Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae).

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Effects of UVB irradiance on conidia and germinants of the entomopathogenic Hyphomycete Metarhizium anisopliae: a study of reciprocity and recovery.

We tested the effects of irradiances of 920 and 1200 mW m-2 (weighted irradiance) on the conidia and germinants of the entomopathogenic Hyphomycete Metarhizium anisopliae. The conidia were exposed to the two irradiances for 1, 2, 4, 6, 7 or 8 h. Increased exposure decreased relative percent culturability. The inactivation provoked by the irradiance of 1200 mW m-2 was higher than for the 920 mW m-2, with a reduction in the 50% lethal time (LT50) from 6 h 40 min to 4 h 26 min. Reciprocity was not observed when conidia in water suspension and germinants in different stages of the germinative process were exposed to a 17.3 kJ m-2 total dose at both irradiance levels. Although nonreciprocity was observed in all situations, its magnitude varied as a function of metabolic state and/or cell-cycle phase in which the conidia were at the exposure time. The least difference between the effects of the two irradiance levels was observed when nongerminating conidia in suspension were exposed, and the greatest was observed when conidia were exposed during an advanced germination phase. Doses of 6.6 and 17.3 kJ m-2 supplied through the two irradiance levels delayed the germination of the surviving conidia. At both doses, delay was greater during exposure to the higher irradiance. Nonreciprocity was higher for the 17.3 kJ m-2 dose. Nonreciprocity magnitude, in addition to depending on the conidial physiological state, also depended on dose. The results demonstrate the importance of evaluating the impact of the increase in irradiance during the different stages of the fungal life cycle, especially during the stages which are more sensitive to UV, and not simply in dormant conidia.

Oxygen consumption by Metarhizium anisopliae during germination and growth on different carbon sources.

Respirometry was used to monitor the germination and growth of the entomopathogenic deuteromycete Metarhizium anisopliae on media containing carbon sources of different kinds (monosaccharides, polysaccharides, amino acids, and proteins). As also observed in several other species of fungi, M. anisopliae germination was found to be marked by a significant increase in O(2) consumption, which started a few hours before germ tube emergence. The exponential consumption of the carbon source and O(2) coincided with the exponential growth phase of the cultures. QO(2) reached a maximum value during the exponential growth phase and was drastically reduced after the depletion of the exogenous carbon source. Taking glucose as reference, we observed that casein, hydrolyzed casein, and N-acetylglucosamine accelerated germination, reduced the lag phase, and increased the growth rate. This fact demonstrates that the fungus can readily use amino acids and N-acetylglucosamine, which are the monomers of the major constituents of the insect cuticle (proteins and chitin), a property that represents an important physiological adaptation to entomopathogenicity.

Electrophoretic variation in esterases in 3 wild-type and respective mutant strains of Aspergillus flavus.

Wild-type strains and auxotrophic mutants of Aspergillus flavus, differing regarding aflatoxin production, were tested for esterases isozymes. Esterases variation was found in all strains used, and a possible correlation between the pattern of esterase bands and aflatoxin production is suggested.