RESUMO
Hydrogen-bonded organic frameworks (HOFs) are a new class of crystalline porous organic molecular materials (POMMs) with great potential for a diverse range of applications. HOFs face common challenges to POMMs, and in general to purely organic crystals, that is, the difficulty of integrating complexity in crystals. Herein, we proposed a simple and sequential strategy for the formation of HOFs with hierarchical superstructures. The strategy is based on controlling the assembly conditions, avoiding the use of any surface functionalization or template, which allows to obtain hierarchical crystalline porous superstructures in an easy manner. As proof of concept, we obtained the first example of core-shell (HOF-on-HOF) crystals and HOFs with hierarchical superstructures having superhydrophobicity and trapping abilities for the capture of persistent water contaminants such as oils and microplastics. We expect that this strategy could serve as inspiration for the construction of more intricated multiscale structures that could greatly expand the library of HOFs materials.
RESUMO
To rationalise the binding of specific ligands to RNA-quadruplex we investigated several naphthalene diimide ligands that interact with the non-coding region of Pseudorabies virus (PRV). Herein we report on the x-ray structure of the naphthalene diimide ND11 with an RNA G-quadruplex putative forming sequence from rPRV. Consistent with previously observed rPRV sequence it assembles into a bimolecular RNA G-quadruplex consisting of a pair of two tetrads stacked 3' to 5'. We observe that ND11 interacts by binding on both the externally available 5' and 3' quartets. The CUC (loop 1) is structurally altered to enhance the 5' mode of interaction. These loop residues are shifted significantly to generate a new ligand binding pocket whereas the terminal A14 residue is lifted away from the RNA G-quadruplex tetrad plane to be restacked above the bound ND11 ligand NDI core. CD analysis of this family of NDI ligands shows consistency in the spectra between the different ligands in the presence of the rPRV RNA G-quadruplex motif, reflecting a common folded topology and mode of ligand interaction. FRET melt assay confirms the strong stabilising properties of the tetrasubstituted NDI compounds and the contributions length of the substituted groups have on melt temperatures.
RESUMO
Telomeres are specialized structures, found at the ends of linear chromosomes in eukaryotic cells, that play a crucial role in maintaining the stability and integrity of genomes. They are composed of repetitive DNA sequences, ssDNA overhangs, and several associated proteins. The length of telomeres is linked to cellular aging in humans, and deficiencies in their maintenance are associated with various diseases. Key structural motifs at the telomeres serve to protect vulnerable chromosomal ends. Telomeric DNA also has the ability to form diverse complex DNA higher-order structures, including T-loops, D-loops, R-loops, G-loops, G-quadruplexes, and i-motifs, in the complementary C-rich strand. While many essential proteins at telomeres have been identified, the intricacies of their interactions and structural details are still not fully understood. This Perspective highlights recent advancements in comprehending the structures associated with human telomeres. It emphasizes the significance of telomeres, explores various telomeric structural motifs, and delves into the structural biology surrounding telomeres and telomerase. Furthermore, telomeric loops, their topologies, and the associated proteins that contribute to the safeguarding of telomeres are discussed.
Assuntos
Quadruplex G , Telomerase , Humanos , Telômero/genética , Telômero/metabolismo , DNA/metabolismo , DNA de Cadeia Simples , Telomerase/genética , Telomerase/metabolismoRESUMO
As scientists who have worked with Stephen Neidle over many years and stages of his career, we present our perspective of his contributions to nucleic acid structural science. We trace some of the highlights of his research on nucleic acid drug interactions and the unique insights about the importance of hydration.
Assuntos
Ácidos Nucleicos , DNA/química , Conformação de Ácido NucleicoRESUMO
A single G-quadruplex forming sequence from the human telomere can adopt six distinct topologies that are inter-convertible under physiological conditions. This presents challenges to design ligands that show selectivity and specificity towards a particular conformation. Additional complexity is introduced in differentiating multimeric G-quadruplexes over monomeric species, which would be able to form in the single-stranded 3' ends of telomeres. A few ligands have been reported that bind to dimeric quadruplexes, but their preclinical pharmacological evaluation is limited. Using multidisciplinary approaches, we identified a novel quinoline core ligand, BMPQ-1, which bound to human telomeric G-quadruplex multimers over monomeric G-quadruplexes with high selectivity, and induced the formation of G-quadruplex DNA along with the related DNA damage response at the telomere. BMPQ-1 reduced tumor cell proliferation with an IC50 of â¼1.0 µM and decreased tumor growth rate in mouse by half. Biophysical analysis using smFRET identified a mixture of multiple conformations coexisting for dimeric G-quadruplexes in solution. Here, we showed that the titration of BMPQ-1 shifted the conformational ensemble of multimeric G-quadruplexes towards (3+1) hybrid-2 topology, which became more pronounced as further G-quadruplex units are added.
Assuntos
Proliferação de Células/efeitos dos fármacos , Quadruplex G , Conformação de Ácido Nucleico , Quinazolinas/química , Quinazolinas/farmacologia , Telômero/química , Telômero/metabolismo , Animais , Apoptose/efeitos dos fármacos , Ciclo Celular/efeitos dos fármacos , Linhagem Celular Tumoral , Dicroísmo Circular , Dano ao DNA , Transferência Ressonante de Energia de Fluorescência , Humanos , Concentração Inibidora 50 , Ligantes , Masculino , Camundongos , Camundongos Endogâmicos BALB C , Camundongos Nus , Neoplasias/tratamento farmacológico , Quinazolinas/uso terapêutico , Ensaios Antitumorais Modelo de XenoenxertoRESUMO
Obtaining phase information remains a formidable challenge for nucleic acid structure determination. The introduction of an X-ray synchrotron beamline designed to be tunable to long wavelengths at Diamond Light Source has opened the possibility to native de novo structure determinations by the use of intrinsic scattering elements. This provides opportunities to overcome the limitations of introducing modifying nucleotides, often required to derive phasing information. In this paper, we build on established methods to generate new tools for nucleic acid structure determinations. We report on the use of (i) native intrinsic potassium single-wavelength anomalous dispersion methods (K-SAD), (ii) use of anomalous scattering elements integral to the crystallization buffer (extrinsic cobalt and intrinsic potassium ions), (iii) extrinsic bromine and intrinsic phosphorus SAD to solve complex nucleic acid structures. Using the reported methods we solved the structures of (i) Pseudorabies virus (PRV) RNA G-quadruplex and ligand complex, (ii) PRV DNA G-quadruplex, and (iii) an i-motif of human telomeric sequence. Our results highlight the utility of using intrinsic scattering as a pathway to solve and determine non-canonical nucleic acid motifs and reveal the variability of topology, influence of ligand binding, and glycosidic angle rearrangements seen between RNA and DNA G-quadruplexes of the same sequence.
Assuntos
Cristalografia por Raios X/métodos , Motivos de Nucleotídeos , Quadruplex G , Herpesvirus Suídeo 1/química , Humanos , RNA Viral/química , Telômero/químicaRESUMO
Bioluminescence imaging (BLI) is ubiquitous in scientific research for the sensitive tracking of biological processes in small animal models. However, due to the attenuation of visible light by tissue, and the limited set of near-infrared bioluminescent enzymes, BLI is largely restricted to monitoring single processes in vivo. Here we show, that by combining stabilised colour mutants of firefly luciferase (FLuc) with the luciferin (LH2) analogue infraluciferin (iLH2), near-infrared dual BLI can be achieved in vivo. The X-ray crystal structure of FLuc with a high-energy intermediate analogue, 5'-O-[N-(dehydroinfraluciferyl)sulfamoyl] adenosine (iDLSA) provides insight into the FLuc-iLH2 reaction leading to near-infrared light emission. The spectral characterisation and unmixing validation studies reported here established that iLH2 is superior to LH2 for the spectral unmixing of bioluminescent signals in vivo; which led to this novel near-infrared dual BLI system being applied to monitor both tumour burden and CAR T cell therapy within a systemically induced mouse tumour model.
Assuntos
Medições Luminescentes/métodos , Neoplasias/diagnóstico por imagem , Neoplasias/patologia , Imagem Óptica/métodos , Animais , Cristalografia por Raios X , Modelos Animais de Doenças , Proteínas Luminescentes/análise , Proteínas Luminescentes/química , Proteínas Luminescentes/genética , Masculino , Camundongos , Transplante de Neoplasias , Conformação Proteica , Proteínas Recombinantes de Fusão/análise , Proteínas Recombinantes de Fusão/química , Proteínas Recombinantes de Fusão/genéticaRESUMO
The application of X-ray crystallographic methods toward a structural understanding of G-quadruplex (G4) motifs at atomic level resolution can provide researchers with exciting opportunities to explore new structural arrangements of putative G4 forming sequences and investigate their recognition by small molecule compounds. The crowded and ordered crystalline environment requires the self-assembly of stable G4 motifs, allowing for an understanding of their inter- and intramolecular interactions in a packed environment, revealing thermodynamically stable topologies. Additionally, crystallographic data derived from these experiments in the form of electron density provides valuable opportunities to visualize various solvent molecules associated with G4s along with the geometries of the metal ions associated within the central channel-elements critical to the understanding G4 stability and topology. Now, with the advent of affordable, commercially sourced and purified synthetic DNA and RNA molecules suitable for immediate crystallization trials, and combined with the availability of specialized and validated crystallization screens, researchers can now undertake in-house crystallization trials without the need for local expertise. When this is combined with access to modern synchrotron platforms that offer complete automation of the data collection process-from the receipt of crystals to delivery of merged and scaled data for the visualization of electron density-the application of X-ray crystallographic techniques is made open to nonspecialist researchers. In this chapter we aim to provide a simple how-to guide to enable the reader to undertake crystallographic experiments involving G4s, encompassing the design of oligonucleotide sequences, fundamentals of the crystallization process and modern strategies used in setting up successful crystallization trials. We will also describe data collection strategies, phasing, electron density visualization, and model building. We will draw on our own experiences in the laboratory and hopefully build an appreciation of the utility of the X-ray crystallographic approaches to investigating G4s.
Assuntos
Cristalografia por Raios X/métodos , Quadruplex G , Difração de Raios XRESUMO
Cells have evolved inherent mechanisms, like homologous recombination (HR), to repair damaged DNA. However, repairs at telomeres can lead to genomic instability, often associated with cancer. While most rapidly dividing cells employ telomerase, the others maintain telomere length through HR-dependent alternative lengthening of telomeres (ALT) pathways. Here we describe the crystal structures of Holliday junction intermediates of the HR-dependent ALT mechanism. Using an extended human telomeric repeat, we also report the crystal structure of two Holliday junctions in close proximity, which associate together through strand exchange to form a hemicatenated double Holliday junction. Our combined structural results demonstrate that ACC nucleotides in the C-rich lagging strand (5'-CTAACCCTAA-3') at the telomere repeat sequence constitute a conserved structural feature that constrains crossover geometry and is a preferred site for Holliday junction formation in telomeres.
Assuntos
DNA/química , Telômero/química , Cristalização , Humanos , Modelos Moleculares , Conformação de Ácido NucleicoRESUMO
Anti-cancer drug discovery efforts to directly inhibit the signal transducer and activator of transcription 3 (STAT3) have been active for over a decade following the discovery that 70% of cancers exhibit elevated STAT3 activity. The majority of research has focused on attenuating STAT3 activity through preventing homo-dimerization by targeting the SH2 or transcriptional activation domains. Such dimerization inhibitors have not yet reached the market. However, an alternative strategy focussed on preventing STAT3 DNA-binding through targeting the DNA-binding domain (DBD) offers new drug design opportunities. Currently, only EMSA and ELISA-based methods have been implemented with suitable reliability to characterize STAT3 DBD inhibitors. Herein, we present a new orthogonal, fluorescence polarization (FP) assay suitable for high-throughput screening of molecules. This assay, using a STAT3127-688 construct, was developed and optimized to screen molecules that attenuate the STAT3:DNA association with good reliability (Z' value > 0.6) and a significant contrast (signal-to-noise ratio > 15.0) at equilibrium. The assay system was stable over a 48 hour period. Significantly, the assay is homogeneous and simple to implement for high-throughput screening compared to EMSA and ELISA. Overall, this FP assay offers a new way to identify and characterize novel molecules that inhibit STAT3:DNA association.
RESUMO
Gastro-intestinal tumours (GISTs) are driven by aberrant expression of the c-KIT oncoprotein. They can be effectively treated by the kinase inhibitor imatinib, which locks the c-KIT kinase domain into an inactive conformation. However resistance to imatinib, driven by active-site mutations, is a recurrent clinical challenge, which has been only partly met by the subsequent development of second and third-generation c-KIT inhibitors. It is reported here that a tetra-substituted naphthalene diimide derivative, which is a micromolar inhibitor of cell growth in a wild-type patient-derived GIST cell line, has a sub-micromolar activity in two distinct patient-derived imatinib-resistant cell lines. The compound has been previously shown to down-regulate expression of the c-KIT protein in a wild-type GIST cell line. It does not affect c-KIT protein expression in a resistant cell line to the same extent, whereas it profoundly down-regulates the expression of the anti-apoptopic protein BCL-2. It is proposed that the mechanism of action involves targeting quadruplex nucleic acid structures, and in particular those in the BCL-2 gene and its RNA transcript. The BCL-2 protein is up-regulated in the GIST-resistant cell line, and is strongly down-regulated after treatment. The compound strongly stabilises a range of G-quadruplexes including a DNA one from the BCL-2 promoter and an RNA quadruplex from its 5'-UTR region. A reporter assay construct incorporating the 5'-UTR quadruplex sequence demonstrates down-regulation of BCL-2 expression.
Assuntos
Quadruplex G , Neoplasias Gastrointestinais/tratamento farmacológico , Mesilato de Imatinib , Imidas/química , Naftalenos/química , Proteínas Proto-Oncogênicas c-bcl-2/efeitos dos fármacos , Regulação para Baixo/efeitos dos fármacos , Resistencia a Medicamentos Antineoplásicos/efeitos dos fármacos , Quadruplex G/efeitos dos fármacos , Humanos , Mesilato de Imatinib/química , Ligantes , Células MCF-7 , Estrutura Molecular , Proteínas Proto-Oncogênicas c-bcl-2/metabolismoRESUMO
We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
Assuntos
Telômero , Cristalografia por Raios X , Quadruplex G , Ligantes , Modelos Moleculares , Conformação de Ácido NucleicoRESUMO
G-rich sequences in DNA and RNA have a propensity to fold into stable secondary structures termed G-quadruplexes. G-quadruplex forming sequences are widespread throughout the human genome, within both, protein coding and non-coding genes, and regulatory regions. G-quadruplexes have been implicated in multiple cellular functions including chromatin epigenetic regulation, DNA recombination, transcriptional regulation of gene promoters and enhancers, and translation. Here we will review the evidence for the occurrence of G-quadruplexes both in vitro and in vivo; their role in neurological diseases including G-quadruplex-forming repeat expansions in the C9orf72 gene in frontotemporal dementia and amyotrophic lateral sclerosis and loss of the G-quadruplex binding protein FMRP in the intellectual disability fragile X syndrome. We also review mounting evidence that supports a role for G-quadruplexes in regulating the processing or function of a range of non-coding RNAs. Finally we will highlight current perspectives for therapeutic interventions that target G-quadruplexes.
Assuntos
Quadruplex G , Doenças Neurodegenerativas/genética , Transcriptoma , HumanosRESUMO
The sequence d(GGGCGGGGAGGGGGAAGGGA) occurs in the promoter region of the B-raf gene. An X-ray crystallographic study has found that this forms an unprecedented dimeric quadruplex arrangement, with a core of seven consecutive G-quartets and an uninterrupted run of six potassium ions in the central channel of the quadruplex. Analogy with previously reported promoter quadruplexes had initially suggested that in common with these a monomeric quadruplex was to be expected. The structure has a distorted G·C·G·C base quartet at one end and four flipped-out adenosine nucleosides at the other. The only loops in the structure are formed by the cytosine and by the three adenosines within the sequence, with all of the guanosines participating in G-quartet formation. Solution UV and circular dichroism data are in accord with a stable quadruple arrangement being formed. 1D NMR data, together with gel electrophoresis measurements, are consistent with a dimer being the dominant species in potassium solution. A single-chain intramolecular quadruplex has been straightforwardly constructed using molecular modeling, by means of a six-nucleotide sequence joining 3' and 5' ends of each strand in the dimer. A human genomic database search has revealed a number of sequences containing eight or more consecutive short G-tracts, suggesting that such intramolecular quadruplexes could be formed within the human genome.
Assuntos
Quadruplex G , Modelos Moleculares , Regiões Promotoras Genéticas , Proteínas Proto-Oncogênicas B-raf/química , Sequência de Bases , Dicroísmo Circular , Cristalografia por Raios X , Dimerização , Eletroforese em Gel de Ágar , Humanos , Proteínas Proto-Oncogênicas B-raf/genéticaRESUMO
The STAT3 transcription factor plays a central role in a wide range of cancer types where it is over-expressed. Previously, phosphorylation of this protein was thought to be a prerequisite for direct binding to DNA. However, we have now shown complete binding of a purified unphosphorylated STAT3 (uSTAT3) core directly to M67 DNA, the high affinity STAT3 target DNA sequence, by a protein electrophoretic mobility shift assay (PEMSA). Binding to M67 DNA was inhibited by addition of increasing concentrations of a phosphotyrosyl peptide. X-ray crystallography demonstrates one mode of binding that is similar to that known for the STAT3 core phosphorylated at Y705.
Assuntos
DNA/química , DNA/metabolismo , Ensaio de Desvio de Mobilidade Eletroforética/métodos , Fator de Transcrição STAT3/química , Fator de Transcrição STAT3/metabolismo , Animais , Sítios de Ligação , Ligação Competitiva , Dicroísmo Circular , Cristalografia por Raios X , DNA/genética , Humanos , Proteínas Luminescentes/genética , Proteínas Luminescentes/metabolismo , Modelos Moleculares , Conformação de Ácido Nucleico , Fosfopeptídeos/química , Fosfopeptídeos/metabolismo , Fosforilação , Ligação Proteica , Estrutura Secundária de Proteína , Estrutura Terciária de Proteína , Fator de Transcrição STAT3/genética , Tirosina/química , Tirosina/genética , Tirosina/metabolismoRESUMO
We report the first complete structure elucidation of the ent-kaurane diterpenoid glycoside atractyloside (1) by means of NMR and X-ray diffractometry techniques. Extensive one- and two-dimensional NMR experiments were employed to assign the proton and carbon signals of 1, and crystallography experiments established the configurations of all stereogenic centers. Furthermore, we present a novel semisynthetic route for the preparation of the highly cytotoxic aglycone derivative of 1, 15-didehydroatractyligenin methyl ester (3). All compounds were tested for their antibiotic activity against Enterococcus faecalis, Escherichia coli, and several strains of Staphylococcus aureus, including fluoroquinolone-resistant (SA1199B) and two epidemic MRSA (EMRSA-15 and -16) strains. Compound 3 exhibited moderate activity against all of the Staph. aureus strains with an MIC value of 128 mg/L.
Assuntos
Antibacterianos/química , Antibacterianos/farmacologia , Atractilosídeo/química , Atractilosídeo/farmacologia , Atractilosídeo/análogos & derivados , Cristalografia por Raios X , Enterococcus faecalis/efeitos dos fármacos , Escherichia coli/efeitos dos fármacos , Staphylococcus aureus Resistente à Meticilina/efeitos dos fármacos , Testes de Sensibilidade Microbiana , Ressonância Magnética Nuclear Biomolecular , Staphylococcus aureus/efeitos dos fármacosRESUMO
We report here the 1.62 Å crystal structure of an intramolecular quadruplex DNA formed from a sequence in the promoter region of the c-kit gene. This is the first reported crystal structure of a promoter quadruplex and the first observation of localized magnesium ions in a quadruplex structure. The structure reveals that potassium and magnesium ions have an unexpected yet significant structural role in stabilizing particular quadruplex loops and grooves that is distinct from but in addition to the role of potassium ions in the ion channel at the centre of all quadruplex structures. The analysis also shows how ions cluster together with structured water molecules to stabilize the quadruplex arrangement. This particular quadruplex has been previously studied by NMR methods, and the present X-ray structure is in accord with the earlier topology assignment. However, as well as the observations of potassium and magnesium ions, the crystal structure has revealed a highly significant difference in the dimensions of the large cleft in the structure, which is a plausible target for small molecules. This difference can be understood by the stabilizing role of structured water networks.
Assuntos
Quadruplex G , Magnésio/química , Potássio/química , Regiões Promotoras Genéticas , Proteínas Proto-Oncogênicas c-kit/genética , Água/química , Cátions/química , Cristalografia por Raios X , DNA/química , Modelos Moleculares , Conformação de Ácido NucleicoRESUMO
The folding of the single-stranded 3' end of the human telomere into G-quadruplex arrangements inhibits the overhang from hybridizing with the RNA template of telomerase and halts telomere maintenance in cancer cells. The ability to thermally stabilize human telomeric DNA as a four-stranded G-quadruplex structure by developing selective small molecule compounds is a therapeutic path to regulating telomerase activity and thereby selectively inhibit cancer cell growth. The development of compounds with the necessary selectivity and affinity to target parallel-stranded G-quadruplex structures has proved particularly challenging to date, relying heavily upon limited structural data. We report here on a structure-based approach to the design of quadruplex-binding ligands to enhance affinity and selectivity for human telomeric DNA. Crystal structures have been determined of complexes between a 22-mer intramolecular human telomeric quadruplex and two potent tetra-substituted naphthalene diimide compounds, functionalized with positively charged N-methyl-piperazine side-chains. These compounds promote parallel-stranded quadruplex topology, binding exclusively to the 3' surface of each quadruplex. There are significant differences between the complexes in terms of ligand mobility and in the interactions with quadruplex grooves. One of the two ligands is markedly less mobile in the crystal complex and is more quadruplex-stabilizing, forming multiple electrostatic/hydrogen bond contacts with quadruplex phosphate groups. The data presented here provides a structural rationale for the biophysical (effects on quadruplex thermal stabilization) and biological data (inhibition of proliferation in cancer cell lines and evidence of in vivo antitumor activity) on compounds in this series and, thus, for the concept of telomere targeting with DNA quadruplex-binding small molecules.
Assuntos
Antineoplásicos/química , DNA/química , Quadruplex G , Imidas/química , Naftalenos/química , Telômero/química , Antineoplásicos/síntese química , Antineoplásicos/farmacologia , Linhagem Celular Tumoral , Proliferação de Células/efeitos dos fármacos , Cristalografia por Raios X , Ensaios de Seleção de Medicamentos Antitumorais , Humanos , Ligação de Hidrogênio , Imidas/síntese química , Imidas/farmacologia , Ligantes , Modelos Moleculares , Estrutura Molecular , Naftalenos/síntese química , Naftalenos/farmacologia , Relação Estrutura-AtividadeRESUMO
The first X-ray crystal structures of nickel(II) and copper(II) salphen metal complexes bound to a quadruplex DNA are presented. Two structures have been determined and show that these salphen-metal complexes bind to human telomeric quadruplexes by end-stacking, with the metal in each case almost in line with the potassium ion channel. Quadruplex and duplex DNA binding is presented for these two and other related salphen complexes, all with side-chains terminating in pyrrolidino end-groups and differing patterns of substitution on the salphen core. The crystal structures are able to provide rationalizations for the structure-activity data, and in particular for the superior quadruplex-binding of the nickel complexes compared to that of the copper-containing ones. The complexes show significant antiproliferative activity for the compounds in a panel of cancer cell lines. They also show telomerase inhibitory activity in the telomerase TRAP-LIG assay.