Biochemical and molecular tools reveal two diverse Xanthomonas groups in bananas.

Xanthomonas campestris pv. musacearum (Xcm) causing the banana Xanthomonas wilt (BXW) disease has been the main xanthomonad associated with bananas in East and Central Africa based on phenotypic and biochemical characteristics. However, biochemical methods cannot effectively distinguish between pathogenic and non-pathogenic xanthomonads. In this study, gram-negative and yellow-pigmented mucoid bacteria were isolated from BXW symptomatic and symptomless bananas collected from different parts of Uganda. Biolog, Xcm-specific (GspDm), Xanthomonas vasicola species-specific (NZ085) and Xanthomonas genus-specific (X1623) primers in PCR, and sequencing of ITS region were used to identify and characterize the isolates. Biolog tests revealed several isolates as xanthomonads. The GspDm and NZ085 primers accurately identified three isolates from diseased bananas as Xcm and these were pathogenic when re-inoculated into bananas. DNA from more isolates than those amplified by GspDm and NZ085 primers were amplified by the X1623 primers implying they are xanthomonads, these were however non-pathogenic on bananas. In the 16-23 ITS sequence based phylogeny, the pathogenic bacteria clustered together with the Xcm reference strain, while the non-pathogenic xanthomonads isolated from both BXW symptomatic and symptomless bananas clustered with group I xanthomonads. The findings reveal dynamic Xanthomonas populations in bananas, which can easily be misrepresented by only using phenotyping and biochemical tests. A combination of tools provides the most accurate identity and characterization of these plant associated bacteria. The interactions between the pathogenic and non-pathogenic xanthomonads in bananas may pave way to understanding effect of microbial interactions on BXW disease development and offer clues to biocontrol of Xcm.

Specific PCR-based detection of Alternaria helianthi: the cause of blight and leaf spot in sunflower.

Alternaria helianthi is an important seed-borne pathogenic fungus responsible for blight disease in sunflower. The current detection methods, which are based on culture and morphological identification, are time-consuming, laborious and are not always reliable. A PCR-based diagnostic method was developed with species-specific primers designed based on the sequence data of a region consisting of the 5.8S RNA gene and internal transcribed spacers-ITS 1 and ITS 2 of nuclear ribosomal RNA gene (rDNA) repeats of A. helianthi. The specificity of the primer pairs AhN1F and AhN1R designed was verified by PCR analysis of DNA from 18 Alternaria helianthi strains isolated from India, 14 non-target Alternaria spp. and 11 fungal isolates of other genera. A single amplification product of 357-bp was detected from DNA of A. helianthi isolates. No cross-reaction was observed with any of the other isolates tested. The detection limit of the PCR method was of 10 pg from template DNA. The primers could also detect the pathogen in infected sunflower seed. This species-specific PCR method provides a quick, simple, powerful and reliable alternative to conventional methods in the detection and identification of A. helianthi. This is the first report of an A. helianthi-specific primer set.

Five Species of Xanthomonads Associated with Bacterial Leaf Spot Symptoms in Tomato from Tanzania.

From 2008 to 2010, leaf spot symptoms were observed on tomato (Solanum lycopersicum Mill.) plants growing in the northern, central and southern highland regions of Tanzania. Symptoms were dark, circular to irregular, water-soaked spots surrounded by chlorotic halos. A total of 136 yellow-pigmented, gram-negative bacteria were isolated from 117 symptomatic plants on nutrient agar. Loopfuls from 24-h-old bacterial cultures were suspended in 500 µl of sterile distilled water and 50 µl of the suspensions were printed on strips of 3MM Whatman chromatography paper. Isolates belonging to the genus Xanthomonas were subsequently identified by PCR amplification of a 402-bp fragment of the Xanthan synthesis pathway gene, gumD (primers: X-gumD-fw 5'GGCCGCGAGTTCTACATGTTCAA and X-gumD-rv 5'CACGATGATGCGGATATCCAGCCACAA). Thirty of the 136 isolates reacted positively in gumD PCR. Pathogenicity of the 30 gumD-positive isolates was confirmed by spraying cell suspensions containing 108 CFU/ml (OD600 = 0.01) of each isolate on four 14-day-old tomato seedlings (cv. Tanya) and sweet pepper (Capsicum annuum L.) cv. Early-Calwonder in a growth chamber at 28 ± 2°C and maintained under humid conditions. Plants sprayed with X. euvesicatoria, X. vesicatoria, X. perforans, and X. gardneri (2) strains NCPPB 2968, 422, 4321, and 881, respectively, served as positive controls. Plants sprayed with sterile distilled water alone served as negative control. The 30 tested isolates were pathogenic on tomato and pepper within 7 to 14 days and induced similar symptoms as those observed on tomato field plants and plants sprayed with reference strains of xanthomonads. Symptoms were not observed on negative control plants. Yellow-pigmented colonies were reisolated from symptomatic plants and their identity confirmed with GumD-PCR. Based on partial sequencing of the fyuA gene using primers developed by Young et al. (4), all 30 isolates were subsequently grouped into five clusters of the genus Xanthomonas. With recent taxonomy of Xanthomonas (2,4), four of these clusters displayed more than 99% sequence identity to known species of Xanthomonas: X. arboricola EU498923 (18 isolates); X. perforans EU498944 (6 isolates), X. vesicatoria EU498876 (2 isolates), and X. euvesicatoria EU498912 (1 isolate). The remaining three isolates formed a fifth cluster displaying less than 94% sequence identity to any known sequence of fyuA (93% matching strains: X. axonopodis EU498914; X. melonis EU498918, and X. cucurbitae EU498891). Representative sequences for each of the five clusters of bacterial leaf spot (BLS) strains mentioned have been deposited in GenBank (Nos. JQ418487, JQ418488, JQ418489, JQ418490, and JQ418491, respectively). BLS of tomato plants and its economic impact has been reported in Tanzania (3). Different BLS causal agents have recently been reported from the Southwest Indian Ocean Region (1), however, corresponding information for Tanzania has been lacking. On the basis of fyuA sequences, this study reports four genotypes of BLS causal agents corresponding to known species of Xanthomonas. In addition, Xanthomonas isolates with a fyuA genotype not previously assigned to any known species has been identified as part of the BLS pathosystem in Tanzania. References: (1) A. A. Hamza et al. Plant Dis. 94:993, 2010. (2) B. J. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (3) K. C. Shenge et al. Afr. J. Biotechnol. 6:15, 2007. (4) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Prospects of molecular markers in Fusarium species diversity.

Recent developments in genomics have opened up for newer opportunities to study the diversity and classification of fungi. The genus Fusarium contains many plant pathogens that attack diverse agricultural crops. Fusarium spp. are not only pathogenic to plants but are also known as toxin producers that negatively affect animal and human health. The identification of Fusarium species still remains one of the most critical issues in fungal taxonomy, given that the number of species recognized in the genus has been constantly changing in the last century due to the different taxonomic systems. This review focuses of various molecular-based techniques employed to study the diversity of Fusarium species causing diseases in major food crops. An introduction of fusarial diseases and their mycotoxins and molecular-marker-based methods for detection introduce the concept of marker application. Various well-known molecular techniques such as random amplified polymorphic DNA, amplification fragment length polymorphism, etc. to more modern ones such as DNA microarrays, DNA barcoding, and pyrosequencing and their application form the core of the review. Target regions in the genome which can be potential candidates for generation of probes and their use in phylogeny of Fusarium spp. are also presented. The concluding part emphasizes the value of molecular markers for assessing genetic variability and reveals that molecular tools are indispensable for providing information not only of one Fusarium species but on whole fungal community. This will be of extreme value for diagnosticians and researchers concerned with fungal biology, ecology, and genetics.

Recent Outbreaks of Black Rot of Brassicas Caused by Xanthomonas campestris pv. campestris in Southern Mozambique.

In August and September of 2007, black rot symptoms were observed on seedbed and field plants of Brassica spp. grown in the southern districts of Boane, Mahotas, and Chòkwé in Mozambique. One hundred eighty-two cabbage-growing households were evaluated for the incidence of Xanthomonas campestris pv. campestris. Five Brassica cultivars, Glory F1, Glory of Enkhuizen, Copenhagen Market, Starke (Brassica oleracea pv. capitata L.), and Tronchuda (B. oleracea L. var. costata DC) were grown in the areas for several years. The hybrid Glory F1 was the most popular grown cultivar in the surveyed areas. In the Boane district, the highest incidence of black rot was recorded on Copenhagen Market (70%), Starke (67.9%), and Glory F1 (67.3%). In Chòkwé, Tronchuda (Portuguese kale) was the least affected Brassica crop. Water-soaked lesions starting at the edge of leaves with typical V-shaped necrotic lesions and vein discoloration were the most commonly observed symptoms. When examined with a microscope, cut edges of symptomatic stem and leaf tissues consistently exhibited bacterial streaming. The bacteria were isolated from commercial seed and field-grown plants on semiselective agar media (2). Forty-six X. campestris pv. campestris strains that were gram negative, aerobic, starch positive, nitrate negative, and oxidase negative or weakly positive (3) were further identified on the basis of ELISA (Agdia Inc., Elhart, IN), GN Biolog Microbial Identification System, version 4.2 (Biolog Inc., Hayward, CA), and PCR-specific primers (1). Pathogenicity tests were conducted by pin inoculating two upper leaves of cabbage (cv. Wirosa) in the 2- to 3-leaf stage with bacterial growth from 24-h-old agar cultures (2). Black rot symptoms developed on nearly all inoculated plants within 7 to 14 days. No symptoms were observed on control plants inoculated with a sterile pin without bacterial inoculum. The severity of black rot of Brassica spp. in three important farming districts caused significant losses in Mozambique. References: (1) T. Berg et al. Plant Pathol. 54:416, 2005. (2) S. J. Roberts and H. Koenraadt. Page 1 in: International Rules for Seed Testing: Annexe to Chapter 7 Seed Health Methods. ISTA, 2007. (3) N. W. Schaad et al. Laboratory Guide for Identification of Plant Pathogenic Bacteria. 3rd ed. The American Phytopathological Society, St. Paul, MN, 2001.

First Report of Bacterial Speck of Tomato Caused by Pseudomonas syringae pv. tomato in Tanzania.

In April 2004, there was a serious outbreak of a tomato (Lypersicon esculentum Mill.) leaf spot disease in Mgeta, Mvomero District of Tanzania. The disease was characterized by lesions on green tomato fruits that were small, sunken, and black and were surrounded by darker green haloes. Lesions on ripe tomato fruits were dark brown to black, superficial, and measured approximately 1 to 2 mm in diameter. On the leaves, lesions were small, black, and surrounded by chlorotic (yellow) haloes. In some cases, the specks coalesced to form large lesions on older leaves. Black lesions were also observed on stems and petioles. A disease survey of selected tomato-producing areas in Arusha, Dodoma, Iringa, and Morogoro regions of Tanzania during 2004 and 2005 revealed that the disease was widespread in farmers' fields in all areas surveyed. Disease incidence was approximately 80%, while severity, rated on the scale of Chambers and Merriman (1), ranged from moderate (11 to 40 lesions per plant) to severe (>40 lesions per plant). A bacterium that produced a greenish, diffusible pigment on King's medium B was consistently isolated from lesions on tomato fruits collected from the fields in all the surveyed areas. All 56 isolates obtained were gram negative, oxidase negative, and fluoresced on King's medium B under UV light. None utilized phenylethylamine as the sole carbon source, while three isolates utilized i-erythritol and lactulose. Biolog analysis of the isolates, along with two reference strains of P. syringae pv. tomato (Pst CEP-3 from Sokoine University of Agriculture, Tanzania and Pst BB6 [Race 1] from Göttinger Sammlung Phytopathogener Bakterien, Göttingen, Germany) identified them as P. syringae pv. tomato, with similarity indices of 0.518 to 0.933. They also were positively identified as P. syringae pv. tomato by repetitive sequence-based-PCR (2,3) and fragment length polymorphism analysis. Pathogenicity of the strains was confirmed by spraying 35-day-old tomato seedlings (cv. Tanya) with suspensions of the isolates at a concentration of 108 CFU ml-1 of sterile water. After approximately 72 h, small, water-soaked, dark brown lesions similar to those observed on the field plants were observed on leaves of all the inoculated tomato seedlings. There were no symptoms on control plants. The bacterium was reisolated from the infected plants and identified as P. syringae pv. tomato, in accordance with Koch's postulates. To our knowledge, this is the first report of the occurrence of tomato bacterial speck in Tanzania. References: (1). S. C. Chambers and P. R. Merriman. Aust. J. Agric. Res. 26:657, 1975. (2). F. J. Louws et al. Appl. Environ. Microbiol. 60:2286, 1994. (3). M. Zaccardelli et al. Eur. J. Plant Pathol. 111:85, 2005.

Detection of Xanthomonas oryzae pv. oryzae in artificially inoculated and naturally infected rice seeds and plants by molecular techniques.

A polymerase chain reaction (PCR) technique was developed for detecting the presence of Xanthomonas oryzae pv. oryzae, the bacterial leaf blight (BLB) pathogen in rice seed and for studying the transmission of this bacterium from seed to plant. Primers TXT and TXT4R from an insertion sequence (IS1113) of the pathogen were used to amplify a 964-bp DNA fragment. A combined biological and enzymatic amplification (BIO-PCR) technique was used to detect the pathogen in naturally infected seed. The level of detection of TXT and TXT4R primers was 55 fg DNA of X. o. pv. oryzae, which is roughly the equivalent of seven cells (and four cells in pure culture suspension) of X. o. pv. oryzae. Hybridization of IS1113 with the amplified DNA fragment in Southern blot analysis confirmed that the 964-bp DNA fragment was amplified from X. o. pv. oryzae. The presence of the IS1113 element in strains of X. o. pv. oryzae from 16 rice-growing countries was confirmed by DNA dot blot analysis. X. o. pv. oryzae was detected from the seed washes and DNA extracted from the seed washes of naturally infected seeds of cvs Jaya and TN1. When stored at 4 degrees C, the pathogen was recovered up to 4 months and 9 months from naturally infected seeds of cvs Jaya and TN1, respectively. The BLB bacterium was also detected in seedlings, mature plants and seeds collected from plants raised from naturally infected seeds.

First Report on the Occurrence of Bacterial Stripe Organism Acidovorax avenae subsp. avenae in Rice Seeds from Burkina Faso.

Breeder rice seeds from Burkina Faso harvesteds in 1999 were tested for Acidovorax avenae subsp. avenae. This pathogen affects rice, maize, sorghum, and other Gramineae. Ten samples of 200 seeds in each sample were tested by the cassette holder method for detection of this bacterium (1). Seedlings were evaluated for symptom development after 14 days at 27 to 30°C and 100% relative humidity under fluorescent light (12 h photoperiod). Bacterial stripe symptoms were observed in seedlings raised from 9 of 10 seed samples tested, and incidence ranged from 5 to 20%. Diseased seedlings showed water-soaked areas on coleoptiles and brown stripes on leaf sheaths and mid-ribs. Twenty-six strains obtained from diseased seedlings were characterized using several criteria. Colonies were small, whitish-grey, raised, entire and translucent on nutrient agar and cream-tan, raised, entire, and did not produce fluorescent pigment on King's medium B. They were Gram negative, oxidase positive and nitrate positive. Variable reactions were recorded for starch hydrolysis; 22 strains reacted positively and 4 negatively. All 26 strains reacted positively in ELISA performed with antiserum against A. avenae subsp. avenae. Results using Biolog GN MicroPlates (Biolog Inc., Hayward, CA computer identification system, Release 4.0) showed all strains to be A. avenae subsp. avenae (sim. 0.709 to 0.802). Hypersensitive reactions on leaves of 2-month-old tobacco plants infiltrated with bacterial suspensions were recorded within 24 h. Strains were tested for pathogenicity by injecting stems of 21-day-old rice plants with bacterial suspensions (approximately 108 CFU/ml). Inoculated seedlings were incubated for 4 to 7 days under humid conditions at 28°C. Inoculated rice plants showed brown stripes and non-inoculated control seedlings remained symptomless. Based on biochemical, serological, and biological characteristics, strains were identified as A. avenae subsp. avenae. This is the first report of A. avenae subsp. avenae, causal agent of bacterial stripe of rice, in Burkina Faso. The common presence of A. avenae subsp. avenae in breeder rice seeds emphasizes the need for control measures to limit further spread to unaffected rice-growing areas and other cereal crops. Reference: (1) D. D. Shakya et al. Phytopathol. Z. 114:256-259, 1985.