"A lactose-modified chitosan accelerates chondrogenic differentiation in mesenchymal stem cells spheroids".

Spheroids derived from human mesenchymal stem cells (hMSCs) are of limited use for cartilage regeneration, as the viability of the cells progressively decreases during the period required for chondrogenic differentiation (21 days). In this work, spheroids based on hMSCs and a lactose-modified chitosan (CTL) were formed by seeding cells onto an air-dried coating of CTL. The polymer coating can inhibit cell adhesion and it is simultaneously incorporated into spheroid structure. CTL-spheroids were characterized from a morphological and biological perspective, and their properties were compared with those of spheroids obtained by seeding the cells onto a non-adherent surface (agar gel). Compared to the latter, smaller and more viable spheroids form in the presence of CTL as early as 4 days of culture. At this time point, analysis of stem cells differentiation in spheroids showed a remarkable increase in collagen type-2 (COL2A1) gene expression (~700-fold compared to day 0), whereas only a 2-fold increase was observed in the control spheroids at day 21. These results were confirmed by histological and transmission electron microscopy (TEM) analyses, which showed that in CTL-spheroids an early deposition of collagen with a banding structure already occurred at day 7. Overall, these results support the use of CTL-spheroids as a novel system for cartilage regeneration, characterized by increased cell viability and differentiation capacity within a short time-frame. This will pave the way for approaches aimed at increasing the success rate of procedures and reducing the time required for tissue regeneration.

A hydrogel system based on a lactose-modified chitosan for viscosupplementation in osteoarthritis.

Osteoarthritis (OA) is a chronic disease affecting joint functionality and often managed with hyaluronic acid (HA) administration. In this study, a hydrogel based on a lactose-modified chitosan (CTL) reticulated with boric acid has been developed as a viscosupplement for OA treatment. The rheological characterization allowed to identify a composition whose properties were in line with those of commercial products (in the order of tens of Pascal). The selected CTL-hydrogel showed biocompatibility and antioxidant activity in vitro, and it did not influence cytokines release by macrophages. Degradation studies carried out over 24 h pointed out its higher resistance to chemical degradation with respect to HA samples. Overall, this study underlines the advantages of the CTL-hydrogel to address the treatment of OA and shed light on an innovative application of CTL polymer, which is one of the main component of the proposed hydrogel system and not used in mixture with other molecules.

Molecular mechanisms driving Streptococcus mitis entry into human gingival fibroblasts in presence of chitlac-nAg and saliva.

The molecular mechanisms leading to Streptococcus mitis capability of entering oral cells were investigated in a co-culture of S. mitis and Human Gingival Fibroblasts (HGFs) in the presence of saliva. An innovative colloidal solution based on silver nanoparticles (Chitlac-nAg), a promising device for daily oral care, was added to the experimental system in order to study the effects of silver on the bacterial overgrowth and ability to enter non-phagocytic eukaryotic cells. The entry of bacteria into the eukaryotic cells is mediated by a signalling pathway involving FAK, integrin ß1, and the two cytoskeleton proteins vinculin and F-actin, and down-regulated by the presence of saliva both at 3 and 48 h of culture, whereas Chitlac-n Ag exposure seems to influence, by incrementing it, the number of bacteria entering the fibroblasts only at 48 h. The formation of fibrillary extrusion from HGFs and the co-localization of bacteria and silver nanoparticles within the fibroblast vacuoles were also recorded. After longer experimental times (72 and 96 h), the number of S. mitis chains inside gingival cells is reduced, mainly in presence of saliva. The results suggest an escape of bacteria from fibroblasts to restore the microbial balance of the oral cavity.

Effects of supercritical carbon dioxide sterilization on polysaccharidic membranes for surgical applications.

Sterilization methods such as ɣ-irradiation, steam sterilization and ethylene oxide gas treatment can have negative effects on molecular structure and properties of polysaccharide-based biomaterials. In this perspective, the use of supercritical carbon dioxide (scCO2) has been proposed as an alternative method for biomaterial sterilization. In this work, chemical, mechanical and biological properties of polysaccharidic membranes for surgical applications were investigated after sterilization by scCO2. Four sets of sterilizing conditions were considered and SEC analyses were performed in order to identify the one with lower impact on the polysaccharidic matrix of membranes (alginate). Mechanical tests showed that the resistance of membranes was slightly affected after sterilization. Biological analyses proved the biocompatibility of the sterilized membranes both in vitro and in a preliminary in vivo test. Overall, this study points out that this sterilization technique can be successfully employed to achieve an effective and safe sterilization of polysaccharidic membranes for surgical use.

Comparison of three different application routes of butyrate to improve colonic anastomotic strength in rats.

INTRODUCTION: Despite extensive research, anastomotic leakage (AL) remains one of the most dreaded complications after colorectal surgery. Since butyrate enemas are known to enhance anastomotic healing, several administration routes have been explored in this study. METHODS: Three intraluminal approaches involving butyrate were investigated: (1) butyrin-elucidating patch, (2) a single injection of hyaluronan-butyrate (HA-But) prior to construction of the proximal anastomosis and (3) rectal hyaluronan-butyrate (HA-But) enemas designed for distal anastomoses. The main outcome was AL and secondary outcomes were bursting pressure, histological analysis of the anastomosis, zymography to detect MMP activity and qPCR for gene expression of MMP2, MMP9, MUC2 and TFF3. RESULTS: Neither the patches nor the injections led to a reduction of AL in experiments 1 and 2. In experiment 3, a significant reduction of AL was accomplished with the (HA-But) enema compared to the control group together with a higher bursting pressure. Histological analysis detected only an increased inflammation in experiment 2 in the hyaluronan injection group compared to the control group. No other differences were found regarding wound healing. Zymography identified a decreased proenzyme of MMP9 when HA-But was administered as a rectal enema. qPCR did not show any significant differences between groups in any experiment. CONCLUSION: Butyrate enemas are effective in the enhancement of colonic anastomosis. Enhanced butyrate-based approaches designed to reduce AL in animal models for both proximal and distal anastomoses were not more effective than were butyrate enemas alone. Further research should focus on how exogenous butyrate can improve anastomotic healing after gastrointestinal surgery.

Enhanced bioadhesivity of dopamine-functionalized polysaccharidic membranes for general surgery applications.

UNLABELLED: An emerging strategy to improve adhesiveness of biomaterials in wet conditions takes inspiration from the adhesive features of marine mussel, which reside in the chemical reactivity of catechols. In this work, a catechol-bearing molecule (dopamine) was chemically grafted onto alginate to develop a polysaccharide-based membrane with improved adhesive properties. The dopamine-modified alginates were characterized by NMR, UV spectroscopy and in vitro biocompatibility. Mechanical tests and in vitro adhesion studies pointed out the effects of the grafted dopamine within the membranes. The release of HA from these resorbable membranes was shown to stimulate fibroblasts activities (in vitro). Finally, a preliminary in vivo test was performed to evaluate the adhesiveness of the membrane on porcine intestine (serosa). Overall, this functionalized membrane was shown to be biocompatible and to possess considerable adhesive properties owing to the presence of dopamine residues grafted on the alginate backbone. STATEMENT OF SIGNIFICANCE: This article describes the development of a mussels-inspired strategy for the development of an adhesive polysaccharide-based membrane for wound healing applications. Bioadhesion was achieved by grafting dopamine moieties on the structural component on the membrane (alginate): this novel biomaterial showed improved adhesiveness to the intestinal tissue, which was demonstrated by both in vitro and in vivo studies. Overall, this study points out how this nature-inspired strategy may be successfully exploited for the development of novel engineered biomaterials with enhanced bioadhesion, thus opening for novel applications in the field of general surgery.

Silver-polysaccharide antimicrobial nanocomposite coating for methacrylic surfaces reduces Streptococcus mutans biofilm formation in vitro.

OBJECTIVES: The aim of this study was to determine the in vitro microbiological performances of a lactose-modified chitosan (Chitlac) coating inside which silver nanoparticles were embedded (Chitlac-nAg) for BisGMA/TEGDMA methacrylic specimens. METHODS: Different concentrations of nAg inside Chitlac coating were tested (1 mM, 2 mM, 5 mM). Specimen surface was analyzed by means of field-emission scanning electron microscopy (FEISEM) and energy-dispersive X-ray spectroscopy (EDS). A 48 h monospecific Streptococcus mutans biofilm was developed over the specimen surfaces using a modified drip-flow bioreactor; adherent viable biomass was assessed by MTT test and biofilm was imaged by confocal laser-scanning microscopy (CLSM). RESULTS: The presence of finely dispersed nanoparticles inside the Chitlac coating was confirmed by FEISEM and EDS analysis. All nanoparticles were embedded in the Chitlac coating layer. Chitlac-nAg coatings were able to significantly decrease biofilm formation depending on the nAg concentration, reaching a -80% viable biomass decrease when the 5 mM nAg-Chitlac group was confronted to non-coated control specimens. CLSM analysis did not provide evidence of a contact-killing activity, however the antibacterial Chitlac-nAg coating was able to alter biofilm morphology preventing the development of mature biofilm structures. CONCLUSIONS: The microbiological model applied in this study helped in assessing the antibacterial properties of a coating designed for methacrylate surfaces. CLINICAL SIGNIFICANCE: A microbiological model based on a bioreactor-grown biofilm is useful for preliminary in vitro tests of dental materials. In translational terms, an antibacterial nanocomposite coating based on Chitlac-nAg and designed to be applied to methacrylic surfaces may be a promising way to obtain dental materials able to actively prevent secondary caries.

Biological responses of silver-coated thermosets: an in vitro and in vivo study.

Bisphenol A glycidylmethacrylate (BisGMA)/triethyleneglycol dimethacrylate (TEGDMA) thermosets are biomaterials commonly employed for orthopedic and dental applications; for both these fields, bacterial adhesion to the surface of the implant represents a major issue for the outcome of the surgical procedures. In this study, the antimicrobial properties of a nanocomposite coating formed by polysaccharide 1-deoxylactit-1-yl chitosan (Chitlac) and silver nanoparticles (nAg) on methacrylate thermosets were studied. The Chitlac-nAg system showed good anti-bacterial and anti-biofilm activity although its biocidal properties can be moderately, albeit significantly, inhibited by serum proteins. In vitro studies on the silver release kinetic in physiological conditions showed a steady metal release associated with a gradual loss of antimicrobial activity. However, after 3weeks there was still effective protection against bacterial colonization which could be accounted for by the residual silver. This time-span could be considered adequate to confer short-term protection from early peri-implant infections. Preliminary in vivo tests in a mini-pig animal model showed good biological compatibility of Chitlac-nAg-coated materials when implanted in bony tissue. The comparison was made with implants of titanium Ti6Al4V alloy and with a Chitlac-coated thermoset. Bone healing patterns and biocompatibility parameters observed for nAg-treated material were comparable with those observed for control implants.

The aggregation of pig articular chondrocyte and synthesis of extracellular matrix by a lactose-modified chitosan.

A reductive amination reaction (N-alkylation) obtained exploiting the aldheyde group of lactose and the amino group of the glucosamine residues of chitosan (d.a. 89%) afforded a highly soluble engineered polysaccharide (chitlac) for a potential application in the repair of the articular cartilage. Chitosan derivatives with 9% and 64% of side chain groups introduced have been prepared and characterized by means of potentiometric titration, (1)H-NMR and intrinsic viscosity. Both polymers, with respect to the unmodified chitosan, induce cell aggregation when in contact with a primary culture of pig chondrocytes, leading to the formation of nodules of considerable dimensions (up to 0.5-1 mm in diameter). The nodules obtained from chondrocytes treated with chitlac with the higher degree of substitution have been studied by means of optical and electron microscopy (SEM, TEM) and the production of glycosaminoglycans (GAGs) and collagen has been measured by means of colorimetric assays. The chondro-specificity of GAG and collagen was determined by RT-PCR. The results show that the lactose-modified chitosan is non-toxic and stimulates the production of aggrecan and type II collagen.

A chicken hnRNP of the A/B family recognizes the single-stranded d(CCCTAA)(n) telomeric repeated motif.

With the aim of identifying proteins able to interact with the C-rich single-stranded telomeric repeated motif, three nuclear polypeptides, CBNP alpha, CBNP beta and CBNP gamma, with apparent mobilities in SDS/PAGE of 38, 44 and 55 kDa, respectively, were isolated from mature chicken erythrocytes by affinity chromatography. In situ UV-cross-linking experiments demonstrated that CBNP alpha and CBNP gamma interact directly with the telomeric d(CCCTAA)n repeat, whereas CBNP beta does not. Moreover, they provided information on the protein components responsible for each electrophoretic mobility-shift assay signal. Ion spray and matrix-assisted laser desorption ionization MS allowed us to identify CBNP alpha with single-stranded D-box-binding factor (ssDBF), a protein previously characterized as a transcription factor belonging to the A/B family of heterogeneous nuclear ribonucleoproteins, and CBNP beta with an isoform of this protein containing an extra exon. Similarly, CBNP gamma was shown to be probably the chicken homolog of hnRNP K, a ribonuclear protein able to bind to polyC oligonucleotides. The relation of CBNP alpha (i.e. ssDBF), CBNP beta and CBNP gamma to a number of similar proteins in the protein and nucleotide sequence databank is discussed. A rather diversified spectrum of functional roles has been assigned to some of these proteins despite the strong sequence homology among them.

Widespread presence in mammals and high binding specificity of a nuclear protein that recognises the single-stranded telomeric motif (CCCTAA)n.

We have recently identified a protein in HeLa nuclear extracts which recognises the single-stranded telomeric sequence (CCCTAA)n in vertebrates [Marsich, E., Piccini, A., Xodo, L. E. & Manzini, G. (1996) Nucleic Acids Res. 24, 4029-4033]. In this paper we provide further experimental evidence, using electrophoretic mobility shift assays, SDS/PAGE after ultraviolet cross-linking, and gel permeation chromatography techniques, that: (a) this protein displays remarkably stringent requirements for the telomeric motif sequence, as (CCCTAAA)n, (CCCCAA)n and (TCCCAA)n are tightly bound, but (CCTAA)n is not; (b) it requires at least four CCC-block repeats properly spaced to bind strongly to DNA, e.g. the polypurine stretch of the murine Ki-ras promoter d(CTCCCTCCCTCCCTCCTTCCCTCCCTCCC), the CarG-motif-containing sequence d(CCATTTCCTAATTAGGTAAAAG), and d(C)22 are not recognised by this protein; (c) it is present in nuclear extracts from several vertebrate sources including human, rat, pig, hamster and chicken; (d) its molecular mass is about 40 kDa, as determined by SDS/ PAGE and non-denaturing gel permeation chromatography, suggesting that this protein is monomeric under native conditions.

Evidence for a HeLa nuclear protein that binds specifically to the single-stranded d(CCCTAA)n telomeric motif.

In recent years several telomere binding proteins from eukaryotic organisms have been identified that are able to recognise specifically the duplex telomeric DNA repeat or the G-rich 3'-ending single strand. In this paper we present experimental evidence that HeLa nuclear extracts contain a protein that binds with high specificity to the single-stranded complementary d(CCCTAA)n repeat. Electrophoretic mobility shift assays show that the oligonucleotide d(CCCTAACCCTAACCCTAACCCT) forms a stable complex with this protein in the presence of up to 1000-fold excesses of single-stranded DNA and RNA competitors, but is prevented from doing so in the presence of its complementary strand. SDS-PAGE experiments after UV cross-linking of the complex provide an estimate of 50 kDa for the molecular weight of this protein.