Prediction of Prognostic Features Based on Neutrophil-Related Genes for Lung Squamous Cell Carcinoma Reveals Immune Landscape and Drug Candidates.

UNASSIGNED: Background: Since to the prognosis of lung squamous cell carcinoma is generally poor, there is an urgent need to innovate new prognostic biomarkers and therapeutic targets to improve patient outcomes. Objectives: Our goal was to develop a novel multi-gene prognostic model linked to neutrophils for predicting lung squamous cell carcinoma prognosis. Methods: We utilized messenger RNA expression profiles and relevant clinical data of lung squamous cell carcinoma patients from the Cancer Genome Atlas database. Through K-means clustering, least absolute shrinkage and selection operator regression, and univariate/multivariate Cox regression analyses, we identified 12 neutrophil-related genes strongly related to patient survival and constructed a prognostic model. We verified the stability of the model in the Cancer Genome Atlas database and gene expression omnibus validation set, demonstrating the robust predictive performance of the model. Results: Immunoinfiltration analysis revealed remarkably elevated levels of infiltration for natural killer cells resting and monocytes in the high-risk group compared to the low-risk group, while macrophages had considerably lower infiltration in the high risk group. Most immune checkpoint genes, including programmed cell death protein 1 and cytotoxic T-lymphocyte-associated antigen 4, exhibited high expression levels in the high risk group. Tumor immune dysfunction and exclusion scores and immunophenoscore results suggested a potential inclination toward immunotherapy in the "RIC" version V2 revised high risk group. Moreover, prediction results from the CellMiner database revealed great correlations between drug sensitivity (e.g., Vinorelbine and PKI-587) and prognostic genes. Conclusion: Overall, our study established a reliable prognostic risk model that possessed significant value in predicting the overall survival of lung squamous cell carcinoma patients and may guide personalized treatment strategies. (Rev Invest Clin. 2024;76(2):116-31).

Ag-carbon dots with peroxidase-like activity for colorimetric and SERS dual mode detection of glucose and glutathione.

Currently, nanozymes have made important research progress in the fields of catalysis, biosensing and tumor therapy, but most of nanozymes sensing systems are single-mode detection, which are easily affected by environment and operation, so it is crucial to construct nanozymes sensing system with dual-signal detection to obtain a more stable and reliable performance. In this paper, Ag-carbon dots (Ag-CDs) bifunctional nanomaterials were synthesized using carbon dots as reducing agent and protective agent by a facile and green one-step method. A simple and sensitive colorimetric-SERS dual-mode sensing platform was constructed for the detection of glucose and glutathione(GSH) in body fluids by taking advantage of good peroxidase-like and SERS activities of Ag-CDs. Ag-CDs catalyzes H2O2 to hydroxyl radicals(•OH), which oxidized TMB to form ox-TMB blue solution with characteristic absorption peak at 652 nm and Raman characteristic peak at 1607 cm-1. Ag-CDs sensing method exhibited high performance for glucose and GSH with detection limits for colorimetric and SERS as low as 11.30 µM and 3.54 µM, 0.38 µM and 0.24 µM respectively (S/N = 3). In addition, Ag-CDs have good stability and uniformity, ensuring long-term applicability of catalytic system. This colorimetric-SERS dual-mode sensing platform can be used for the determination of glucose and GSH in saliva and urine, and has the advantages of simple, low cost, rapid, and high accuracy, which has a potential application prospect in biosensor and medical research.

Perspective of Calcium Imaging Technology Applied to Acupuncture Research / 中国结合医学杂志

Acupuncture, a therapeutic treatment defined as the insertion of needles into the body at specific points (ie, acupoints), has growing in popularity world-wide to treat various diseases effectively, especially acute and chronic pain. In parallel, interest in the physiological mechanisms underlying acupuncture analgesia, particularly the neural mechanisms have been increasing. Over the past decades, our understanding of how the central nervous system and peripheral nervous system process signals induced by acupuncture has developed rapidly by using electrophysiological methods. However, with the development of neuroscience, electrophysiology is being challenged by calcium imaging in view field, neuron population and visualization in vivo. Owing to the outstanding spatial resolution, the novel imaging approaches provide opportunities to enrich our knowledge about the neurophysiological mechanisms of acupuncture analgesia at subcellular, cellular, and circuit levels in combination with new labeling, genetic and circuit tracing techniques. Therefore, this review will introduce the principle and the method of calcium imaging applied to acupuncture research. We will also review the current findings in pain research using calcium imaging from in vitro to in vivo experiments and discuss the potential methodological considerations in studying acupuncture analgesia.

Application of two phacoemulsification modes in cataract surgery with different hard nuclear / 国际眼科杂志(Guoji Yanke Zazhi)

AIM: To compare the clinical efficacy of the Balanced energy system versus the conventional torsional ultrasound system in phacoemulsification surgeries for cataracts with varying nuclear hardness.METHODS: In this study, 120 patients(122 eyes)with age-related cataracts scheduled for surgery between November 2021 and November 2022 at our hospital were randomly divided into two groups: 58 patients(59 eyes)in the experimental group underwent surgery using the Balanced energy system, while 62 patients(63 eyes)in the control group were treated with the conventional torsional ultrasound system. Intraoperative cumulative dissipated energy(CDE), case time(CT), aspiration time(AST), and estimated fluid used(EFU)were recorded. Patients were followed-up for 3mo to examine and record the best-corrected visual acuity(BCVA)and corneal endothelial cell density(ECD), and to calculate the rate of endothelial cell loss.RESULTS: Comparing the intraoperative parameters between the two groups, there was no significant difference in CT(P>0.05), but the CDE, AST and EFU of the patients in the experimental group were lower than those of the control group(P<0.05), and the CDE of patients with grade III nuclear hardness in the experimental group was lower than the control group(P<0.05), CDE, AST and EFU in patients with grade IV nuclear hardness were lower than those in the control group(P<0.05). After 3mo of follow-up, BCVA in both groups improved significantly, and the experimental group recovered faster than the control group. At 3mo after surgery, the ECD of the two groups of patients was reduced compared with that before surgery(P<0.01), but there were no significant differences in ECD and endothelial cell loss rates between the experimental and control groups before and at 3mo after surgery(P>0.05). In grade IV nuclear hardness cataracts, the rate of endothelial cell loss in the experimental group was significantly lower than that in the control group(4.63%±4.10% vs. 6.63%±4.49%, P<0.01).CONCLUSION: The Balanced energy system and the conventional torsional ultrasound system both show high safety and efficiency in phacoemulsification of cataracts with different nuclear hardness. However, the former demonstrates substantial advantages in cases with dense nuclei, offering lower ultrasound energy, shorter aspiration and infusion times, and reduced volume of infusion fluid.

Effect of hand controlled rhythm music therapy on unilateral spatial neglect after stroke / 中国康复理论与实践

ObjectiveTo observe the clinical effect of hand controlled rhythm music therapy on unilateral spatial neglect for stroke patients. MethodsFrom September, 2020 to September, 2022, 52 patients with unilateral spatial neglect after stroke in Wuxi Central Rehabilitation Hospital were randomly divided into control group (n = 26) and observation group (n = 26). Both groups accepted routine rehabilitation, and the observation group accepted hand controlled rhythm music therapy in addition, for eight weeks. Before and after treatment, the patients were assessed with Chinese Behavioral Inattention Test-Hong Kong version (CBIT-HK) routine tests (line crossing, letter cancellation, star cancellation, line bisection, figure and shape copying, and representational drawing) and modified Barthel Index (MBI). ResultsAfter treatment, six scores of CBIT-HK routine tests and the scores of MBI increased in both groups (|t| > 3.077, P < 0.05), and they were higher in the observation group than in the control group (|t| > 2.639, P < 0.05). ConclusionHand controlled rhythm music therapy could effectively alleviate the symptoms of unilateral spatial neglect after stroke, and improve the activities of daily living.

Comparison of the Nerve Regeneration Capacity and Characteristics between Sciatic Nerve Crush and Transection Injury Models in Rats / 生物医学与环境科学（英文）

OBJECTIVE@#To provide useful information for selecting the most appropriate peripheral nerve injury model for different research purposes in nerve injury and repair studies, and to compare nerve regeneration capacity and characteristics between them.@*METHODS@#Sixty adult SD rats were randomly divided into two groups and underwent crush injury alone (group A, n = 30) or transection injury followed by surgical repair (group B, n = 30) of the right hind paw. Each group was subjected to the CatWalk test, gastrocnemius muscle evaluation, pain threshold measurement, electrophysiological examination, retrograde neuronal labeling, and quantification of nerve regeneration before and 7, 14, 21, and 28 days after injury.@*RESULTS@#Gait analysis showed that the recovery speed in group A was significantly faster than that in group B at 14 days. At 21 days, the compound muscle action potential of the gastrocnemius muscle in group A was significantly higher than that in group B, and the number of labeled motor neurons in group B was lower than that in group A. The number of new myelin sheaths and the g-ratio were higher in group A than in group B. There was a 7-day time difference in the regeneration rate between the two injury groups.@*CONCLUSION@#The regeneration of nerve fibers was rapid after crush nerve injury, whereas the transection injury was relatively slow, which provides some ideas for the selection of clinical research models.

Xiangsha Liu Junzitang for Prevention and Treatment of Gastric Cancer： A Review / 中国实验方剂学杂志

Gastric cancer is one of the malignancies with high incidence in the world. Xiangsha Liu Junzitang，a common prescription for the prevention and treatment of gastric cancer，has the effects of moving Qi to relieve pain，drying dampness， and invigorating the spleen. It is especially indicated for gastric cancer of the spleen and stomach qi deficiency syndrome. Based on the databases such as CNKI，Wanfang Data，and PubMed，the clinical efficacy and experimental studies of Xiangsha Liu Junzitang for the prevention and treatment of gastric cancer were summarized and sorted out，and the mechanism of Xiangsha Liu Junzitang for the prevention and treatment of gastric cancer was elaborated in order to provide useful references for the clinical and basic research on Xiangsha Liu Junzitang in the field of gastric cancer in the future. In clinical practice，Xiangsha Liu Junzitang can treat gastric precancerous lesions，increase the body immunity of patients with gastric cancer，improve the symptoms of spleen and stomach weakness after gastric cancer surgery，and reduce the adverse reactions of the digestive tract after chemotherapy for gastric cancer. Its clinical efficacy is superior to that of western medicine alone whether it is combined with western medicine or used alone. In the experimental research，Xiangsha Liu Junzitang has the effects of regulating inflammatory factors，inhibiting the proliferation of gastric cancer cells，promoting the apoptosis of gastric cancer cells，and improving the activity of pepsin. Modern pharmacological research has shown that Xiangsha Liu Junzitang can conduct a comprehensive intervention with multiple components and multiple targets. The main components of a single drug contained include saponins，polysaccharides，lactones，volatile oils，organic acids，and others， with the effects of protecting gastric mucosa，regulating endocrine，and promoting apoptosis of epithelial cells in gastric mucosal dysplasia，reflecting the advantages and values of traditional Chinese medicine in the prevention and treatment of gastric cancer.

The expression and significance of protease activated receptor 2 in ovarian epithelial carcinoma / 中华肿瘤杂志

Objective: To investigate the expression and significance of protease activated receptor 2 (PAR2) in ovarian epithelial carcinoma. Methods: PAR2 mRNA expression levels in 410 cases of epithelial ovarian carcinoma and 88 cases of human normal ovary were analyzed from cancer Genome Atlas (TCGA) database and tissue genotypic expression database (GTEx). Immunohistochemical (IHC) staining of PAR2 protein was performed in 149 patients with ovarian cancer who underwent primary surgical treatment at Cancer Hospital of Chinese Academy of Medical Sciences. Then the relationship between mRNA/protein expression of PAR2 and clinicopathological features and prognosis was analyzed. Gene functions and related signaling pathways involved in PAR2 were studied by enrichment analysis. Results: The mRNA expression of PAR2 in epithelial ovarian carcinoma was significantly higher than that in normal ovarian tissue (3.05±0.72 vs. 0.33±0.16, P=0.004). There were 77 cases showing positive and 19 showing strong positive of PAR2 IHC staining among the 149 patients, accounting for 64.4% in total. PAR2 mRNA/protein expression was closely correlated with tumor reduction effect and initial therapeutic effect (P<0.05). Survival analysis showed that the progression free survival time (P=0.033) and overall survival time (P=0.011) in the group with high PAR2 mRNA expression was significantly lower than that in the low PAR2 mRNA group. Multivariate analysis showed tumor reduction effect, initial therapeutic effect were independent prognostic factors on both progression-free survival and overall survival (P<0.05). The progression-free survival (P=0.016) and overall survival (P=0.038) of the PAR2 protein high expression group was significantly lower than that of the low group. Multivariate analysis showed PAR2 expression, initial treatment effect and chemotherapy resistance were independent prognostic factors on both progression-free survival and overall survival (P<0.05). Based on Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG), PAR2 target genes were mainly enriched in function related to intercellular connection, accounting for 40%. Gene enrichment analysis (GSEA) showed that the Wnt/β-catenin signaling pathway (P=0.023), the MAPK signaling pathway (P=0.029) and glycolysis related pathway (P=0.018) were enriched in ovarian cancer patients with high PAR2 mRNA expression. Conclusions: PAR2 expression is closely related to tumor reduction effect, initial treatment effect and survival of ovarian cancer patients. PAR2 may be involved in Wnt/β-catenin signaling pathway and intercellular connection promoting ovarian cancer invasion and metastasis.

A positive feedback loop of heparanase/ syndecan1erve growth factor regulates cancer pain progression

Background@#The purpose of this research was to assess the role of heparanase (HPSE)/syndecan1 (SDC1)erve growth factor (NGF) on cancer pain from melanoma. @*Methods@#The influence of HPSE on the biological function of melanoma cells and cancer pain in a mouse model was evaluated. Immunohistochemical staining was used to analyze HPSE and SDC1. HPSE, NGF, and SDC1 were detected using western blot. Inflammatory factors were detected using ELISA assay. @*Results@#HPSE promoted melanoma cell viability, proliferation, migration, invasion, and tumor growth, as well as cancer pain, while SST0001 treatment reversed the promoting effect of HPSE. HPSE up-regulated NGF, and NGF feedback promoted HPSE. High expression of NGF reversed the inhibitory effect of HPSE down-regulation on melanoma cell phenotype deterioration, including cell viability, proliferation, migration, and invasion. SST0001 down-regulated SDC1 expression. SDC1 reversed the inhibitory effect of SST0001 on cancer pain. @*Conclusions@#The results showed that HPSE promoted melanoma development and cancer pain by interacting with NGF/SDC1. It provides new insights to better understand the role of HPSE in melanoma and also provides a new direction for cancer pain treatment.

Tracking of Stem Cells from Human Exfoliated Deciduous Teeth Labeled with Molday ION Rhodamine-B during Periodontal Bone Regeneration in Rats

Background and Objectives@#Chronic periodontitis can lead to alveolar bone resorption and eventually tooth loss. Stem cells from exfoliated deciduous teeth (SHED) are appropriate bone regeneration seed cells. To track the survival, migration, and differentiation of the transplanted SHED, we used super paramagnetic iron oxide particles (SPIO) Molday ION Rhodamine-B (MIRB) to label and monitor the transplanted cells while repairing periodontal bone defects. @*Methods@#and Results: We determined an appropriate dose of MIRB for labeling SHED by examining the growth and osteogenic differentiation of labeled SHED. Finally, SHED was labeled with 25 μg Fe/ml MIRB before being transplanted into rats. Magnetic resonance imaging was used to track SHED survival and migration in vivo due to a low-intensity signal artifact caused by MIRB. HE and immunohistochemical analyses revealed that both MIRB-labeled and unlabeled SHED could promote periodontal bone regeneration. The colocalization of hNUC and MIRB demonstrated that SHED transplanted into rats could survive in vivo. Furthermore, some MIRB-positive cells expressed the osteoblast and osteocyte markers OCN and DMP1, respectively. Enzyme-linked immunosorbent assay revealed that SHED could secrete protein factors, such as IGF-1, OCN, ALP, IL-4, VEGF, and bFGF, which promote bone regeneration. Immunofluorescence staining revealed that the transplanted SHED was surrounded by a large number of host-derived Runx2- and Col II-positive cells that played important roles in the bone healing process. @*Conclusions@#SHED could promote periodontal bone regeneration in rats, and the survival of SHED could be tracked in vivo by labeling them with MIRB. SHED are likely to promote bone healing through both direct differentiation and paracrine mechanisms.

Gene clone and functional identification of sterol glycosyltransferases from Paris polyphylla var. yunnanensis / 中国中药杂志

In this study, the authors cloned a glycosyltransferase gene PpUGT2 from Paris polyphylla var. yunnanensis with the ORF length of 1 773 bp and encoding 590 amino acids. The phylogenetic tree revealed that PpUGT2 belonged to the UGT80A subfamily and was named as UGT80A49 by the UDP-glycosyltransferase(UGT) Nomenclature Committee. The expression vector pET28a-PpUGT2 was constructed, and enzyme catalytic reaction in vitro was conducted via inducing protein expression and extraction. With UDP-glucose as sugar donor and diosgenin and pennogenin as substrates, the protein was found with the ability to catalyze the C-3 hydroxyl β-glycosylation of diosgenin and pennogenin. To further explore its catalytic characteristic, 15 substrates including steroids and triterpenes were selected and PpUGT2 showed its activity towards the C-17 position of sterol testosterone with UDP-glucose as sugar donor. Homology modelling and molecule docking of PpUGT2 with substrates predicted the key residues interacting with ligands. The re-levant residues of PpUGT2-ligand binding model were scanned to calculate the corresponding mutants, and the optimized mutants were obtained according to the changes in binding affinity of the ligand with protein and the surrounding residues within 5.0 Å of ligands, which had reference value for design of the mutants. This study laid a foundation for further exploring the biosynthetic pathway of polyphyllin as well as the structure of sterol glycosyltransferases.

Effect of moxibustion on plaque psoriasis complicated with obesity / 中国针灸

OBJECTIVE@#To observe the clinical efficacy of moxibustion combined with coptis chinensis ointment sealing on plaque psoriasis complicated with obesity.@*METHODS@#A total of 52 patients of plaque psoriasis complicated with obesity were randomized into an observation group (26 cases) and a control group (26 cases, 2 cases dropped off). Coptis chinensis ointment sealing was adopted in the control group. On the basis of the treatment in the control group, moxibustion was applied at ashi point (area of local target lesions), Zhongwan (CV 12) and bilateral Zusanli (ST 36), Fenglong (ST 40), Quchi (LI 11), Tianshu (ST 25), Shangjuxu (ST 37) in the observation group. The treatment was given 30 min each time, once a day for 4 weeks in both groups. The psoriasis area and severity index (PASI) score, obesity related indexes (body mass, waist circumference, body mass index [BMI]), triglyceride, cholesterol, uric acid and plasma glucose were compared before and after treatment, and the clinical efficacy was evaluated in the two groups.@*RESULTS@#After treatment, the PASI scores were decreased compared with those before treatment in the two groups (P<0.01), and the PASI score in the observation group was lower than that in the control group (P<0.05); the body mass, waist circumference, BMI, triglyceride, cholesterol, uric acid and plasma glucose were decreased compared with those before treatment in the observation group (P<0.01, P<0.05), the triglyceride and cholesterol in the observation group were lower than those in the control group (P<0.05). The total effective rate was 53.8% (14/26) in the observation group, which was superior to 20.8% (5/24) in the control group (P<0.05).@*CONCLUSION@#Moxibustion combined with coptis chinensis ointment sealing can effectively improve the clinical symptoms in patients of plaque psoriasis complicated with obesity.

Da Chengqitang in Treatment of Sepsis： A Review / 中国实验方剂学杂志

Sepsis is a systemic inflammatory syndrome induced by infection and other factors， with the number of patients worldwide exceeding 10 million each year. The pathophysiological mechanism is of this disease complex. Sepsis is often accompanied by endotoxin translocation， gastrointestinal dysfunction， inflammatory cytokine activation， immune dysregulation， coagulation disorder， multiple organ function impairment and many other body imbalances， as well as systemic inflammation， apoptosis， oxidative stress injury and other cell damage mechanisms. This disease causes a heavy medical burden due to the difficult diagnosis and treatment and the poor prognosis. Great progress has been achieved in the diagnosis and treatment of sepsis with traditional Chinese medicine （TCM） and western medicine. The value of western medicine in the diagnosis and treatment of sepsis is limited due to antibiotic resistance， hormone abuse， and high medical costs. Sepsis is classified as a warm disease or typhoid fever in TCM. Da Chengqitang is a classical formula in the Treatise on Typhoid Fever to deal with the excess syndrome of Yang brightness Fu-organ. Modern medicine has proved that Da Chengqitang has the effect of inhibiting oxidative stress， reducing inflammation， and delaying apoptosis by improving gastrointestinal dynamics and regulating intestinal microecology. On the basis of the previous theoretical basis and the rich experience in the medication， medical practitioners have proposed a new therapeutic concept of using Da Chengqitang in combination with western drugs from a holistic view involving both bacteria and toxicity for treating both the symptoms and the root cause， which has a wide range of application. The article reviews the classical research and latest findings of Da Chengqitang in the treatment of sepsis， with a view to clarifying the mechanism and advantages of this formula in the adjuvant treatment of sepsis， exploring its potential efficacy， and providing timely， adequate， and scientific theoretical support for the promotion of this formula in the clinical practice.

Case-control study on fragility fractures in coal miners: A comparison between surface and underground workers / 环境与职业医学

Background The prevalence of osteoporosis and osteopenia is higher among underground coal miners than surface workers. The special underground work environment and unhealthy habits such as smoking, drinking, and a high-salt diet may lead to changes in bone metabolism, increasing the risk of fragility fractures and placing a heavy economic burden on individuals and society. Objective To identify potential factors influencing fragility fractures among coal miners in different working environments and to provide a basis for targeted preventive measures to reduce the occurrence of fragility fractures. Methods Male participants who attended at least one of the physical examinations in Kailuan Group between June 2006 and December 2020 were included in the study. The participants were divided into two groups based on their working environment: surface or underground. A case-control study was conducted, where patients with new fragility fractures served as the case group and participants without fragility fractures served as the control group. The two groups were matched with a case:control ratio of 1:4 by age (±1 year) and the same year of physical examination. The matching process was repeated twice, once for the surface working population and once for the underground working population. The analysis of risk factors was conducted using conditional logistic regression models. Results Among a total of 113138 employees in Kailuan Group, 82631 surface workers and 30507 underground workers were included, respectively. The number of individuals who suffered fragility fractures was 1375, accounting for 1.22% of the total population. The incidence of fragility fractures in underground workers was significantly higher than that in surface workers (1.63%>1.07%, P<0.001). The results of conditional logistic regression model showed that current smoking (OR=1.26, 95%CI: 1.05, 1.51), manual labor (OR=1.37, 95%CI: 1.06, 1.78), diabetes (OR=1.26, 95%CI: 1.04, 1.54), sinus tachycardia (OR=1.81, 95%CI: 1.23, 2.66), history of stroke (OR=1.51, 95%CI: 1.09, 2.09), education at college and above (OR=0.65, 95%CI: 0.45, 0.95), high income level (OR=0.69, 95%CI: 0.54, 0.90), elevated hemoglobin (OR=0.91, 95%CI: 0.85, 0.98), and elevated total cholesterol (OR=0.90, 95%CI: 0.82, 0.99) were associated with fragility fractures in the surface working population of coal mines; current smoking (OR=1.48, 95%CI: 1.17, 1.87), current drinking (OR=1.26, 95%CI: 1.01, 1.56), manual labor (OR=2.64, 95%CI: 1.41, 4.94), history of dust exposure (OR=1.28, 95%CI: 1.03, 1.58), and obesity (OR=0.72, 95%CI: 0.52, 0.96) were associated with fragility fractures in the underground working population of coal mines. Conclusion In preventing fragility fractures, special attention should be paid to the bone health of underground workers engaged in manual labor or having a history of dust exposure. It is important to correct their unhealthy behaviors in a timely manner, such as smoking and drinking, and to appropriately increase body weight to prevent fragility fractures. For surface workers, particular attention should be given to the high-risk group for fragility fractures, such as low family income per capita, manual labor, and having a history of stroke or diabetes; in addition, close monitoring of their resting heart rate, hemoglobin levels, and total cholesterol levels may help prevent fragility fractures.

The mechanism of modified Gan Cao Fu Zi Decoction in the treatment of rheumatoid arthritis based on network pharmacology and experimental validation / 药学学报

We used network pharmacology to predict the mechanism in the treatment of rheumatoid arthritis (RA) via modified Gan Cao Fu Zi Decoction (GCFZ), and validated the results of the analysis and explored the pharmacodynamic effects of GCFZ through animal experiments. Firstly, TCMID, SymMap, HERB, STITCH and GEO databases were utilized to obtain the target genes of GCFZ for the treatment of RA, which yielded a total of 1 250 differentially expressed genes for RA, 534 genes for GCFZ targets and 83 intersecting genes. Then functional enrichment analysis of the intersecting genes was performed through GO and KEGG databases, and the results revealed that GCFZ and its active ingredients mainly functioned through cytokine pathways, where chemokine signaling pathway and tumor necrosis factor (TNF) signaling pathway were enriched with a high number of genes. Cytoscape 3.8.0 software was used to construct the drug-target-disease network and screen key proteins, which included TNF, C-X-C chemokine ligand 8 (CXCL8), C-X-C chemokine ligand 10 (CXCL10), C-C chemokine ligand 5 (CCL5), C-X-C chemokine ligand 2 (CXCL2) and C-X-C chemokine receptor type 4 (CXCR4). The molecular docking technology was used to confirm the binding ability of the main active ingredients of GCFZ to the core proteins. Additionally, the therapeutic effects of GCFZ in low (4 g·kg-1), medium (8 g·kg-1) and high (16 g·kg-1) dose groups were investigated by constructing the collagen-induced arthritis (CIA) rat model. X-ray imaging approach, HE staining and Safranin O-Fast Green staining showed that GCFZ treatment significantly improved bone destruction, synovial hyperplasia and cartilage damage in CIA rats, while immunofluorescence results showed that GCFZ treatment could regulate the expression of TNF, CXCL8 and CCL5. In summary, our results indicate that GCFZ contains a variety of small molecule pharmacodynamic substances, which can exert therapeutic effects via multiple targets and pathways, and obviously reduce the symptoms of arthritis in CIA rats. This animal experiment of our research was approved by the Experimental Animal Management and Ethics Committee of Bengbu Medical College.

Effect of dual task walking on spatiotemporal gait in patients with cerebral small vessel disease / 中华神经科杂志

Objective:To compare the gait characteristics of cognitive and motor dual task walking (DTW) in patients with cerebral small vessel disease (CSVD), and determine the best gait parameters to diagnose CSVD and judge the severity of the disease.Methods:A total of 106 patients with CSVD and 21 healthy individuals were included from September 1, 2020 to July 1, 2021 in the Seventh Medical Center of Chinese People′s Liberation Army General Hospital. According to the Fazekas scores, the subjects were divided into mild ( n=34, 1 point), moderate ( n=34, 2 points), severe ( n=38,3 points) groups and control group ( n=21). Participants were recorded parameters under single task walking (STW) and DTW conditions, and calculated dual task effect (DTC) through the difference between single task and dual task. The differences in gait variances and their DTC were shown by generalized estimation equations when performed in STW and DTW and 4 groups of the severity of disease. Post-hoc comparisons were corrected using Bonferroni′s method. Spearman analyses were applied to explore the correlations between gait parameters and their DTC during STW or DTW and severity of disease. Based on the Logistic model, combining predictors or probabilities were gained and applied to establish receiver operating characteristic curve in order to calculate sensitivity, specificity, and the area under the curve. Results:In the control group, there was no statistically significant difference in gait parameters between STW and DTW. In the CSVD group, the gait parameters of STW were significantly better than cognitive or motor DTW (all P<0.05). In the control group, there was no statistically significant difference in basic gait parameters under different tasks (all P>0.05). In cognitive DTW, temporal gait parameters (stride frequency and stride time) deteriorated significantly only in moderate and severe groups [stride frequency:moderate group 100.220±1.795/min,severe group 94.525±2.139/min;stride time:moderate group (1.227±0.024) s, severe group (1.299±0.031) s], but spatial parameters [stride length: control group (1.050±0.021) m, mild group (0.974±0.022) m, moderate group (0.903±0.025) m, severe group (0.793±0.026) m; stride speed: control group (0.944±0.028) m/s, mild group (0.866±0.030) m/s, moderate group (0.751±0.027) m/s, severe group (0.606±0.022) m/s] were significantly different among all groups (except the control group and mild group;all P<0.05). The DTC of all gait parameters during cognitive DTW was higher than that during motor DTW (all P<0.05) for CSVD patients. While no any difference was found between cognitive DTW and motor DTW in the control group (all P>0.05). Similarly, the temporal parameters′ DTC of cognitive DTW was abnormal only in the late stage of disease, while the spatial parameters′ DTC showed statistically significant difference among all the groups (including the control group and the mild group;all P<0.05). Correlation coefficients of the spatial parameters and their DTC in condition of cognitive DTW were significantly higher than temporal parameters and their DTC (0.50< r<0.64 vs 0.15< r<0.39). The area under curve of the combined predictor was significantly higher than that of any single index. Conclusions:Cognitive DTW can better reflect the abnormal gait of CSVD patients. The spatial parameters and DTC of cognitive DTW could effectively diagnose CSVD and distinguish the disease of severity. And DTC might be better indicators. For diagnosis of CSVD, there was no significant discrepancy between the spatial parameters and DTC, but the combined predictor could significantly improve the sensitivity and reduce the false negative rate.

The 500th case: pain in both hip joints, headache, and diplopia / 中华内科杂志

A male child, aged 5 years and 3 months, was admitted to the Oncology Department with a history of pain in both hip joints, headache, and diplopia lasting for 40 days. Physical examination did not reveal definitive signs or obvious abnormalities in the nervous system. Imaging studies showed only abnormalities in the craniocerebrum and spinal cord. Routine cerebrospinal fluid (CSF) analysis revealed elevation in the total number of white blood cells, mainly mononuclear cells. Biochemical analysis of CSF showed normal glucose and chloride levels, and increased protein concentrations. The possibility of central nervous system (CNS) infection was initially considered. Subsequently, antibacterial and antiviral therapy was administered; however, this treatment was ineffective. Further examination of CSF through immunophenotyping revealed mature B-cell lymphoma with CNS involvement; there were no neoplastic lesions detected elsewhere in the body. Thus, the patient was diagnosed with primary central nervous system lymphoma (PCNSL). Complete remission was achieved after chemotherapy with the CNCL-2017-mature B-cell lymphoma regimen. Thus far, all chemotherapy cycles have been completed, the patient remains in complete remission, and the follow-up is ongoing. Clinicians should pay close attention to PCNSL in children.

Phenotype and genotype analysis of progressive familial intrahepatic cholestasis type 4 / 中华实用儿科临床杂志

Objective:To improve the understanding of progressive familial intrahepatic cholestasis type 4 (PFIC4).Methods:Clinical characteristics in a 10-year-old boy with PFIC4 at the Second Hospital of Hebei Medical University in February 2020 were retrospectively analyzed, and the TJP2 gene mutations were analyzed. Results:The proband was a 10-year-old boy with a slow onset of intrahepatic cholestasis[normal γ-glutamyl transpeptidase(GGT)], hepatosplenomegaly and hepatic fibrosis.Laboratory tests showed elevated levels of total bilirubin, especially the direct bilirubin increased.Alanine aminotransferase, aspartate transaminase acid and total bile acid were elevated, while GGT remained in a normal range.Oral medication of ursodeoxycholic acid initially improved liver biochemical parameters, but later fluctuated.Adenosine dehydrogenase, coagulation indicators and hepatic fibrosis indexes were persistently abnormal.The average shear wave velocity of liver was 1.9 times of the upper limit of normal value.Compound heterozygous mutations c. 334G>A(p.A112T)/c.580_639delGACCGGAGCCGTGGCCGGAGCCTGGAGCGGGG-CCTGGACCAAGACCATGCGCGCACCCGA (p.194_213delDRSRGRSLERGLDQDHARTR) were found in the TJP2 gene.The deletion mutation of the TJP2 gene was reported for the first time throughout the world.Both of his parents carried a heterozygous mutation. Conclusions:PFIC should be considered in intrahepatic cholestasis patients with a normal range of GGT.The detection of TJP2 gene mutation is of great value in the clinical diagnosis of PFIC4.The presence of TJP2 gene mutation may be a risk factor for patient developing cirrhosis of liver and primary liver cancer in early childhood.It is necessary for children with PFIC4 to be closely followed up.

Research progress on the application of combining radiotherapy and systemic therapy in breast cancer / 国际肿瘤学杂志

Compared with single therapy, radiotherapy combined with chemotherapy, endocrine therapy, molecular targeted therapy and immunological therapy can not only shorten the treatment cycle, but also improve the local control rate and prolong the survival of patients. However, the safety of combined therapy still needs to be further clarified to comprehensively evaluate the feasibility. Therefore, exploring the efficacy and safety of radiotherapy combined with systematic therapy will provide evidence for clinical benefits.

Clinical analysis of 5 children with lymphoma complicated with Pneumocystis jirovecii pneumonia / 白血病·淋巴瘤

Objective:To explore the clinical features of childhood lymphoma complicated with Pneumocystis jirovecii pneumonia (PJP).Methods:The clinical data, diagnosis and treatment of 5 children with lymphoma complicated with PJP admitted to Beijing Children's Hospital from January 2013 to April 2022 were retrospectively analyzed.Results:Among 5 patients, there were 3 males and 2 females, the median onset age was 7 years old; 4 cases were non-Hodgkin lymphoma and 1 case was Hodgkin lymphoma. Fever and cough occurred 5-18 months after chemotherapy; typical mosaic sign could be seen in 2 cases without pneumothorax and pleural effusion as well as other pathogenic infection; all 5 cases had hypoxemia; 4 cases were diagnosed by next-generation sequencing (NGS). The CD4/CD8 ratio decreased in all cases, and the median CD4 positive T-cell was 200/μl. Trimethoprim-sulfamethoxazole (TMP-SMZ) was irregularly used in 3 cases. During the treatment, all cases received mechanical ventilation, TMP-SMZ intravenously dripping combined with caspofungin, glucocorticoid and gamma globulin. All 5 cases of PJP were cured and there was no recurrent infection.Conclusions:Lymphoma children are susceptible to PJP due to immunocompromise caused by chemotherapy, and their condition progresses rapidly. When encountering fever, shortness of breath, severe lung symptoms and mild signs of children, it is necessary to improve the vigilance of PJP. NGS can help diagnosis, and TMP-SMZ should be actively treated and prevented. Early diagnosis and active treatment can achieve a good prognosis.