Recapitulation of human pathophysiology and identification of forensic biomarkers in a translational model of chlorine inhalation injury.

Chlorine gas (Cl2) has been repeatedly used as a chemical weapon, first in World War I and most recently in Syria. Life-threatening Cl2 exposures frequently occur in domestic and occupational environments, and in transportation accidents. Modeling the human etiology of Cl2-induced acute lung injury (ALI), forensic biomarkers, and targeted countermeasures development have been hampered by inadequate large animal models. The objective of this study was to develop a translational model of Cl2-induced ALI in swine to understand toxico-pathophysiology and evaluate whether it is suitable for screening potential medical countermeasures and to identify biomarkers useful for forensic analysis. Specific pathogen-free Yorkshire swine (30-40 kg) of either sex were exposed to Cl2 (≤240 ppm for 1 h) or filtered air under anesthesia and controlled mechanical ventilation. Exposure to Cl2 resulted in severe hypoxia and hypoxemia, increased airway resistance and peak inspiratory pressure, and decreased dynamic lung compliance. Cl2 exposure resulted in increased total leucocyte and neutrophil counts in bronchoalveolar lavage fluid, vascular leakage, and pulmonary edema compared with the air-exposed group. The model recapitulated all three key histopathological features of human ALI, such as neutrophilic alveolitis, deposition of hyaline membranes, and formation of microthrombi. Free and lipid-bound 2-chlorofatty acids and chlorotyrosine-modified proteins (3-chloro-l-tyrosine and 3,5-dichloro-l-tyrosine) were detected in plasma and lung tissue after Cl2 exposure. In this study, we developed a translational swine model that recapitulates key features of human Cl2 inhalation injury and is suitable for testing medical countermeasures, and validated chlorinated fatty acids and protein adducts as biomarkers of Cl2 inhalation.NEW & NOTEWORTHY We established a swine model of chlorine gas-induced acute lung injury that exhibits several features of human acute lung injury and is suitable for screening potential medical countermeasures. We validated chlorinated fatty acids and protein adducts in plasma and lung samples as forensic biomarkers of chlorine inhalation.

Establishing Population Values for Chlorine Exposure in the United States (2015-2016) Using 2 Chlorine Biomarkers, 3-Chlorotyrosine and 3,5-Dichlorotyrosine.

BACKGROUND: In the United States, 12 million short tons of chlorine are manufactured and transported each year. Due to the volume of this volatile chemical, large- and small-scale chemical exposures occur frequently. To diagnose and treat potentially exposed individuals, reference range values for confirmatory biomarkers are required to differentiate between normal and abnormal exposure levels. METHODS: Serum surplus samples (n = 1780) from the National Health and Nutrition Examination Survey (NHANES) 2015-2016 were measured for 2 chlorine biomarkers, 3-chlorotyrosine (Cl-Tyr) and 3,5-dichlorotyrosine (Cl2-Tyr), by liquid chromatography coupled to a triple quadrupole mass spectrometer. We evaluated demographic factors associated with elevated biomarker levels. RESULTS: Participant samples were analyzed for the chlorine biomarkers Cl-Tyr and Cl2-Tyr. In the unweighted analysis of these samples, 1349 (75.8%) were under the limit of detection (< LOD) of 2.50 ng/mL for Cl-Tyr and 1773 (99.6%) were < LOD for Cl2-Tyr. Samples within the method reportable range were 2.50 to 35.6 ng/mL for Cl-Tyr and 2.69 to 11.2 ng/mL for Cl2-Tyr. Since only 7 of the 1780 participants had detectable Cl2-Tyr, statistical analysis was limited to Cl-Tyr. Of the demographic characteristics examined, age, body mass index (BMI), estimated glomerular filtration rate (eGFR), and sex exhibited statistically significant differences in the weighted prevalence of detectable Cl-Tyr. CONCLUSIONS: This is the first reported set of Cl-Tyr and Cl2-Tyr population values for the United States. This population range coupled with NHANES demographic information could help healthcare professionals distinguish between normal and abnormal chlorine biomarker levels in an emergency. With this information, an inference could be made when determining acute chlorine exposure in individuals.

Development of a clinical assay to measure chlorinated tyrosine in hair and tissue samples using a mouse chlorine inhalation exposure model.

Chlorine is a toxic industrial chemical with a history of use as a chemical weapon. Chlorine is also produced, stored, and transported in bulk making it a high-priority pulmonary threat in the USA. Due to the high reactivity of chlorine, few biomarkers exist to identify exposure in clinical and environmental samples. Our laboratory evaluates acute chlorine exposure in clinical samples by measuring 3-chlorotyrosine (Cl-Tyr) and 3,5-dichlorotyrosine (Cl2-Tyr) using liquid chromatography tandem mass spectrometry (LC-MS/MS). Individuals can have elevated biomarker levels due to their environment and chronic health conditions, but levels are significantly lower in individuals exposed to chlorine. Historically these biomarkers have been evaluated in serum, plasma, blood, and bronchoalveolar lavage (BAL) fluid. We report the expansion into hair and lung tissue samples using our newly developed tissue homogenization protocol which fits seamlessly with our current chlorinated tyrosine quantitative assay. Furthermore, we have updated the chlorinated tyrosine assay to improve throughput and ruggedness and reduce sample volume requirements. The improved assay was used to measure chlorinated tyrosine levels in 198 mice exposed to either chlorine gas or air. From this animal study, we compared Cl-Tyr and Cl2-Tyr levels among three matrices (i.e., lung, hair, and blood) and found that hair had the most abundant chlorine exposure biomarkers. Furthermore, we captured the first timeline of each analyte in the lung, hair, and blood samples. In mice exposed to chlorine gas, both Cl-Tyr and Cl2-Tyr were present in blood and lung samples up to 24 h and up to 30 days in hair samples.

A quantitative method to detect human exposure to sulfur and nitrogen mustards via protein adducts.

Sulfur and nitrogen mustards are internationally banned vesicants listed as Schedule 1 chemical agents in the Chemical Weapons Convention. These compounds are highly reactive electrophiles that form stable adducts to a variety of available amino acid residues on proteins upon exposure. We present a quantitative exposure assay that simultaneously measures agent specific protein adducts to cysteine for sulfur mustard (HD) and three nitrogen mustards (HN1, HN2, and HN3). Proteinase K was added to a serum or plasma sample to digest protein adducts and form the target analyte, the blister agent bound to the tripeptide cysteine-proline-phenylalanine (CPF). The mustard adducted-tripeptide was purified by solid phase extraction and analyzed using isotope dilution LC-MS/MS. Product ion structures were identified using high-resolution product ion scan data for HD-CPF, HN1-CPF, HN2-CPF, and HN3-CPF. Thorough matrix comparison, analyte recovery, ruggedness, and stability studies were incorporated during method validation to produce a robust method. The method demonstrated long term-stability, precision (RSD < 15%), and intra- and inter-day accuracies > 85% across the reportable range of 3.00-200 ng/mL for each analyte. Compared to previously published assays, this method quantitates both sulfur and nitrogen mustard exposure biomarkers, requires only 10 µL of sample volume, and can use either a liquid sample or dried sample spot.

Supplemental Learning in the Laboratory: An Innovative Approach for Evaluating Knowledge and Method Transfer.

The Multi-Rule Quality Control System (MRQCS) is a tool currently employed by the Centers for Disease Control and Prevention (CDC) to evaluate and compare laboratory performance. We have applied the MRQCS to a comparison of instructor and computer-led pre-laboratory lectures for a supplemental learning experiment. Students in general chemistry and analytical chemistry from both two- and four-year institutions performed two laboratory experiments as part of their normal laboratory curriculum. The first laboratory experiment was a foundational learning experiment in which all the students were introduced to Beer-Lambert's Law and spectrophotometric light absorbance measurements. The foundational learning experiment was instructor-led only, and participant performance was evaluated against a mean characterized value. The second laboratory experiment was a supplemental learning experiment in which students were asked to build upon the methodology they learned in the foundational learning experiment and apply it to a different analyte. The instruction type was varied randomly into two delivery modes, participants receiving either instructor-led or computer-led pre-laboratory instruction. The MRQCS was applied and determined that no statistical difference was found to exist in the QC (quality control) passing rates between the participants in the instructor-led instruction and the participants in the computer-led instruction. These findings demonstrate the successful application of the MRQCS to evaluate knowledge and technology transfer.

Bridging the Gap between Sample Collection and Laboratory Analysis: Using Dried Blood Spots to Identify Human Exposure to Chemical Agents.

Public health response to large scale chemical emergencies presents logistical challenges for sample collection, transport, and analysis. Diagnostic methods used to identify and determine exposure to chemical warfare agents, toxins, and poisons traditionally involve blood collection by phlebotomists, cold transport of biomedical samples, and costly sample preparation techniques. Use of dried blood spots, which consist of dried blood on an FDA-approved substrate, can increase analyte stability, decrease infection hazard for those handling samples, greatly reduce the cost of shipping/storing samples by removing the need for refrigeration and cold chain transportation, and be self-prepared by potentially exposed individuals using a simple finger prick and blood spot compatible paper. Our laboratory has developed clinical assays to detect human exposures to nerve agents through the analysis of specific protein adducts and metabolites, for which a simple extraction from a dried blood spot is sufficient for removing matrix interferents and attaining sensitivities on par with traditional sampling methods. The use of dried blood spots can bridge the gap between the laboratory and the field allowing for large scale sample collection with minimal impact on hospital resources while maintaining sensitivity, specificity, traceability, and quality requirements for both clinical and forensic applications.

Simultaneous Measurement of 3-Chlorotyrosine and 3,5-Dichlorotyrosine in Whole Blood, Serum and Plasma by Isotope Dilution HPLC-MS-MS.

Chlorine is a public health concern and potential threat due to its high reactivity, ease and scale of production, widespread industrial use, bulk transportation, massive stockpiles and history as a chemical weapon. This work describes a new, sensitive and rapid stable isotope dilution method for the retrospective detection and quantitation of two chlorine adducts. The biomarkers 3-chlorotyrosine (Cl-Tyr) and 3,5-dichlorotyrosine (Cl2-Tyr) were isolated from the pronase digest of chlorine exposed whole blood, serum or plasma by solid-phase extraction (SPE), separated by reversed-phase HPLC and detected by tandem mass spectrometry (MS-MS). The calibration range is 2.50-1,000 ng/mL (R2 ≥ 0.998) with a lowest reportable limit (LRL) of 2.50 ng/mL for both analytes, an accuracy of ≥93% and an LOD of 0.443 ng/mL for Cl-Tyr and 0.396 ng/mL for Cl2-Tyr. Inter- and intra-day precision of quality control samples had coefficients of variation of ≤10% and ≤7.0%, respectively. Blood and serum samples from 200 healthy individuals and 175 individuals with chronic inflammatory disease were analyzed using this method to assess background levels of chlorinated tyrosine adducts. Results from patients with no known inflammatory disease history (healthy) showed baseline levels of

Enhanced stability of blood matrices using a dried sample spot assay to measure human butyrylcholinesterase activity and nerve agent adducts.

Dried matrix spots are safer to handle and easier to store than wet blood products, but factors such as intraspot variability and unknown sample volumes have limited their appeal as a sampling format for quantitative analyses. In this work, we introduce a dried spot activity assay for quantifying butyrylcholinesterase (BChE) specific activity which is BChE activity normalized to the total protein content in a sample spot. The method was demonstrated with blood, serum, and plasma spotted on specimen collection devices (cards) which were extracted to measure total protein and BChE activity using a modified Ellman assay. Activity recovered from dried spots was ∼80% of the initial spotted activity for blood and >90% for plasma and serum. Measuring total protein in the sample and calculating specific activity substantially improved quantification and reduced intraspot variability. Analyte stability of nerve agent adducts was also evaluated, and the results obtained via BChE-specific activity measurements were confirmed by quantification of BChE adducts using a previously established LC-MS/MS method. The spotted samples were up to 10 times more resistant to degradation compared to unspotted control samples when measuring BChE inhibition by the nerve agents sarin and VX. Using this method, both BChE activity and adducts can be accurately measured from a dried sample spot. This use of a dried sample spot with normalization to total protein is robust, demonstrates decreased intraspot variability without the need to control for initial sample volume, and enhances analyte stability.

Simultaneous measurement of tabun, sarin, soman, cyclosarin, VR, VX, and VM adducts to tyrosine in blood products by isotope dilution UHPLC-MS/MS.

This work describes a new specific, sensitive, and rapid stable isotope dilution method for the simultaneous detection of the organophosphorus nerve agents (OPNAs) tabun (GA), sarin (GB), soman (GD), cyclosarin (GF), VR, VX, and VM adducts to tyrosine (Tyr). Serum, plasma, and lysed whole blood samples (50 µL) were prepared by protein precipitation followed by digestion with Pronase. Specific Tyr adducts were isolated from the digest by a single solid phase extraction (SPE) step, and the analytes were separated by reversed-phase ultra high performance liquid chromatography (UHPLC) gradient elution in less than 2 min. Detection was performed on a triple quadrupole tandem mass spectrometer using time-triggered selected reaction monitoring (SRM) in positive electrospray ionization (ESI) mode. The calibration range was characterized from 0.100-50.0 ng/mL for GB- and VR-Tyr and 0.250-50.0 ng/mL for GA-, GD-, GF-, and VX/VM-Tyr (R(2) ≥ 0.995). Inter- and intra-assay precision had coefficients of variation of ≤17 and ≤10%, respectively, and the measured concentration accuracies of spiked samples were within 15% of the targeted value for multiple spiking levels. The limit of detection was calculated to be 0.097, 0.027, 0.018, 0.074, 0.023, and 0.083 ng/mL for GA-, GB-, GD-, GF-, VR-, and VX/VM-Tyr, respectively. A convenience set of 96 serum samples with no known nerve agent exposure was screened and revealed no baseline values or potential interferences. This method provides a simple and highly specific diagnostic tool that may extend the time postevent that a confirmation of nerve agent exposure can be made with confidence.

An enhanced butyrylcholinesterase method to measure organophosphorus nerve agent exposure in humans.

Organophosphorus nerve agent (OPNA) adducts to butyrylcholinesterase (BChE) can be used to confirm exposure in humans. A highly accurate method to detect G- and V-series OPNA adducts to BChE in 75 µL of filtered blood, serum, or plasma has been developed using immunomagnetic separation (IMS) coupled with liquid chromatography tandem mass spectrometry (LC-MS/MS). The reported IMS method captures > 88 % of the BChE in a specimen and corrects for matrix effects on peptide calibrators. The optimized method has been used to quantify baseline BChE levels (unadducted and OPNA-adducted) in a matched-set of serum, plasma, and whole blood (later processed in-house for plasma content) from 192 unexposed individuals to determine the interchangeability of the tested matrices. The results of these measurements demonstrate the ability to accurately measure BChE regardless of the format of the blood specimen received. Criteria for accepting or denying specimens were established through a series of sample stability and processing experiments. The results of these efforts are an optimized and rugged method that is transferrable to other laboratories and an increased understanding of the BChE biomarker in matrix.

Detecting respiratory syncytial virus using nanoparticle-amplified immuno-PCR.

Early-stage detection is essential for effective treatment of pediatric virus infections. In traditional -immuno-PCR, a single antibody recognition event is associated with one to three DNA tags, which are subsequently amplified by PCR. In this protocol, we describe a nanoparticle-amplified immuno-PCR assay that combines antibody recognition of traditional ELISA with a 50-fold nanoparticle valence amplification step followed by amplification by traditional PCR. The assay detects a respiratory syncytial virus (RSV) surface fusion protein using a Synagis antibody bound to a 15 nm gold nanoparticle co-functionalized with thiolated DNA complementary to a hybridized 76-base Tag DNA. The Tag DNA to Synagis ratio is 50 to 1. The presence of virus particles triggers the formation of a "sandwich" complex comprised of the gold nanoparticle construct, virus, and a 1 µm antibody-functionalized magnetic particle used for extraction. Virus-containing complexes are isolated using a magnet, DNA tags released by heating to 95 °C, and detected via real-time PCR. The limit of detection of the nanoparticle-amplified immuno-PCR assay was compared to traditional ELISA and traditional RT-PCR using RSV-infected HEp-2 cell extracts. Nanoparticle-amplified immuno-PCR showed a ∼4,000-fold improvement in the limit of detection compared to ELISA and a fourfold improvement in the limit of detection compared to traditional RT-PCR. Nanoparticle-amplified immuno-PCR offers a viable platform for the development of an early-stage diagnostics requiring an exceptionally low limit of detection.

Detection of respiratory syncytial virus using nanoparticle amplified immuno-polymerase chain reaction.

In traditional immuno-polymerase chain reaction (immuno-PCR), a single antibody recognition event is associated with one to three DNA tags, which are subsequently amplified by PCR. Here we describe a nanoparticle-amplified immuno-PCR (NPA-IPCR) assay that combines antibody recognition of enzyme-linked immunosorbent assay (ELISA) with a 50-fold nanoparticle valence amplification step prior to tag amplification by PCR. The assay detects a respiratory syncytial virus (RSV) surface protein using an antibody bound to a 15-nm gold nanoparticle cofunctionalized with thiolated DNA complementary to a hybridized 76-base tag DNA with a tag DNA/antibody ratio of 50:1. The presence of virus particles triggers the formation of a "sandwich" complex composed of the gold nanoparticle construct, virus, and an antibody-functionalized magnetic particle used for extraction. After extraction, DNA tags are released by heating to 95°C and detected via real-time PCR. The limit of detection of the assay was compared with ELISA and reversion transcription (RT) PCR using RSV-infected HEp-2 cell extracts. NPA-IPCR showed an approximately 4000-fold improvement in the limit of detection compared with ELISA and a 4-fold improvement compared with viral RNA extraction followed by traditional RT-PCR. NPA-IPCR offers a viable platform for the development of early-stage diagnostics requiring an exceptionally low limit of detection.

Hairpin DNA-functionalized gold colloids for the imaging of mRNA in live cells.

A strategy is presented for the live cell imaging of messenger RNA using hairpin DNA-functionalized gold nanoparticles (hAuNP). hAuNP improve upon technologies for studying RNA trafficking by their efficient internalization within live cells without transfection reagents, improved resistance to DNase degradation, low cytotoxicity, and the incorporation of hairpin DNA molecular beacons to confer high specificity and sensitivity to the target mRNA sequence. Furthermore, the targeted nanoparticle-beacon construct, once bound to the target mRNA sequence, remains hybridized to the target, enabling spatial and temporal studies of RNA trafficking and downstream analysis. Targeted hAuNP exhibited high specificity for glyceraldehyde 3-phosphate dehydrogenase (GADPH) mRNA in live normal HEp-2 cells and respiratory syncytial virus (RSV) mRNA in live RSV-infected HEp-2 cells with high target to background ratios. Multiplexed fluorescence imaging of distinct mRNAs in live cells and simultaneous imaging of mRNAs with immunofluorescently stained protein targets in fixed cells was enabled by appropriate selection of molecular beacon fluorophores. Pharmacologic analysis suggested that hAuNP were internalized within cells via membrane-nanoparticle interactions. hAuNP are a promising approach for the real-time analysis of mRNA transport and processing in live cells for elucidation of biological processes and disease pathogenesis.

Viral detection using DNA functionalized gold filaments.

Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.