The Synergistic Effect of N2 and N7 Modifications on the Inhibitory Efficacy of mRNA Cap Analogues.

In the fight against cancer, researchers have turned their attention to the eukaryotic initiation factor eIF4E, a protein whose increased level is strongly correlated with the development and progression of various types of cancer. Among the numerous strategies devised to tackle eIF4E overexpression, the use of 5' end mRNA cap analogues has emerged as a promising approach. Here, we present new candidates as potent m7GMP analogues for inhibiting translation and interfacing with eIF4E. By employing an appropriate strategy, we synthesized doubly modified mono- and dinucleotide cap analogues, introducing simultaneous substituents at both the N7 and N2 positions of the guanine ring. This approach was identified as an effective and promising combination. Our findings reveal that these dual modifications increase the potency of the dinucleotide analogue, marking a significant advancement in the development of cancer therapeutics targeting the eIF4E pathway.

Application of Phosphoramidate ProTide Technology for the Synthesis of 5'-mRNA Cap Analogs Modified on the Exocyclic Amine Group.

Aryloxy triester phosphoramidate methodology, commonly known as ProTide technology, is one of the most widely used prodrug approaches applied to therapeutic nucleosides. This approach has been used extensively by the pharmaceutical industry and researchers in medicinal chemistry. Herein we report our adaptation of this effective method for the synthesis of bioactive 5'-mRNA cap analogues as inhibitors for targeting cap-dependent translation. The synthesis was performed in two main stages: preparation of N2-modified guanosine analogues and their subsequent transformation into prodrugs using phenylethoxy-l-alaninyl phosphorochloridate. The prepared pro-nucleotide cap analogues were tested for their capacity in enzymatic activation, inhibitory properties in a rabbit reticulocyte lysate system, and passive membrane translocation properties.

N2 modified dinucleotide cap analogs as a potent tool for mRNA engineering.

mRNA-based vaccines are relatively new technologies that have been in the field of interest of research centers and pharmaceutical companies in recent years. Such therapeutics are an attractive alternative for DNA-based vaccines since they provide material that can be used with no risk of genomic integration. Additionally, mRNA can be quite easily engineered to introduce modifications for different applications or to modulate its properties, for example, to increase translational efficiency or stability, which is not available for DNA vectors. Here, we describe the use of N2 modified dinucleotide cap analogs as components of mRNA transcripts. The compounds obtained showed very promising biological properties while incorporated into mRNA. The presented N2-guanine modifications within the cap structure ensure proper attachment of the dinucleotide to the transcripts in the IVT reaction, guarantees their incorporation only in the correct orientation, and enables highly efficient translation of mRNA both in the in vitro translation system and in human HEK293 cells.

The potential of N2-modified cap analogues for precise genetic manipulation through mRNA engineering.

The technology of mRNA-based drugs is currently being intensively developed and implemented. Medical products of this type are already being used as viral vaccines and could potentially find application in a wide range of diseases. The tremendous interest in mRNA is due to the relatively easy production process, which can be quickly adapted to meet societal needs. The properties of this molecule depend on the structure of its individual components, such as the structure of the cap at the 5' end. Modifications of the cap significantly affect the translational potential and lifespan of the whole mRNA. In the current work, we present the synthesis of derivatives of cap analogues modified at the N2 position of 7-methylguanosine. In addition to the substituent at the N2 position, the derivatives had either an extended triphosphate chain, a thiophosphate modification, an added cap1-modified nucleotide or an extended linker between the substituent and 7-methylguanosine. The compounds were tested for use as translation inhibitors and as components for mRNA preparation and appeared of interest for both applications.

Effect of Chronic Stress Present in Fibroblasts Derived from Patients with a Sporadic Form of AD on Mitochondrial Function and Mitochondrial Turnover.

Although the sporadic form of Alzheimer's disease (AD) is the prevalent form, the cellular events underlying the disease pathogenesis have not been fully characterized. Accumulating evidence points to mitochondrial dysfunction as one of the events responsible for AD progression. We investigated mitochondrial function in fibroblasts collected from patients diagnosed with the sporadic form of AD (sAD), placing a particular focus on mitochondrial turnover. We measured mitochondrial biogenesis and autophagic clearance, and evaluated the presence of bioenergetic stress in sAD cells. The mitochondrial turnover was clearly lower in the fibroblasts from sAD patients than in the fibroblasts from the control subjects, and the levels of many proteins regulating mitochondrial biogenesis, autophagy and mitophagy were decreased in patient cells. Additionally, the sAD fibroblasts had slightly higher mitochondrial superoxide levels and impaired antioxidant defense. Mitochondrial turnover undergoes feedback regulation through mitochondrial retrograde signaling, which is responsible for the maintenance of optimal mitochondrial functioning, and mitochondria-derived ROS participate as signaling molecules in this process. Our results showed that in sAD patients cells, there is a shift in the balance of mitochondrial function, possibly in response to the presence of cellular stress related to disease development.

Adaptation of mitochondrial network dynamics and velocity of mitochondrial movement to chronic stress present in fibroblasts derived from patients with sporadic form of Alzheimer's disease.

Alzheimer's disease (AD) is one of the most common neurodegenerative diseases. Only 10% of all cases are familial form, the remaining 90% are sporadic form with unknown genetic background. The etiology of sporadic AD is still not fully understood. Pathogenesis and pathobiology of this disease are limited due to the limited number of experimental models. We used primary culture of fibroblasts derived from patients diagnosed with sporadic form of AD for investigation of dynamic properties of mitochondria, including fission-fusion process and localization of mitochondria within the cell. We observed differences in mitochondrial network organization with decreased mitochondrial transport velocity, and a drop in the frequency of fusion-fission events. These studies show how mitochondrial dynamics adapt to the conditions of long-term mitochondrial stress that prevails in cells of sporadic form of AD.

Effect of HIV-1 TAT Peptide Fusion on 5' mRNA Cap Analogs Cell Membrane Permeability and Translation Inhibition.

The development of targeted anticancer drugs has been one of the most challenging goals of current research. Eukaryotic translation initiation factor 4E (eIF4E) is an oncogene that stimulates mRNA translation via binding to the 5' endcap structure. It is well documented that eIF4E is overexpressed in many cancers including breast, prostate, head and neck, and stomach malignancies and leads to oncogenic transformation and metastasis. One approach to block eIF4E function in cancer cells is based on the disruption of the interaction between eIF4E and the 5' mRNA cap structure using cap analog inhibitors. Since analogs are cell-impermeable due to their anionic nature, we used a cell penetrating peptide (CPP) for delivery of model cap analogs into cancer cells. The human immunodeficiency virus I (HIV-1) transactivator of transcription derived peptide (TAT) was conjugated with the analogs m7GMP and m7GpppG using click chemistry methodology. We observed that both conjugates (m7GMP-TAT and m7GpppG-TAT), contrary to TAT alone, did not translocate through the artificial phospholipid membrane of giant unilamellar vesicles. This suggests that passive transport is not the mechanism by which translocation of cap analogs occurs. In contrast, synthesized fluorescently labeled m7GpppG-TAT translocated into the human breast adenocarcinoma cancer cell line MCF-7. Furthermore, we demonstrated that m7GMP-TAT and m7GpppG-TAT inhibited cap-dependent translation up to 30% both in vivo and in vitro while simultaneously not affecting cell growth and viability. These results demonstrate the usefulness of cell penetration peptides as carriers for the internalization of cap analogs.

Isoxazole-containing 5' mRNA cap analogues as inhibitors of the translation initiation process.

Herein we describe a synthesis of new isoxazole-containing 5' mRNA cap analogues via a cycloaddition reaction. The obtained analogues show a capability to inhibit cap-dependent translation in vitro and are characterized by a new binding mode in which an isoxazolic ring, instead of guanine, is involved in the stacking effect. Our study provides valuable information toward designing new compounds that can be potentially used as anticancer therapeutics.

Decapping Scavenger Enzyme Activity toward N2-Substituted 5' End mRNA Cap Analogues.

mRNA degradation is a key mechanism of gene expression regulation. In the 3' → 5' decay pathway, mRNA is degraded by the exosome complex and the resulting cap dinucleotide or short-capped oligonucleotide is hydrolyzed mainly by a decapping scavenger enzyme (DcpS)-a member of the histidine triad family. The decapping mechanism is similar for DcpS from different species; however, their respective substrate specificities differ. In this paper, we describe experiments exploring DcpS activity from human (hDcps), Caenorhabditis elegans (CeDcpS), and Ascaris suum (AsDcpS) toward dinucleotide cap analogues modified at the N2 position of 7-methylguanosine. Various alkyl substituents were tested, and cap analogues with a longer than three-carbon chain were nonhydrolyzable by hDcpS and CeDcpS. Resistance of the modified cap analogues to hDcpS and CeDcpS may be associated with their weaker binding with enzymes.

Modified ARCA analogs providing enhanced translational properties of capped mRNAs.

Nowadays gene manipulation techniques ("DNA therapy") undergo progressive development and become widely used in industry and medicine. Since new advances in mRNA technologies are capable for obtaining particles with increased stability and translational efficiency, RNA become an attractive alternative for advancement of DNA therapy. For the past years studies have been conducted to explore different modification in mRNA cap structure and its effect on RNA properties. Recently we have shown that modification of the cap structure at the N2 position of 7-methylguanosine leads to an enhancement in translation inhibition. Currently, we have decided to exploit translational properties of mRNA capped with the ARCA (anti-reversed cap) analogs modified within N2 position of purine moiety s. We designed and synthesized three new dinucleotide cap analogs and investigated them in the rabbit reticulocyte lysate (RRL) and the human embryonic kidney derived HEK293 cell line, in vitro translational model systems. The obtained data indicate that, in both translational assays, the cap analogs synthesized by us when incorporated into mRNA improved its translational properties compared to the ARCA capped transcripts. Furthermore, the introduced modifications enhanced stability of the capped transcripts in HEK293 cells, which become higher compared to that of the transcripts capped with regular cap or with ARCA. Additionally one of the synthesized cap analogs revealed strong translation inhibition potency in RRL system, with IC50 value 1.7 µM.

Translocation of 5' mRNA cap analogue--peptide conjugates across the membranes of giant unilamellar vesicles.

Cell-penetrating peptides (CPPs) have been extensively studied because of their ability to deliver various cargo molecules, which are often potential therapeutic agents. However, in most cases, the exact entry mechanism of CPPs is still unknown. In this study, we focused our attention on the membrane permeability sequence (MPS) peptide (AAVALLPAVLLALLAK) conjugated to analogues of a 5' mRNA cap. This unique RNA structure plays a pivotal role in eukaryotic gene expression and has a large therapeutic application potential. We validated the translocation abilities of conjugates across the membranes of giant unilamellar vesicles (GUVs) composed of POPC lipids by application of fluorescence microscopy. Translocation of the MPS peptide itself was observed in contrast to peptide conjugates containing mono- and dinucleotide cap analogues, indicating that even for such small cargos, passive translocation does not occur. However, membrane permeability was observed in the case of conjugated mononucleotides. Fluorescence lifetime microscopy (FLIM) of the C6-NBD-phospholipid revealed changes in lipid packing induced by a penetrating peptide. Our results support the usefulness of artificial membrane systems applied to elucidate membrane crossing mechanisms.

How to find the optimal partner--studies of snurportin 1 interactions with U snRNA 5' TMG-cap analogues containing modified 2-amino group of 7-methylguanosine.

Snurportin 1 is an adaptor protein that mediates the active nuclear import of uridine-rich small nuclear RNAs (U snRNA) by the importin-ß receptor pathway. Its cellular activity influences the overall transport yield of small ribonucleoprotein complexes containing N(2),N(2),7-trimethylguanosine (TMG) capped U snRNA. So far little is still known about structural requirements related to molecular recognition of the trimethylguanosine moiety by snurportin in solution. Since these interactions are of a great biomedical importance, we synthesized a series of new 7-methylguanosine cap analogues with extended substituents at the exocyclic 2-amino group to gain a deeper insight into how the TMG-cap is adapted into the snurportin cap-binding pocket. Prepared chemical tools were applied in binding assays using emission spectroscopy. Surprisingly, our results revealed strict selectivity of snurportin towards the TMG-cap structure that relied mainly on its structural stiffness and compactness.

Effect of different N7 substitution of dinucleotide cap analogs on the hydrolytic susceptibility towards scavenger decapping enzymes (DcpS).

Scavenger decapping enzymes (DcpS) are involved in eukaryotic mRNA degradation process. They catalyze the cleavage of residual cap structure m(7)GpppN and/or short capped oligonucleotides resulting from exosom-mediated the 3' to 5' digestion. For the specific cap recognition and efficient degradation by DcpS, the positive charge at N7 position of guanine moiety is required. Here we examine the role the N7 substitution within the cap structure on the interactions with DcpS (human, Caenorhabditis elegans and Ascaris suum) comparing the hydrolysis rates of dinucleotide cap analogs (m(7)GpppG, et(7)GpppG, but(7)GpppG, bn(7)GpppG) and the binding affinities of hydrolysis products (m(7)GMP, et(7)GMP, but(7)GMP, bn(7)GMP). Our results show the conformational flexibility of the region within DcpS cap-binding pocket involved in the interaction with N7 substituted guanine, which enables accommodation of substrates with differently sized N7 substituents.

Triazole-containing monophosphate mRNA cap analogs as effective translation inhibitors.

Synthetic analogs of the 5' end of mRNA (cap structure) are widely used in molecular studies on mechanisms of cellular processes such as translation, intracellular transport, splicing, and turnover. The best-characterized cap binding protein is translation initiation factor 4E (eIF4E). Recognition of the mRNA cap by eIF4E is a critical, rate-limiting step for efficient translation initiation and is considered a major target for anticancer therapy. Here, we report a facile methodology for the preparation of N2-triazole-containing monophosphate cap analogs and present their biological evaluation as inhibitors of protein synthesis. Five analogs possessing this unique hetero-cyclic ring spaced from the m7-guanine of the cap structure at a distance of one or three carbon atoms and/or additionally substituted by various groups containing the benzene ring were synthesized. All obtained compounds turned out to be effective translation inhibitors with IC50 similar to dinucleotide triphosphate m(7)GpppG. As these compounds possess a reduced number of phosphate groups and, thereby, a negative charge, which may support their cell penetration, this type of cap analog might be promising in terms of designing new potential therapeutic molecules. In addition, an exemplary dinucleotide from a corresponding mononucleotide containing benzyl substituted 1,2,3-triazole was prepared and examined. The superior inhibitory properties of this analog (10-fold vs. m(7)GpppG) suggest the usefulness of such compounds for the preparation of mRNA transcripts with high translational activity.

5'-Terminal chemical capping of spliced leader RNAs.

Spliced leader (SL) RNA trans-splicing adds a 2,2,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5' end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5'-terminal capped MMG and TMG wild-type, and mutant 22 nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3' biotin tag.

Synthesis of N²-modified 7-methylguanosine 5'-monophosphates as nematode translation inhibitors.

Preparative scale synthesis of 14 new N(2)-modified mononucleotide 5' mRNA cap analogues was achieved. The key step involved use of an S(N)Ar reaction with protected 2-fluoro inosine and various primary and secondary amines. The derivatives were tested in a parasitic nematode, Ascaris suum, cell-free system as translation inhibitors. The most effective compound with IC(50) ∼0.9µM was a N(2)-p-metoxybenzyl-7-methylguanosine-5'-monophosphate 35.

Synthesis of ¹³C- and ¹4C-labeled dinucleotide mRNA cap analogues for structural and biochemical studies.

Herein we describe the first simple and short method for specific labeling of mono- and trimethylated dinucleotide mRNA cap analogues with (13)C and (14)C isotopes. The labels were introduced within the cap structures either at the N7 for monomethylguanosine cap or N7 and N2 position for trimethylguanosine cap. The compounds designed for structural and biochemical studies will be useful tools for better understanding the role of the mRNA cap structures in pre-mRNA splicing, nucleocytoplasmic transport, translation initiation and mRNA degradation.

Structural basis for nematode eIF4E binding an m(2,2,7)G-Cap and its implications for translation initiation.

Metazoan spliced leader (SL) trans-splicing generates mRNAs with an m(2,2,7)G-cap and a common downstream SL RNA sequence. The mechanism for eIF4E binding an m²²7G-cap is unknown. Here, we describe the first structure of an eIF4E with an m(2,2,7)G-cap and compare it to the cognate m7G-eIF4E complex. These structures and Nuclear Magnetic Resonance (NMR) data indicate that the nematode Ascaris suum eIF4E binds the two different caps in a similar manner except for the loss of a single hydrogen bond on binding the m(2,2,7)G-cap. Nematode and mammalian eIF4E both have a low affinity for m(2,2,7)G-cap compared with the m7G-cap. Nematode eIF4E binding to the m7G-cap, m(2,2,7)G-cap and the m(2,2,7)G-SL 22-nt RNA leads to distinct eIF4E conformational changes. Additional interactions occur between Ascaris eIF4E and the SL on binding the m(2,2,7)G-SL. We propose interactions between Ascaris eIF4E and the SL impact eIF4G and contribute to translation initiation, whereas these interactions do not occur when only the m(2,2,7)G-cap is present. These data have implications for the contribution of 5'-UTRs in mRNA translation and the function of different eIF4E isoforms.

Dinucleotide cap analogue affinity resins for purification of proteins that specifically recognize the 5' end of mRNA.

Here we present first dinucleotide affinity resins for purification of proteins that specifically recognize the 5' end of mRNA. Constructed resins possess either a naturally occurring mono- or trimethylated cap or their analogues resistant towards enzymatic degradation, bearing a CH(2) bridge between ß and γ position of the 5',5'-triphosphate chain. All cap analogues were attached to a polymer support (EAH-Sepharose) through the carboxylic group that had been generated by derivatization of the 2',3'-cis diol of the second nucleotide in the cap structure with levulinic acid.

Synthesis of a new class of ribose functionalized dinucleotide cap analogues for biophysical studies on interaction of cap-binding proteins with the 5' end of mRNA.

mRNAs of primitive eukaryotes such as Caenorhabditis elegans and Ascaris summ possess two different caps at their 5' terminus. They have either a typical cap which consists of 7-methylguanosine linked via a 5',5'-triphosphate bridge to the first transcribed nucleotide (MMG cap) or an atypical hypermethylated form with two additional methyl groups at the N2 position (TMG cap). Studies on interaction between the 5' end of mRNA and proteins that specifically recognize its structure have been carried out for several years and they often require chemically modified cap analogues. Here, we present the synthesis of five novel dinucleotide MMG and TMG cap analogues designed for binding studies using biophysical methods such as electron spin resonance (ESR) and surface plasmon resonance (SPR). New analogues were prepared by derivatization of the 2',3'-cis diol of the second nucleotide in the cap structure with levulinic acid, and coupling of the obtained acetal through its carboxylic group with 4-amino-2,2,6,6-tetramethylpiperidine-1-oxyl (4-amino TEMPO), ethylenediamine (EDA) or (+)-biotinyl-3,6,9-trioxaundecanediamine (amine-PEO(3)-biotin).