A peptide derived from enzymatic digestion of globulins from amaranth shows strong affinity binding to the replication origin of Tomato yellow leaf curl virus reducing viral replication in Nicotiana benthamiana.

Tomato yellow leaf curl virus (TYLCV; genus Begomovirus; family Geminiviridae) infects mainly plants of the family Solanaceae, and the infection induces curling and chlorosis of leaves, dwarfing of the whole plant, and reduced fruit production. Alternatives for direct control of TYLCV and other geminiviruses have been reported, for example, the use of esterified whey proteins, peptide aptamer libraries or artificial zinc finger proteins. The two latter alternatives affect directly the replication of TYLCV as well as of other geminiviruses because the replication structures and sequences are highly conserved within this virus family. Because peptides and proteins offer a potential solution for virus replication control, in this study we show the isolation, biochemical characterization and antiviral activity of a peptide derived from globulins of amaranth seeds (Amaranthus hypochondriacus) that binds to the replication origin sequence (OriRep) of TYLCV and affects viral replication with a consequent reduction of disease symptoms in Nicotiana benthamiana. Aromatic peptides obtained from papain digests of extracted globulins and albumins of amaranth were tested by intrinsic fluorescent titration and localized surface resonance plasmon to analyze their binding affinity to OriRep of TYLCV. The peptide AmPep1 (molecular weight 2.076 KDa) showed the highest affinity value (Kd = 1.8 nM) for OriRep. This peptide shares a high amino acid similarity with a part of an amaranth 11S globulin, and the strong affinity of AmPep1 could be explained by the presence of tryptophan and lysine facilitating interaction with the secondary structure of OriRep. In order to evaluate the effect of the peptide on in vitro DNA synthesis, rolling circle amplification (RCA) was performed using as template DNA from plants infected with TYLCV or another begomovirus, pepper huasteco yellow vein virus (PHYVV), and adding AmPep1 peptide at different concentrations. The results showed a decrease in DNA synthesis of both viruses at increasing concentrations of AmPep1. To further confirm the antiviral activity of the peptide in vivo, AmPep1 was infiltrated into leaves of N. benthamiana plants previously infected with TYLCV. Plants treated with AmPep1 showed a significant decrease in virus titer compared with untreated N. benthamiana plants as well as reduced symptom progression due to the effect of AmPep1 curtailing TYLCV replication in the plant. The peptide also showed antiviral activity in plants infected with PHYVV. This is the first report, in which a peptide is directly used for DNA virus control in plants, supplied as exogenous application and without generation of transgenic lines.

A novel begomovirus isolated from sida contains putative cis- and trans-acting replication specificity determinants that have evolved independently in several geographical lineages.

A novel begomovirus isolated from a Sida rhombifolia plant collected in Sinaloa, Mexico, was characterized. The genomic components of sida mosaic Sinaloa virus (SiMSinV) shared highest sequence identity with DNA-A and DNA-B components of chino del tomate virus (CdTV), suggesting a vertical evolutionary relationship between these viruses. However, recombination analysis indicated that a short segment of SiMSinV DNA-A encompassing the plus-strand replication origin and the 5´-proximal 43 codons of the Rep gene was derived from tomato mottle Taino virus (ToMoTV). Accordingly, the putative cis- and trans-acting replication specificity determinants of SiMSinV were identical to those of ToMoTV but differed from those of CdTV. Modeling of the SiMSinV and CdTV Rep proteins revealed significant differences in the region comprising the small ß1/ß5 sheet element, where five putative DNA-binding specificity determinants (SPDs) of Rep (i.e., amino acid residues 5, 8, 10, 69 and 71) were previously identified. Computer-assisted searches of public databases led to identification of 33 begomoviruses from three continents encoding proteins with SPDs identical to those of the Rep encoded by SiMSinV. Sequence analysis of the replication origins demonstrated that all 33 begomoviruses harbor potential Rep-binding sites identical to those of SiMSinV. These data support the hypothesis that the Rep ß1/ß5 sheet region determines specificity of this protein for DNA replication origin sequences.

Tomato infectious chlorosis virus Associated with Tomato Diseases in Baja California, Mexico.

Tomato (Solanum lycopersicum L.) is an important vegetable crop in Mexico. The national production in 2009 was 2,043,814 metric tons with a value of $163,560,636 US. Since 2007, abnormal yellow and crispy leaves were observed in commercial tomato fields in Ensenada County, Baja California, Mexico. In affected fields from two localities (San Quintín Valley and Ensenada), symptomatic plants were randomly distributed and symptoms resembled previous descriptions of crinivirus infections in tomato (3). The symptoms and the presence of whiteflies (Bemisia tabaci and Trialeurodes vaporariorum) in the affected fields suggested a viral etiology. Leaf samples of 143 symptomatic tomato plants were collected in the 2007 and 2008 growing seasons. Total RNA was extracted and analyzed by reverse transcription (RT)-PCR assay for simultaneous detection of Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV). Degenerate primers (HS-11/HS-12) were used in combination with specific primers (TIC-3/TIC-4 and ToC-5/ToC-6) for detection of these viruses by nested-PCR (2). A PCR fragment of the expected size for TICV (223 bp) was amplified in 26 of 143 samples. None of the samples tested positive for ToCV. In addition, considering that whiteflies are vectors of begomoviruses, samples were also tested for presence of viral DNA. Results showed 30 positive samples and one with mixed infection. It is therefore possible that the viral disease symptoms observed could be caused in part by viruses other than TICV. Three amplicons from RT-PCR of tomato samples were cloned into the pGEM-T easy vector system II (Promega Corporation, Madison, WI) and sequenced. The sequence of one amplicon (GenBank Accession No. FJ609651) was compared with the sequences of other criniviruses reported in the NCBI/GenBank database using the Clustal V alignment method of the sequence analysis software suite Lasergene (MegAling, DNASTAR Inc., Madison, WI). Sequence analysis of the 223-bp PCR fragment corresponding to TICV showed 99.1% identity with a TICV isolate from Japan (GenBank Accession No. AB085602) and 100% identity with TICV isolates from the United States (GenBank Accession No. TIU67449). Although the presence of another crinivirus, ToCV, was reported previously in Mexico associated with tomato crops and two native weeds, S. nigrescens and Datura stramonium (1), this virus was not detected in Baja California during the present work. To our knowledge, this is the first report of TICV associated with tomato diseases in Mexico. The emerging of a previously unreported virus disease in tomato production areas of Mexico complicates disease management efforts. References: (1) P. Álvarez-Ruíz et al. Plant Pathol. 56:1043, 2007. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) G. C. Wisler et al. Plant Dis. 82:270, 1998.

Genetic Diversity and Geographical Distribution of Phytoplasmas Associated with Potato Purple Top Disease in Mexico.

Potato purple top (PPT) disease has caused severe economic losses in some potato (Solanum tuberosum) growing areas of Mexico. Two distinct phytoplasma strains belonging to the aster yellows and peanut witches'-broom groups (16SrI and 16SrII groups) have been associated with PPT disease in several regions of Mexico. However, there has been no previous large-scale survey in the main potato growing areas in Mexico to analyze the diversity and geographical distribution of phytoplasmas. Potato samples were collected between 2003 and 2006 and were analyzed by nested polymerase chain reaction assays. On the basis of results from nucleotide sequence comparisons and virtual restriction fragment length polymorphism analysis of 16S rDNA, four different phytoplasma groups were detected in potato growing areas in Mexico. The aster yellows group (16SrI) 'Candidatus Phytoplasma asteris' was distributed in all potato growing areas, whereas peanut witches'-broom group (16SrII) 'Candidatus Phytoplasma aurantifolia' was detected in Guanajuato and Sinaloa, X-disease group (16SrIII) was detected in Coahuila and Guanajuato, and the Mexican periwinkle virescence (16SrXIII) was only detected in Sinaloa. Phytoplasmas from X-disease and Mexican periwinkle virescence groups were detected in potato samples for the first time in Mexico.

Tomatillo (Physalis ixocarpa) as a Natural New Host for Tomato yellow leaf curl virus in Sinaloa, Mexico.

Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of $259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 83:1178, 1999. (2) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (3) C. Gámez-Jímenez et al. (Abstr.) Phytopathology 96(suppl.):S38. 2006.

Detection and Molecular Characterization of Two Little Leaf Phytoplasma Strains Associated with Pepper and Tomato Diseases in Guanajuato and Sinaloa, Mexico.

Pepper (Capsicum annuum) and tomato (Lycopersicon esculentum) are important vegetable crops in Mexico. Recently, symptoms associated with phytoplasma diseases such as witches'-broom (shoot proliferation) and little leaf were observed in pepper and tomato fields in central and northwestern Mexico. DNA extracted from symptomatic and asymptomatic plants was used in nested polymerase chain reaction (PCR) assays with primers amplifying 16S rDNA sequences for phytoplasmas. Twenty-four percent of pepper and 49% of tomato samples yielded a nested rDNA product of 1.25 kb. Restriction fragment length polymorphism profiles and sequencing of PCR products allowed classification of the detected phytoplasmas with the aster yellows group (16SrI). Both phytoplasmas, pepper little leaf (PeLL) and tomato little leaf (ToLL), could be included as new members of the aster yellows group because HaeIII and TaqI restriction enzymes discriminated among these phytoplasmas and members of other 16SrI subgroups. PeLL and ToLL phytoplasma sequences were deposited and compared with those in GenBank, and the maximum identity was found with several isolates of 'Candidatus Phytoplasma asteris'. The highest identity (99%) has been observed with tomatillo little leaf phytoplasma and ash witches'-broom phytoplasma. This is the first report of 'Ca. Phytoplasma asteris' associated with pepper and tomato diseases in the Mexican states of Guanajuato and Sinaloa.

A Begomovirus Isolated from Chlorotic and Stunted Soybean Plants in Mexico is a New Strain of Rhynchosia golden mosaic virus.

Soybean (Glycine max Merr.) is an alternative crop during the summer in Sinaloa, a northern state of Mexico. During the last 4 years, symptoms of yellowing, curled leaves, and stunting have been observed on soybean plantings, and a scrutiny of field samples collected in 2003 identified a begomovirus related to Pepper golden mosaic virus in symptomatic plants (4). A new survey was conducted during the summer of 2004 when the soybean disease was prevalent in the region. Affected plants appeared as patches displaying symptoms ranging from mild to severe yellow mosaic with leaf deformation and stunted growth in several parcels of commercial fields of northern Sinaloa. More than 100 samples from symptomatic soybean plants and weeds growing within the same fields were collected and analyzed for the presence of begomoviruses using DNA hybridization with the coat protein gene of Pepper huasteco yellow vein virus as a probe. Thirty-eight soybean, 12 Rhynchosia sp., and 14 sunflower hybridization-positive samples were subsequently used for polymerase chain reaction (PCR) amplification with the degenerate primers pRep-DGR and pCP70-Mot (1). PCR products were cloned into pGEM-T Easy vector (Promega, Madison, WI) and sequenced. The amplified viral DNA (915 nt) from two soybean plants, Sb1 and Sb2 (GenBank Accession Nos. AY955101 and AY957561, respectively), one isolate from Rhynchosia minima (GenBank Accession No. AY955102), and one from Heliantus annum (GenBank Accession No. AY957560) were sequenced and compared with DNA sequences available at NCBI database using BLAST. The highest sequence similarity was obtained with the two known isolates of Rhynchosia golden mosaic virus, RhGMV [Honduras] (GenBank Accession No. AF239671), and RhGMV [Chiapas] (GenBank Accession No. AF408199), displaying a nucleotide identity of approximately 89% with the Sinaloa isolates. Sequence comparisons of the latter isolates showed that viruses in the weeds were 97% identical to one of the soybean isolates, RhGMV-Sb1, but differed significantly (88% of nucleotide identity) from the second soybean isolate, RhGMV-Sb2. The complete genome A sequence of RhGMV-Sb1 was determined using PCR amplification of viral DNA with four degenerate primers recently described (2), cloning of overlapping PCR products into pGEM-T Easy vector (Promega) and sequencing. The 2,604-bp DNA-A of RhGMV-Sb1 (GenBank Accession No. DQ347950) was compared with the homologous genome of RhGMV [Chiapas] and RhGMV [Honduras] using the CLUSTAL alignment method (MegAlign, DNASTAR software, London) and an overall nucleotide identity of 89.2 and 88.6%, respectively, was determined. Current taxonomic criteria for begomoviruses establish that a DNA-A sequence identity lower than 93% with other isolates of a virus is indicative of a separate strain (3). Therefore, the virus identified in this study is a new strain of RhGMV that is provisionally named Rhynchosia golden mosaic virus-Soybean [Mexico:Sinaloa:2004]. This is the first soybean-infecting begomovirus from the American continent whose genome A has been completely characterized as of today. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (2) R. De La Torre-Almaraz et al. Plant Dis. 90:378, 2006. (3) C. Fauquet et al. Arch. Virol. 150:2151, 2005. (4) J. Mendez-Lozano et al. Plant Dis. 90:109, 2006.

A Begomovirus Associated with Leaf Curling and Chlorosis of Soybean in Sinaloa, Mexico is Related to Pepper golden mosaic virus.

Since June 2001, symptoms of yellowing, leaf curling, crumpling, and stunted growth were observed on soybean (Glycine max Merr.) plants in Sinaloa, Mexico. These symptoms and the presence of whiteflies (Bemisia tabaci Gennadius) in the affected fields suggested a viral etiology. Samples from symptomatic plants were collected from commercial fields and analyzed for the presence of begomoviruses using DNA hybridization, and as a probe, the DNA A of Pepper huasteco virus at low stringency (2). Thirty-five positive samples were subsequently used for polymerase chain reaction (PCR) amplification with the degenerate primers RepMot and CPMot (1). These primers direct the amplification of a DNA A segment comprising the entire intergenic region (IR) and the first 210 bp of the coat protein (CP) gene, which is highly variable in size and nucleotide sequence among begomoviruses. PCR products were obtained for 25 of 35 samples and five of these were cloned into the pGEM-T easy vector (Promega, Madison, WI) and sequenced. The 571-bp DNA sequence (GenBank Accession No. AY905553) was compared with sequences of other begomoviruses in GenBank using the Clustal alignment method (MegAlign, DNASTAR software, London). The sequence was 74 and 70% identical to the Pepper golden mosaic virus (PepGMV; GenBank Accession No. U57457) and Cabbage leaf curl virus (CaLCuV; GenBank Accession No. U65529) sequences, respectively. Interestingly, the partial coat protein gene sequence (210 nt) of this soybean-infecting virus was 98% identical to the CP gene of Tobacco apical stunt virus (TbASV; GenBank Accession No. AF076855). Nonetheless, the known sequence of TbASV intergenic region (GenBank Accession No. AF077744) is very different from the homologous region of the soybean virus (34% of nucleotide identity). Analysis of the soybean virus intergenic region revealed that it harbors almost identical iterons (i.e., Rep-binding sites) to PepGMV, suggesting a close relationship between these two viruses. Soybean-infecting geminiviruses have been previously reported only from Asia; however, the partial sequence of a begomovirus isolated from soybean in Brazil was recently deposited in Genbank (Accession No. AY436328). Sequence comparisons between the Brazilian and Mexican isolates showed these viruses are less related with a nucleotide identity of 46%. Taken together, our data indicate that the virus identified in this study might be either a different strain of PepGMV adapted to leguminous plants or a new begomovirus species. To our knowledge, this is the first report of a begomovirus infecting soybean in Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (2) J. Méndez-Lozano et al. Phytopathology 93:270, 2003.

First Report of a Geminivirus Inducing Yellow Mottle in Okra (Abelmoschus esculentus) in Mexico.

Okra is an annual vegetable species native to Africa. In Mexico, the states of Tamaulipas, Guerrero, and Morelos contain the most important okra-producing areas. Viral-like diseases have recently affected the fruit production. In the field, the most common symptoms encountered include yellow streak, distortion of fruits, and foliar yellow mottle. Total DNA extracts from symptomatic okra plants were used as a template for polymerase chain reaction (PCR)-based detection using begomovirus-specific primers. RepMot and CPMot primers (1) were used for the amplification of DNA fragments that included the Rep and coat protein (CP) genes of begomoviruses. PCR results suggested the presence of a begomovirus in symptomatic plants. Southern and dot blot hybridization analysis were performed using a DNA fragment containing the CP gene of Pepper huasteco virus as a probe. Hybridization conducted under low stringency conditions confirmed the presence of a geminivirus. Additionally, transmission by grafting and biolistic (total DNA extracts from symptomatic plants) inoculations induced consistently severe streak fruits and yellow mottle symptoms in okra plants. Cloning of the PCR products (approximately 632-bp fragment) was performed in the PCRTopo vector (Invitrogen, San Diego, CA). Cloned viral inserts were sequenced (Genbank Accession No. AF349113). Nucleotide sequence comparisons were performed using the Clustal Method (MegAlign, DNAStar software, Madison, WI) with the GenBank database. Analysis of the PCR products confirmed the begomovirus nature of the sequence. The first 64 amino acids of the CP had 89% identity with Squash leaf curl virus while the intergenic region had 85% identity with Sida golden mosaic virus. To our knowledge, this is the first report of a begomovirus infecting okra in Mexico. Reference: 1) J. T. Ascencio et al. Plant Dis. 86:692, 2002.

Interactions Between Geminiviruses in a Naturally Occurring Mixture: Pepper huasteco virus and Pepper golden mosaic virus.

ABSTRACT Pepper huasteco virus (PHV) and Pepper golden mosaic virus (PepGMV) are found in mixtures in many horticultural crops in Mexico. This combination constitutes an interesting, naturally occurring model system to study several aspects of virus-virus interactions. Possible interactions between PHV and PepGMV were studied at four levels: symptom expression, gene expression, replication, and movement. In terms of symptom expression, the interaction was shown to be host-dependent because antagonism was observed in pepper, whereas synergism was detected in tobacco and Nicotiana benthamiana. PHV and PepGMV did not generate viable pseudorecombinant viruses; however, their replication is increased during mixed infections. An asymmetric complementation in movement was observed because PHV was able to support the systemic movement of PepGMV A whereas PepGMV did not support the systemic distribution of PHV A. Heterologous transactivation of both coat protein promoters also was detected. Several conclusions can be drawn from these experiments. First, viruses coinfecting the same plant can interact at several levels (replication, movement) and in different manners (synergism, antagonism); some interactions might be host dependent; and natural mixed infections could be a potential source of geminivirus variability by generating viable tripartite combinations that could facilitate recombination events.

First Report of Rhynchosia golden mosaic virus (RhGMV) Infecting Tobacco in Chiapas, Mexico.

After a tobacco virus outbreak associated with whiteflies in Chiapas, Mexico, we conducted a survey to detect the presence of begomoviruses. Previously, two tobacco-infecting geminiviruses were reported in the same geographical area: Texas pepper virus-Chiapas and Tobacco apical stunt virus (TPV-CPS and TbASV, respectively) (2). DNA extracts from symptomatic tobacco plants (yellow mosaic, severe foliar distortion, and dwarfing) were used to biolistically inoculate tobacco plants (1). After symptom expression, the viruses were analyzed by polymerase chain reaction (PCR) and sequencing. For the first PCR procedure, the primers used (RepMot: 5'GAGTCTAGAGGATANGTRAGGAAATARTTCTT GGC3' and CPMot: 5'CGCGAATTCGACTGGACCTTACATGGNCCTT CAC3') were designed from conserved regions of the Rep and CP genes, and directed the amplification of a fragment that includes the intergenic region and varies in size from 600 (for New World begomoviruses) to 750 bp (Old World begomoviruses). Cloning of the PCR products (approximately 600 bp) was performed in the pCRII vector (Invitrogene, San Diego, CA), and viral inserts derived from different symptomatic plants were sequenced. Nucleotide sequence comparisons were performed using the Clustal method (MegAlign, DNAStar software, Madison, WI) with GenBank databases. Analysis of the PCR products allowed the identification of two types of viral sequences. The first virus identified was 98% identical to TPV-CPS, whereas the second virus was clearly related to Rhynchosia golden mosaic virus (RhGMV; 91% identity in the amplified region), and 65% identical to Pepper Huasteco virus (PHV). To disclose the identity of the second virus, another set of primers was used, p260 and p261 (4). These primers are located back-to-back in a conserved region of the CP gene, and direct the amplification of a full-length DNA-A from circular templates. The resulting PCR fragment (2.6 kb) was cloned in pCRII and fully sequenced (GenBank Accession No. AF408199). Analysis showed that this tobacco-infecting geminivirus is a strain of the recently described RhGMV from Honduras (3) (overall DNA A sequence identity, 94%; protein similarities: CP, 98.4%; AL1, 93.6%; AL2, 92.8%; and AL3, 91.7%). Comparative analysis of the intergenic regions of RhGMV-Tob, TPV-CPS, and TbASV showed that these viruses display different Ori-associated iterative motifs (iterons): RhGMV-Tob (GGTRT/G), TPV-CPS (GGAGTC), and TbASV (GGTAT). Since iterons are critical determinants of replication specificity, this observation indicates that those viruses are probably unable to form infectious pseudorecombinants in nature. To date, at least three different geminiviruses have been identified from symptomatic tobacco samples in Chiapas (2), showing how complex a geminiviral outbreak can be in a permissive environment. To our knowledge, this is the first time that the presence of RhGMV has been reported in Mexico and also the first time that this virus has been associated with an economically important crop. References: (1) J. Garzon-Tiznado et al. Phytopathology 83:514, 1993. (2) M. Paxidamis et al. Arch. Virol. 144:703, 1999. (3) J. L. Potter et al. Plant Dis. 84:1045, 2000. (4) I. Torres-Pacheco et al. Phytopathology 86:1186, 1996.

Pepper huasteco virus and Pepper golden mosaic virus are Geminiviruses Affecting Tomatillo (Physalis ixocarpa) Crops in Mexico.

Whitefly-transmitted geminivirus diseases cause important losses in several horticultural crops in all areas in Mexico (1). Tomatillo is important in the Mexican diet since it is widely used to prepare many types of salsas and other dishes. As a result, tomatillo, also known as tomate verde (green tomato), is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Morelos, Puebla, and Michoacán. Leaf samples of 105 tomatillo plants exhibiting yellowing, yellowing mosaic, leaf curl, bunchy top, and stunting were collected from the states of Puebla, Morelos, Estado de México, and Sinaloa. Symptomatic plants were associated with the presence of whiteflies in many fields and suggested a viral etiology. Total DNA extracted from symptomatic tomatillo plants was used as a template in a polymerase chain reaction (PCR)-based geminivirus detection procedure. MP16 and MP82 primers (2) were used to direct the amplification of a segment from the stem-loop structure in the intergenic region (IR) to a conserved region in the coat protein (CP) of begomoviruses (2). Sixty-nine percent (72/105) of the samples produced the expected PCR fragment (400 to 450 bp). Similar results were obtained with a dot-blot hybridization procedure using as a probe the component A of Pepper huasteco virus (PHV) under low stringency conditions. More than 50 PCR products were cloned and sequenced. Sequence analysis (nucleotide level for the IR; amino acid level for the CP) revealed that the tomatillo-infecting geminiviruses clustered into two main groups. The first group showed a high percent identity (average of 95.3% at the CP N terminus) to PHV, whereas the second showed a similarly high percent (average 93.8%) identity to Pepper golden mosaic virus (PepGMV, previously called Texas pepper geminivirus. Both PepGMV and PHV were found in all sampled areas. Although mixed infections (differentiated by the respective IR probes) of PHV and PepGMV were common (61%), single infections were also detected (PHV 27%; PepGMV 10%). The presence of begomoviruses in tomatillo crops has been previously reported (1); however, their identity as PHV and PepGMV was not confirmed. References: (1) I. Torres-Pacheco et al. Phytopathology 86:1186, 1996. (2) P. Umaharan et al. Phytophatology 88:1262, 1998.

First Report of Tomato Yellow Leaf Curl Geminivirus in Yucatán, México.

Geminiviruses are probably the most important viral pathogen affecting tomatoes and other crops in the Caribbean region. In addition to losses previously caused by native virus populations, the introduction of tomato yellow leaf curl virus (TYLCV) into the area has become a major concern for tomato growers (1). Since the detection of TYLCV in Cuba, and later in Florida (2,3), we have been monitoring the tomato- and pepper-growing areas of the Yucatán Peninsula, México, for TYLCV. We also have reanalyzed samples previously collected. Other geminiviruses (pepper huasteco virus [PHV], Texas pepper virus [TPV], and tomato mottle virus [ToMoV]) in the area can cause symptoms similar to those induced by TYLCV, which led us to refine our analysis of samples, using a polymerase chain reaction (PCR) procedure that can differentiate between monopartite and bipartite begomoviruses based on the size of the amplification product, 750 and 600 bp, respectively. One advantage of using this set of primers is that the PCR product, which includes the amino terminus of the Rep protein, intergenic region, precoat protein, and amino terminus of the coat protein, can be sequenced completely with only one sequencing reaction from each end. Using the primer set, we analyzed samples collected from tomato and pepper fields (as well as from weeds surrounding the fields) from December 1996 until March 1999. In most cases, samples were taken from plants that showed yellowing, curling, and stunting symptoms. Most of the samples that were positive for geminiviruses came from plants infected with PHV or TPV. However, three tomato samples collected during two seasons in Dzidzantun and Yobain counties (northeast of Mérida, Yucatan) produced the larger PCR amplification product (750 bp) expected for monopartite begomoviruses. PCR products were cloned and sequenced to confirm their identity. The sequence was deposited in the GenBank Database (Accession no. AF168709) and compared with all geminivirus sequences deposited in the database. Analysis showed that the amplified fragment from the TYLCV strain present in the Yucatán is 99% identical to the isolate reported in the Dominican Republic and later found in Cuba (2). As previously noted, the isolate is almost identical to TYLCV-Isr (2). In addition to the PCR product, a full-length TYLCV clone was obtained directly from DNA extracts of an infected tomato plant. Further characterization of the full-length clone is underway. The fact that TYLCV was detected in two counties and in samples collected during two seasons confirms the presence of TYLCV in the Yucatán. Interestingly, although the first positive sample for TYLCV was collected during the winter of 1996 and 1997, current incidence is rather low-only two other positive samples have been detected in more recently collected samples. Perhaps the characteristics of the agriculture system in the Yucatán (small, disperse plots) or the presence of other geminiviruses have contributed to a slow spread of the virus. More comprehensive surveys are required to confirm the actual distribution of the pathogen in the area. References: (1) J. E. Polston et al. Plant Dis. 81:1358, 1997. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) P. L. Ramos et al. Plant Dis. 80:1208, 1996.

Stable transformation of barley tissue culture by particle bombardment.

Suspension culture cells of barley (Hordeum vulgare L. cv Pokko) were stably transformed with two separate plasmids containing genes coding for neomycin phosphotransferase II and ß-glucuronidase, respectively. Transformed cultures were selected with the antibiotic Geneticin(R). Enzymatic activity was tested in the Geneticin(R) resistant cultures, and in 96% of them neomycin phosphotransferase could be detected. The non-selected marker, detected as ß-glucuronidase activity, was expressed in 40% of the resistant cultures. Stable transformation was confirmed with Southern blot hybridization.