Measurement of light absorption by chromophoric dissolved organic matter using a type-II liquid capillary waveguide: assessment of an achievable accuracy.

Light absorption by chromophoric dissolved organic matter (CDOM) in the ocean is often measured using liquid waveguide capillary cells coupled to spectral array detectors. This type of optical setup is affected by several sources of uncertainties related to the waveguide and the detector. Uncertainties from the waveguide arise from errors in the effective path length and the effects of water salinity, while errors related to the detector are due to the non-linearity in the response, internal stray light, and wavelength accuracy. Here, uncertainties in the measurements of the spectral absorption coefficient of CDOM due to the optical setup itself were investigated in detail. The related systematic errors were very often significant (2-15%) and larger than expected from simple measurement uncertainty (±1%). However, they can be corrected by characterizing the detector's response for non-linearity and stray light, regularly performing calibrations for the detector's wavelength response, and routinely measuring the waveguide's effective path length. Including such corrections and timely calibrations reduces the uncertainties related to the spectrophotometric measurements to about ±2%. Uncertainties related to the necessary handling of samples are not included here.

Phytoplankton optical fingerprint libraries for development of phytoplankton ocean color satellite products.

Phytoplankton respond to physical and hydrographic forcing on time and space scales up to and including those relevant to climate change. Quantifying changes in phytoplankton communities over these scales is essential for predicting ocean food resources, occurrences of harmful algal blooms, and carbon and other elemental cycles, among other predictions. However, one of the best tools for quantifying phytoplankton communities across relevant time and space scales, ocean color sensors, is constrained by its own spectral capabilities and availability of adequately vetted and relevant optical models. To address this later shortcoming, greater than fifty strains of phytoplankton, from a range of taxonomic lineages, geographic locations, and time in culture, alone and in mixtures, were grown to exponential and/or stationary phase for determination of hyperspectral UV-VIS absorption coefficients, multi-angle and multi-spectral backscatter coefficients, volume scattering functions, particle size distributions, pigment content, and fluorescence. The aim of this publication is to share these measurements to expedite their utilization in the development of new optical models for the next generation of ocean color satellites.

One-Year and 18-Month Outcomes in nAMD Patient Eyes Switched to Brolucizumab Alone versus to Brolucizumab Alternating with Other Anti-VEGF Agents.

Objective: Retrospective, real-world study to evaluate visual acuity (VA), anti-vascular endothelial growth factor (anti-VEGF) injection intervals, and central macular thickness (CMT) in neovascular age-related macular degeneration (nAMD) eyes switched to brolucizumab only or to brolucizumab alternating with another anti-VEGF. Methods: The overall study population comprised eyes that were given ≥1 brolucizumab injection between 1 October 2019 and 30 November 2021. The brolucizumab-only (BRO) cohort consisted of prior anti-VEGF-treated eyes treated exclusively with ≥3 brolucizumab injections over ≥12 or ≥18 months; the alternating brolucizumab (ALT) cohort comprised prior anti-VEGF-treated eyes treated with ≥2 brolucizumab injections and ≥1 other anti-VEGF over ≥12 or ≥18 months. Results: A total of 482 eyes received ≥1 brolucizumab injection during the study period. Mean VA changes from baseline were -1.1±15.1 letters (BRO cohort; n = 174) and 1.3±13.0 letters (ALT cohort; n = 47) at Month 12, and 0.0±13.5 letters (BRO cohort; n = 95) and -7.3±17.2 letters (ALT cohort; n = 29) at Month 18. Mean changes in injection intervals were +26.9±48.1 days (BRO cohort) and +11.1±17.3 days (ALT cohort) at Month 12 and +36.3±52.3 days (BRO cohort) and +14.0±19.9 days (ALT cohort) at Month 18. Mean changes in CMT were -35.2±108.1 µm (BRO cohort) and -31.5±91.2 µm (ALT cohort) at Month 12 and -38.9±75.0 µm (BRO cohort) and -9.0±59.9 µm (ALT cohort) at Month 18. Intraocular inflammation-related adverse events were recorded in 22/482 (4.6%) eyes. Conclusion: Treatment with either brolucizumab alone or brolucizumab alternating with another anti-VEGF can preserve vision, reduce CMT, and extend anti-VEGF injection intervals in patients with nAMD.

In Vivo Optical Characterization of Middle Ear Effusions and Biofilms During Otitis Media.

Otitis media (OM), a common ear infection, is characterized by the presence of an accumulated middle ear effusion (MEE) in a normally air-filled middle ear cavity. While assessing the MEE plays a critical role in the overall management of OM, identifying and examining the MEE is challenging with the current diagnostic tools since the MEE is located behind the semi-opaque eardrum. The objective of this cross-sectional, observational study is to non-invasively visualize and characterize MEEs and bacterial biofilms in the middle ear. A portable, handheld, otoscope-integrated optical coherence tomography (OCT) system combined with novel analytical methods has been developed. In vivo middle ear OCT images were acquired from 53 pediatric subjects (average age of 3.9 years; all awake during OCT imaging) diagnosed with OM and undergoing a surgical procedure (ear tube surgery) to aspirate the MEE and aerate the middle ear. In vivo middle ear OCT acquired prior to the surgery was compared with OCT of the freshly extracted MEEs, clinical diagnosis, and post-operative evaluations. Among the subjects who were identified with the presence of MEEs, 89.6% showed the presence of the TM-adherent biofilm in in vivo OCT. This study provides an atlas of middle ear OCT images exhibiting a range of depth-resolved MEE features, which can only be visualized and assessed non-invasively through OCT. Quantitative metrics of OCT images acquired prior to the surgery were statistically correlated with surgical evaluations of MEEs. Measurements of MEE characteristics will provide new readily available information that can lead to improved diagnosis and management strategies for the highly prevalent OM in children.

Switching to brolucizumab: injection intervals and visual, anatomical and safety outcomes at 12 and 18 months in real-world eyes with neovascular age-related macular degeneration.

BACKGROUND: The anti-vascular endothelial growth factor (anti-VEGF) injection interval influences treatment burden and compliance in neovascular age-related macular degeneration (nAMD). This real-world study investigates visual acuity (VA), injection-interval extension, central macular thickness (CMT) and safety in nAMD eyes switched to the anti-VEGF agent brolucizumab and followed for up to 18 months. METHODS: This retrospective study included patients with nAMD who were switched from other anti-VEGF agents to brolucizumab only. Patient eyes were grouped into three nested cohorts with the overall cohort receiving ≥ 1 brolucizumab injection, the second receiving ≥ 3 brolucizumab injections with a follow-up period of ≥ 12 months and the third cohort receiving ≥ 3 brolucizumab injections with a follow-up period of ≥ 18 months. Study endpoints included changes from baseline at 12 or 18 months in VA, injection intervals, and CMT. Sub-group analyses were conducted using baseline injection interval length or baseline VA as qualifiers. RESULTS: Overall, 482 eyes received ≥ 1 brolucizumab injection; 174 eyes received ≥ 3 brolucizumab injections with ≥ 12 months of follow-up, and 95 eyes received ≥ 3 brolucizumab injections with ≥ 18 months of follow-up. VA (mean [95% confidence intervals]) remained stable relative to baseline after 12 months (- 1.1 [- 3.7, 1.6] letters; p = 0.42) and 18 months (0.0 [- 3.1, 3.1] letters; p = 0.98) of brolucizumab treatment, respectively, and pre-switch injection intervals or baseline VA had no notable effect. Following the switch to brolucizumab, injection intervals were extended from baseline to month 12 by 26.9 (19.7, 34.0) days (p < 0.0001), and eyes with pre-switch injection intervals < 8 weeks were able to have their injection intervals extended by 23.6 days longer than eyes with pre-switch injection intervals ≥ 8 weeks. At 18 months, injection intervals were extended by 36.3 (25.6, 46.9) days (p < 0.0001) compared to baseline. Following switch to brolucizumab, CMT was reduced at both 12 and 18 months (12 months: - 35.2 (- 51.7, - 18.8) µm, p < 0.0001; 18 months: - 38.9 (- 54.3, - 22.0) µm, p < 0.0001). Intraocular inflammation-related adverse events were reported in 4.6% of brolucizumab-treated eyes. CONCLUSIONS: This real-world study demonstrates that injection intervals may be significantly extended with maintained vision and reduced CMT in nAMD eyes switching to brolucizumab therapy from other anti-VEGFs.

Artificial intelligence-based computer-aided system for knee osteoarthritis assessment increases experienced orthopaedic surgeons' agreement rate and accuracy.

PURPOSE: The aims of this study were to (1) analyze the impact of an artificial intelligence (AI)-based computer system on the accuracy and agreement rate of board-certified orthopaedic surgeons (= senior readers) to detect X-ray features indicative of knee OA in comparison to unaided assessment and (2) compare the results to those of senior residents (= junior readers). METHODS: One hundred and twenty-four unilateral knee X-rays from the OAI study were analyzed regarding Kellgren-Lawrence grade, joint space narrowing (JSN), sclerosis and osteophyte OARSI grade by computerized methods. Images were rated for these parameters by three senior readers using two modalities: plain X-ray (unaided) and X-ray presented alongside reports from a computer-assisted detection system (aided). After exclusion of nine images with incomplete annotation, intraclass correlations between readers were calculated for both modalities among 115 images, and reader performance was compared to ground truth (OAI consensus). Accuracy, sensitivity and specificity were also calculated and the results were compared to those from a previous study on junior readers. RESULTS: With the aided modality, senior reader agreement rates for KL grade (2.0-fold), sclerosis (1.42-fold), JSN (1.37-fold) and osteophyte OARSI grades (3.33-fold) improved significantly. Reader specificity and accuracy increased significantly for all features when using the aided modality compared to the gold standard. On the other hand, sensitivity only increased for OA diagnosis, whereas it decreased (without statistical significance) for all other features. With aided analysis, senior readers reached similar agreement and accuracy rates as junior readers, with both surpassing AI performance. CONCLUSION: The introduction of AI-based computer-aided assessment systems can increase the agreement rate and overall accuracy for knee OA diagnosis among board-certified orthopaedic surgeons. Thus, use of this software may improve the standard of care for knee OA detection and diagnosis in the future. LEVEL OF EVIDENCE: Level II.

Automated classification of otitis media with OCT: augmenting pediatric image datasets with gold-standard animal model data.

Otitis media (OM) is an extremely common disease that affects children worldwide. Optical coherence tomography (OCT) has emerged as a noninvasive diagnostic tool for OM, which can detect the presence and quantify the properties of middle ear fluid and biofilms. Here, the use of OCT data from the chinchilla, the gold-standard OM model for the human disease, is used to supplement a human image database to produce diagnostically relevant conclusions in a machine learning model. Statistical analysis shows the datatypes are compatible, with a blended-species model reaching ∼95% accuracy and F1 score, maintaining performance while additional human data is collected.

Comparative Analysis of Gene Expression Patterns for Oral Epithelial Cell Functions in Periodontitis.

The structure and function of epithelial cells are critical for the construction and maintenance of intact epithelial surfaces throughout the body. Beyond the mechanical barrier functions, epithelial cells have been identified as active participants in providing warning signals to the host immune and inflammatory cells and in communicating various detailed information on the noxious challenge to help drive specificity in the characteristics of the host response related to health or pathologic inflammation. Rhesus monkeys were used in these studies to evaluate the gingival transcriptome for naturally occurring disease samples (GeneChip® Rhesus Macaque Genome Array) or for ligature-induced disease (GeneChip® Rhesus Gene 1.0 ST Array) to explore up to 452 annotated genes related to epithelial cell structure and functions. Animals were distributed by age into four groups: ≤ 3 years (young), 3-7 years (adolescent), 12-16 years (adult), and 18-23 years (aged). For naturally occurring disease, adult and aged periodontitis animals were used, which comprised 34 animals (14 females and 20 males). Groups of nine animals in similar age groups were included in a ligature-induced periodontitis experiment. A buccal gingival sample from either healthy or periodontitis-affected tissues were collected, and microarray analysis performed. The overall results of this investigation suggested a substantial alteration in epithelial cell functions that occurs rapidly with disease initiation. Many of these changes were prolonged throughout disease progression and generally reflect a disruption of normal cellular functions that would presage the resulting tissue destruction and clinical disease measures. Finally, clinical resolution may not signify biological resolution and represent a continued risk for disease that may require considerations for additional biologically specific interventions to best manage further disease.

Longitudinal optical coherence tomography to visualize the in vivo response of middle ear biofilms to antibiotic therapy.

Studying the impact of antibiotic treatment on otitis media (OM), the leading cause of primary care office visits during childhood, is critical to develop appropriate treatment strategies. Tracking dynamic middle ear conditions during antibiotic treatment is not readily applicable in patients, due to the limited diagnostic techniques available to detect the smaller amount and variation of middle ear effusion (MEE) and middle ear bacterial biofilm, responsible for chronic and recurrent OM. To overcome these challenges, a handheld optical coherence tomography (OCT) system has been developed to monitor in vivo response of biofilms and MEEs in the OM-induced chinchilla model, the standard model for human OM. As a result, the formation of MEE as well as biofilm adherent to the tympanic membrane (TM) was longitudinally assessed as OM developed. Various types of MEEs and biofilms in the chinchilla model were identified, which showed comparable features as those in humans. Furthermore, the effect of antibiotics on the biofilm as well as the amount and type of MEEs was investigated with low-dose and high-dose treatment (ceftriaxone). The capability of OCT to non-invasively track and examine middle ear conditions is highly beneficial for therapeutic OM studies and will lead to improved management of OM in patients.

In vivo dynamic characterization of the human tympanic membrane using pneumatic optical coherence tomography.

Decreased mobility of the human eardrum, the tympanic membrane (TM), is an essential indicator of a prevalent middle ear infection. The current diagnostic method to assess TM mobility is via pneumatic otoscopy, which provides subjective and qualitative information of subtle motion. In this study, a handheld spectral-domain pneumatic optical coherence tomography system was developed to simultaneously measure the displacement of the TM, air pressure inputs applied to a sealed ear canal, and to perform digital pneumatic otoscopy. A novel approach based on quantitative parameters is presented to characterize spatial and temporal variations of the dynamic TM motion. Furthermore, the TM motions of normal middle ears are compared with those of ears with middle ear infections. The capability of noninvasively measuring the rapid motion of the TM is beneficial to understand the complex dynamics of the human TM, and can ultimately lead to improved diagnosis and management of middle ear infections.

Gingival tissue autophagy pathway gene expression profiles in periodontitis and aging.

OBJECTIVE: We hypothesized that autophagy-related genes will be differentially expressed in periodontitis, suggesting an impaired gingival autophagic response associated with disease. BACKGROUND: Autophagy is a cellular physiologic mechanism to maintain tissue homeostasis, while deficient autophagic responses increase inflammation and susceptibility to infection. METHODS: Rhesus monkeys [<3 years to 23 years of age (n = 34)] were examined for periodontal health and naturally occurring periodontitis. Gingival tissues samples were obtained from healthy or diseased sites, total RNA was isolated, and the Rhesus Gene Chip 1.0 ST (Affymetrix) was used for gene expression analysis of 150 autophagy-related genes. RESULTS: Comparison of expression levels with adult healthy tissues demonstrated a rather limited number of individual genes that were significantly different across the age-groups. In contrast, with periodontitis in the adults and aged animals, about 15% of the genes were significantly increased or decreased. The differences were reflected in the mTOR complex (5/12), ULK1/ATG1 complex (5/9), PI3K complex (5/21), ATG9 complex (2/7), ATG12 conjugation/LC3 lipidation (7/22), and lysosome fusion/vesicle degradation [LF/VD (5/10)] activities within the broader autophagic pathway. The genes most greatly altered in gingival tissues of naturally occurring periodontitis were identified in the ATG12 and LF/VD pathways that approximated 50% of the genes in each of those categories. While healthy gingival aging did not appear to reflect altered autophagy gene expression, substantial differences were noted with periodontitis irrespective of the age of the animals. Future studies into the role of autophagy in periodontitis and could offer potential new therapeutic strategies to prevent and/or treat periodontal disease.

Assessing the Effect of Middle Ear Effusions on Wideband Acoustic Immittance Using Optical Coherence Tomography.

OBJECTIVES: Wideband acoustic immittance (WAI) noninvasively assesses middle ear function by measuring the sound conduction over a range of audible frequencies. Although several studies have shown the potential of WAI for detecting the presence of middle ear effusions (MEEs), determining the effects of MEE type and amount on WAI in vivo has been challenging due to the anatomical location of middle ear cavity. The purpose of this study is to correlate WAI measurements with physical characteristics of the middle ear and MEEs determined by optical coherence tomography (OCT), a noninvasive optical imaging technique. DESIGN: Sixteen pediatric subjects (average age of 7 ± 4 years) were recruited from the primary care clinic at Carle Foundation Hospital (Urbana, IL). A total of 22 ears (normal: 15 ears, otitis media with effusion: 6 ears, and acute otitis media: 1 ear, based on physician's diagnosis) were examined via standard otoscopy, tympanometry, OCT imaging, and WAI measurements in a busy, community-based clinical setting. Cross-sectional OCT images were analyzed to quantitatively assess the presence, type (relative turbidity based on the amount of scattering), and amount (relative fluid level) of MEEs. These OCT metrics were utilized to categorize subject ears into no MEE (control), biofilm without a MEE, serous-scant, serous-severe, mucoid-scant, and mucoid-severe MEE groups. The absorbance levels in each group were statistically evaluated at α = 0.05. RESULTS: The absorbance of the control group showed a similar trend when compared with a pediatric normative dataset, and the presence of an MEE generally decreased the power absorbance. The mucoid MEE group showed significantly less power absorbance from 2.74 to 4.73 kHz (p < 0.05) when compared with the serous MEE group, possibly due to the greater mass impeding the middle ear system. Similarly, the greater amount of middle ear fluid contributed to the lower power absorbance from 1.92 to 2.37 kHz (p< 0.05), when compared with smaller amounts of fluid. As expected, the MEEs with scant fluid only significantly affected the power absorbance at frequencies greater than 4.85 kHz. A large variance in the power absorbance was observed between 2 and 5 kHz, suggesting the dependence on both the type and amount of MEE. CONCLUSIONS: Physical characteristics of the middle ear and MEEs quantified from noninvasive OCT images can be helpful to understand abnormal WAI measurements. Mucoid MEEs decrease the power absorbance more than serous MEEs, and the greater amounts of MEE decreases the power absorbance, especially at higher (>2 kHz) frequencies. As both the type and amount of MEE can significantly affect WAI measurements, further investigations to correlate acoustic measurements with physical characteristics of middle ear conditions in vivo is needed.

Automated classification platform for the identification of otitis media using optical coherence tomography.

The diagnosis and treatment of otitis media (OM), a common childhood infection, is a significant burden on the healthcare system. Diagnosis relies on observer experience via otoscopy, although for non-specialists or inexperienced users, accurate diagnosis can be difficult. In past studies, optical coherence tomography (OCT) has been used to quantitatively characterize disease states of OM, although with the involvement of experts to interpret and correlate image-based indicators of infection with clinical information. In this paper, a flexible and comprehensive framework is presented that automatically extracts features from OCT images, classifies data, and presents clinically relevant results in a user-friendly platform suitable for point-of-care and primary care settings. This framework was used to test the discrimination between OCT images of normal controls, ears with biofilms, and ears with biofilms and middle ear fluid (effusion). Predicted future performance of this classification platform returned promising results (90%+ accuracy) in various initial tests. With integration into patient healthcare workflow, users of all levels of medical experience may be able to collect OCT data and accurately identify the presence of middle ear fluid and/or biofilms.

Correction: Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

The sequence for the Reverse primer used to amplify the human gene PLA2G2A presented in table 1 is incorrect. The following, is the correct sequence: Reverse 5' - GCTCCCTCTGCAGTGTTTATT -3.

Surgical treatment of posterior cruciate ligament lesions does not cause growth disturbances in pediatric patients.

PURPOSE: The aim of the present study was to describe epidemiology, management and outcome of pediatric and adolescent patients with posterior cruciate ligament (PCL) injuries. METHODS: Sixteen patients of less than 18 years of age with 7 PCL avulsion fractures and 9 PCL tears were included over a 10-year period. Trauma mechanism, additional injuries and treatment methods were analyzed. Follow-up examination included range of motion and ability to perform squats. Pedi-IKDC and Lysholm score were obtained and posterior shift was measured in kneeling view radiographs and compared to the contralateral side. Patients were grouped into pediatric patients with open physes at the time surgery and adolescent patients with closing or closed physes. In case of open physes, growth disturbances were assessed. RESULTS: Six of the treated patients (median age 12.5 years, range 10-13) had open physes at time of surgery. Five of those sustained avulsion fractures and treatment consisted of open reduction and screw fixation in four cases and graft reconstruction in one case. One patient sustained a PCL tear and underwent graft reconstruction. Follow-up at a median of 71.5 months (range 62-100) did not reveal any growth disturbances. Median Pedi-IKDC was 71.9 (range 51.7-92.1), median Lysholm score was 81.5 (range 66-88) and median posterior shift difference was 2.5 mm (range 0-11). The remaining 10 patients (median age 16 years, range 14-17) had closing/closed physis at the time of operation. Two patients presented with avulsion fractures treated with open reduction and screw fixation and 8 patients sustained PCL tears treated with graft reconstruction. At a median follow-up of 69.5 months (range 11-112), median Pedi-IKDC was 86.8 (range 36.8-97.7), median Lysholm score was 84.0 (range 45-95) and median posterior shift difference was 4 mm (range 0-15). CONCLUSIONS: In our small number of pediatric patients with PCL injuries, open reduction and epiphyseal screw fixation of displaced avulsed fractures and steep tunnel drilling in case of PCL reconstruction did not cause growth disturbances. Nevertheless, long-term functional impairment should be expected and close follow-up has to be recommended. LEVEL OF EVIDENCE: Therapeutic, Level IV.

Outcome following excision of the radial head in children with open physes for impaired elbow motion.

BACKGROUND: Only few reports have described the outcome of pediatric patients following radial head resection. Therefore, the aim of the present study was to assess clinical and radiologic outcome of patients with open physes following resection of the radial head. MATERIALS AND METHODS: Skeletally immature patients treated with resection of the radial head were included. Range of motion (ROM) of the elbow joint was compared with preoperative values. Grip strength, pronation and supination strength, and carrier angle were compared with the unaffected side. Radiographs were assessed for signs of arthrosis, radial migration, and perifocal ossification. Disabilities of the Arm, Shoulder and Hand and Mayo Elbow Performance scores were obtained. RESULTS: The study included 7 patients (mean age, 11 years), 5 with post-traumatic and 2 with congenitally impaired elbow joint motion. Mean follow-up was 47 months. Pronation/supination ROM improved significantly (P = .018). Extension/flexion ROM did not improve significantly (P = .122). Although grip strength (P = .027) and pronation strength (P = .028) of the affected side were significantly lower compared with the contralateral side, supination strength did not differ significantly (P = .176). The carrying angle was increased in 3 patients. Significant radial migration occurred (mean, 3 mm; standard deviation [SD], 3 mm; P = .018). Arthrosis was found in 3 patients. The mean Disabilities of the Arm, Shoulder and Hand score was 16.1 (range 8.8-30.8; SD, 10.1) and mean Mayo Elbow Performance Score was 88 (range, 70-100; SD, 12). CONCLUSIONS: Radial head excision may be considered for selected patients with open physes in cases of severe impairment of pronation/supination. However, sequelae such as radial migration, arthrosis, and elevation of the carrying angle should be expected.

The adsorption of dissolved organic carbon onto glass fiber filters and its effect on the measurement of particulate organic carbon: A laboratory and modeling exercise.

Particulate organic carbon (POC) represents a small portion of total carbon in the ocean. However, it plays a large role in the turnover of organic matter through the biological pump and other processes. Early on since the development of the POC measurement technique in the 1960s, it was known that dissolved organic carbon (DOC) adsorbs and is retained both on and in the filter. That retained DOC is measured as if it was part of the particulate fraction, an artifact that can cause significant overestimates of POC concentration. We set out to address the long-standing question of whether the magnitude of the DOC adsorption is affected by the quantity and quality of the dissolved organic matter in the sample. However, our results precluded an unequivocal answer to that question; nevertheless, the experimental data generated did allow us to develop and test predictive models that relate the mass of carbon adsorbed to the volume of sample filtered. The results indicate that the uptake of DOC can be predicted using an exponential model and that a saturation point is approached when approximately a half-liter of water is filtered. This model can be a valuable tool for correcting existing POC data sets that did not account for DOC adsorption. Nonetheless, this approach should not be regarded as a substitute for collecting in situ filter blanks in parallel with POC samples to prop-erly correct for this artifact.

In vivo detection of nanometer-scale structural changes of the human tympanic membrane in otitis media.

Otitis media (OM) is a common ear infection and a leading cause of conductive hearing loss in the pediatric population. Current technologies such as otoscopy, pneumatic otoscopy, tympanometry, and acoustic reflectometry are used to diagnose OM, which can reasonably diagnose the infection with a sensitivity and specificity of 50-90% and 60-90%, respectively. However, these techniques provide limited information about the physical architecture of the tympanic membrane (TM), or what may lie behind it. Here, we report the detection of nanometer-scale structural changes of the TM using nano-sensitive optical coherence tomography (nsOCT). In total, an image dataset from 65 pediatric subjects from three different groups (normal, acute OM, and chronic OM) and with longitudinal image-based analysis of ear infections were included in this study. The nsOCT data were correlated with physician diagnosis and with OCT thickness measurements and were found to be in good agreement with these results. We report that nsOCT detects in vivo structural deformations of the TM earlier than OCT alone, and enhances the detection sensitivity of OCT measurements. This unique technique for early detection of nano-scale structural modifications in the TM has the potential to aid in our understanding of microbiological effects, and possibly for early diagnosis and more effective treatment of OM.

Activation of Notch-1 in oral epithelial cells by P. gingivalis triggers the expression of the antimicrobial protein PLA2-IIA.

P. gingivalis (Pg) is an oral pathogen with the ability to induce oral dysbiosis and periodontal disease. Nevertheless, the mechanisms by which mucosal responses to the oral microbiota in the presence of specific pathogens such as Pg could abrogate the host-microbe symbiotic relationship leading to periodontitis remain unclear. Herein, we identified the Notch-1/PLA2-IIA axis as a new molecular pathway through which Pg could be specifically modulating oral epithelial antimicrobial and inflammatory responses. Pg activated Notch-1, and inhibition or silencing of Notch-1 completely abrogated Pg-induced PLA2-IIA in oral epithelial cells (OECs). Activation of Notch-1 and PLA2-IIA production were associated with Pg-produced gingipains. Other oral Gram-positive and Gram-negative species failed to induce similar responses. Pg enhanced OEC antimicrobial activity through PLA2-IIA. Increased Notch-1 activation correlated with higher PLA2-IIA gingival expression and changes in the abundance of specific oral bacteria phyla during periodontal disease. Oral bacterial species exhibited differential antimicrobial susceptibility to PLA2-IIA. These findings support previous evidence suggesting an important role for epithelial Notch-1 activation and PLA2-IIA production during health and disease at mucosal surfaces, and provide new mechanistic information concerning the regulation of epithelial antimicrobial and pro-inflammatory responses modulated by oral pathogenic bacteria associated with periodontal disease.

Pneumatic low-coherence interferometry otoscope to quantify tympanic membrane mobility and middle ear pressure.

Pneumatic otoscopy to assess the mobility of the tympanic membrane (TM) is a highly recommended diagnostic method of otitis media (OM), a widespread middle ear infection characterized by the fluid accumulation in the middle ear. Nonetheless, limited depth perception and subjective interpretation of small TM displacements have challenged the appropriate and efficient examination of TM dynamics experienced during OM. In this paper, a pneumatic otoscope integrated with low coherence interferometry (LCI) was adapted with a controlled pressure-generating system to record the pneumatic response of the TM and to estimate middle ear pressure (MEP). Forty-two ears diagnosed as normal (n = 25), with OM (n = 10), or associated with an upper respiratory infection (URI) (n = 7) were imaged with a pneumatic LCI otoscope with an axial, transverse, and temporal resolution of 6 µm, 20 µm, and 1 msec, respectively. The TM displacement under pneumatic pressure transients (a duration of 0.5 sec with an intensity of ± 150 daPa) was measured to compute two metrics (compliance and amplitude ratio). These metrics were correlated with peak acoustic admittance and MEP from tympanometry and statistically compared via Welch's t-test. As a result, the compliance represents pneumatic TM mobility, and the amplitude ratio estimates MEP. The presence of a middle ear effusion (MEE) significantly decreased compliance (p<0.001). The amplitude ratio of the OM group was statistically less than that of the normal group (p<0.01), indicating positive MEP. Unlike tympanometry, pneumatic LCI otoscopy quantifies TM mobility as well as MEP regardless of MEE presence. With combined benefits of pneumatic otoscopy and tympanometry, pneumatic LCI otoscopy may provide new quantitative metrics for understanding TM dynamics and diagnosing OM.