First Report of Pitaya Virus X Infecting Lophocereus schottii f. mieckleyanus (Thin-Stemmed Totem Pole Cactus) in the United States.

Lophocereus is a genus of three species of columnar cacti native to Arizona and Mexico (Lodi, 2015). These cacti produce several tall, ascending, columnar stems that branch at the base in a candelabra-like arrangement. The most common species, L. schottii is known as the senita cactus. Several unusual knobby-stemmed spineless forms of senita cactus have been found in nature in Baja California, Mexico, which are collectively known as totem pole cacti. The thin-stemmed totem pole cactus, L. schottii f. mieckleyanus is an important part of landscapes in southern Arizona. Cacti are clonally propagated which makes viral infections of economic importance in the ornamental/nursery industry. In February 2023, virus-like symptoms, such as mosaic and chlorotic spots were observed on the stems of L. schottii f. mieckleyanus grown in a nursery in Phoenix, AZ, USA. Total RNA was extracted from two symptomatic cacti (YPHC-61 A & B) following the protocol by Tzanetakis et al. (2007), and cDNA was synthesized using the Superscript IV Reverse Transcriptase (Invitrogen, Vilnius, Lithuania). Reverse transcription polymerase chain reaction (RT-PCR) performed with cactus virus X specific primers (Kim et al. 2016) targeting the coat protein (CP) gene failed to generate any amplicon, while potexvirus-replicase primers, Potex 2RC and Potex 5 (van der Vlugt and Berendsen 2002) targeting RNA-dependent RNA polymerase (RdRp) gene amplified an expected amplicon of ~580 bp from both the samples. One of the amplicons was Sanger sequenced and showed 90.7% nucleotide (nt) identity with pitaya virus X (PiVX) in the GenBank (MN982522). Sequence was submitted in the GenBank under the accession number OR425049. PiVX is a new species of the genus Potexvirus and is named after its origin from pitaya (Hylocereus spp.). Further, RT-PCR was conducted with PiVX-specific primers, CP 110F/CP 604R targeting CP gene (Bae and Park 2022) and RdRp gene (RdRp F 5' GCGTGGGCCCTGGAAAA-3'/RdRp R 5' CTAAGATTCATCAATTCACCTCTCC-3') (this study). Amplicons of ~500 and 1100 bp were obtained using primers, CP 110F/CP 604R and RdRp F/RdRp R, respectively. A BLAST search revealed 90.5% nt identity to PiVX CP sequences (OM802135 and OM802134) and 87.3% nt identity to RdRp sequences (MN982523 and LC654699) in the GenBank. Sequences of isolates YPHC-61A and YPHC-61B were submitted in the GenBank under accession numbers, OQ915350 and PP182358 (CP gene) and OQ915351 and PP209539 (RdRp gene). Phylogenetic analysis based on the combined sequence datasets of CP and RdRp genes also grouped YPHC-61A and YPHC-61B with PiVX isolates and separated from other potexviruses species. For a bioassay of the virus, sap extract from symptomatic cactus was mechanically inoculated onto indicator plant species, i.e., beans, alfalfa, and melon. Ten days post- inoculation, chlorotic lesions were observed on beans and alfalfa plants, while melon and mock-inoculated plants did not show any symptoms. Similarly, L. schottii f. mieckleyanus plants grafted with infected cactus showed chlorotic spots after 30 days post grafting. Mechanically inoculated beans, alfalfa, and cactus plants were found to be positive for PiVX based on RT-PCR and Sanger sequencing. PiVX has earlier been detected on Notocactus leninghausii f. cristatus (Park et al. 2018) and dragon fruit (Selenicereus undatus) plants in South Korea (Bae and Park 2022). To our knowledge, this is the first report of PiVX on L. schottii f. mieckleyanus in the United States and worldwide.

First Report of Charcoal Rot Caused by Macrophomina phaseolina on Stevia rebaudiana in Arizona, USA.

Stevia (Stevia rebaudiana Bertoni) is an important medicinal crop grown worldwide. Leaves of stevia contain a non-caloric sweetener, stevioside, which is used as a substitute to artificial sweeteners. In August 2022, symptoms of chlorosis, wilting, and root rot were observed in about 30 % of stevia plants growing at the Agricultural Station at Yuma Agricultural Center, Yuma, AZ, USA (32.7125° N, 114.7067° W). Infected plants initially showed chlorosis and wilting, and the plants eventually died with foliage remaining intact to the plant. Cross sections of the crown tissue of affected stevia plants showed necrotic tissue and a dark brown discoloration in areas of the vascular and cortical tissues. Dark brown microsclerotia were observed on stem bases and necrotic roots of the infected plants. Five symptomatic plants were sampled to isolate the pathogen. Root and crown tissues (0.5 to 1 cm) were surface disinfested with 1% sodium hypochlorite for 2 min, rinsed three times with sterile water, and plated onto potato dextrose agar (PDA). All the five isolates displayed rapid mycelial growth on PDA at 28°C with a 12-h photoperiod. The mycelia were initially hyaline and turned from gray to black after 7 days. Masses of dark spherical to oblong microsclerotia were observed after 3 days on PDA, measuring an average of 75 µm width × 114 µm length (n=30). For molecular identification, genomic DNA was extracted from mycelia and microsclerotia of a representative isolate (Yuma) using the DNeasy Plant Pro kit (Qiagen, Hilden, Germany). The internal transcribed spacer (ITS), translation elongation factor-1α (TEF-1α), calmodulin (CAL), and ß-tubulin (ß-TUB) regions were amplified using the primer sets, ITS1/ITS4 (White et al. 1990), EF1-728F/EF1-986R (Carbone and Kohn 1999), MpCalF/MpCalR (Santos et al. 2020), and T1/T22 (O'Donnell and Cigelink 1997), respectively. A BLAST search of sequences revealed 98.7 to 100% identity to Macrophomina phaseolina sequences (MK757624, KT261797, MK447823, MK447918). Both morphological and molecular characteristics confirmed the fungus as M. phaseolina (Holliday and Punithaligam 1970). Sequences were submitted in the GenBank under accession numbers OP599770 (ITS), OP690156 (TEF-1α), OP612814 (CAL), and OP690157 (ß-TUB). Pathogenicity assay was performed on 9-week-old stevia plants (var. SW2267), grown in 4-inch planters in the greenhouse. The inoculum was made from a 14-day-old culture of M. phaseolina grown in conical flasks (250 ml) in potato dextrose broth at 28°C. Mycelial mats of the fungus were blended in 250 ml of sterile distilled water, filtered through four layers of cheesecloth, and then calibrated to 105 microsclerotia/ml using a hemocytometer. Twenty healthy plants were inoculated by soil drenching 50 ml of the inoculum per pot. Soil drenching using sterile distilled water was done on 5 non-inoculated control plants. Plants were maintained in the greenhouse at 28 ± 3°C with 12 h photoperiod. After 6 weeks, necrosis at the base of petioles and chlorosis of the leaves, followed by wilting were noticed on all 20 inoculated plants, whereas all the 5 control plants remained healthy. The fungus was reisolated and identified as M. phaseolina based on the morphology and sequences of ITS, TEF-1α, CAL and ß-TUB regions. Although M. phaseolina has been reported earlier on stevia in NC, USA (Koehler and Shew 2018), this is a first report from AZ, USA. M. phaseolina is known to be favored by high soil temperatures (Zveibil et al. 2011), thus represents a potential threat to stevia production in AZ, USA in coming years.

First Report of Powdery Mildew Caused by Golovinomyces latisporus on Helianthus annuus in the Arizona.

Helianthus annuus, known as the common sunflower, is an annual plant indigenous to the United States. The crop is grown for its edible oil, seeds, and as an ornamental. In November 2021, powdery mildew-like signs and symptoms were observed on sunflower in a house garden located at Fortuna Foothills, Yuma County, AZ (32.6725°N, 114.4329°W). Signs of powdery mildew included white blotches of amphigenous and caulicolous mycelia. Initially, signs appeared as circular spots that expanded over the entire leaf and were also observed later on petioles and stems. Fungal hyphae were branched, septate, and with nipple-shaped appressoria. Foot cells of conidiophores were erect, cylindrical, and followed by one to three short cells bearing conidia. The conidiophores were hyaline, straight, cylindrical and produced short chains of up to four immature conidia. Conidia were ovoid to ellipsoid, seldom cylindrical, without-fibrosin bodies and measured 25 to 40 µm in length (mean= 34 µm) and 16 to 24 µm in width (mean= 18.6 µm) (n = 10), with an average length: width ratio of 1.8. The germination of conidia was Euoidium type with short germ tube. Chasmothecium formation was not detected. As the disease progressed, the infected leaves became wilted and senesced. The morphological characteristics of this fungus were in accordance with those described for G. latisporus (Braun and Cook, 2012; Qiu et al., 2020). For molecular identification, genomic DNA was isolated from fungal colonies using the DNeasy Plant kit (Qiagen). The internal transcribed spacer (ITS), large ribosomal subunit (28S), intergenic spacer (IGS), beta- tubulin (TUB2) and chitin synthase 1 (CHS1) regions were amplified using the primer sets, ITS5/ITS4 (White et al., 1990), LSU1/LSU2 (Scholin et al., 1994), IGS-12a/NS1R (Carbone and Kohn, 1999), TubF1/TubR1 and gCS1a1/gCS1b (Qiu et al., 2020). Sequences were submitted in the GenBank under accession numbers OP160535 (ITS), OP153874 (28S rDNA), OP160534 (IGS), OP168959 (TUB2) and OP168960 (CHS1). A BLAST search revealed 98.7 to 100-% identity to G. latisporus sequences (MK452603, NG_068877, MK452520, MK452476, and MK452428). Phylogenetic analysis based on the combined sequence datasets of ITS+28S rDNA+IGS+TUB2+CHS1 also grouped Yuma isolate in a monophyletic clade with G. latisporus accessions from Qiu et al. (2020). A pathogenicity test was carried out by inoculating four sunflower varieties (Velvet queen, Evening sun, Skyscraper and Mammoth). Conidia from infected leaves were dusted on the leaves of 10 individually potted, five-week-old seedlings of each variety. Four seedlings of each variety were not inoculated and served as controls. The inoculated and control plants were then kept in two separate greenhouses at 25-28°C at the Yuma Agricultural Center, Yuma, AZ. Inoculated plants started showing symptoms of powdery mildew within 7 days of inoculation, while the control plants stayed healthy and disease-free. The morphological characteristics of powdery mildew fungus on the inoculated plants were identical to the isolate collected from the garden, with the same sequence following PCR as above, thus fulfilling Koch's postulates. G. latisporus has been previously reported on common sunflower from Washington and California states (Qiu et al., 2020), however, this is a first report from Arizona. Although sunflower is not a major crop in Arizona, the wild sunflower population could serve as reservoir for the spread of the disease.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Epidemiology of Blackberry chlorotic ringspot virus.

The pollen- and seed-borne ilarviruses pose a substantial threat to many specialty crops, including berries, rose, and tree fruit, because there are no efficient control measures other than avoidance. The case of Blackberry chlorotic ringspot virus (BCRV) is of particular interest because the virus has been found to be an integral part of blackberry yellow vein disease and is widespread in rose plants affected by rose rosette disease. This study provides insight into the epidemiology of BCRV, including incidence in blackberry and rose; host range, with the addition of apple as a host of the virus; and seed transmission that exceeded 50% in rose. Sensitive detection protocols that can be used to avoid dissemination of infected material through nurseries and breeding programs were also developed.

Epidemiology of Blackberry yellow vein associated virus.

Blackberry yellow vein disease is one of the most important diseases of blackberry in the United States. Several viruses are found associated with the symptomology but Blackberry yellow vein associated virus (BYVaV) appears to be the most prevalent of all, leading to the need for a better understanding of its epidemiology. Efficient detection protocols were developed using end-point and quantitative reverse-transcription polymerase chain reaction. A multi-state survey was performed on wild and cultivated blackberry to assess the geographical distribution of the virus. Two whitefly species, Trialeurodes abutilonea and T. vaporariorum, were identified as vectors and 25 plant species were tested as potential BYVaV hosts. The information obtained in this study can be used at multiple levels to better understand and control blackberry yellow vein disease.

Viruses and Virus Diseases of Rubus.

Blackberry and raspberry are members of the family Rosaceae. They are classified in the genus Rubus, which comprises hundreds of species and has a center of origin in the Far East. Rubus is divided into 15 subgenera with blackberries classified in the Rubus (formerly Eubatus) and raspberries in the Idaeobatus subgenera. Rubus species are propagated vegetatively and are subject to infection by viruses during development, propagation, and fruit production stages. Reports of initial detection and symptoms of more than 30 viruses, virus-like diseases, and phytoplasmas affecting Rubus spp. were reviewed more than 20 years ago. Since the last review on Rubus viruses, significant progress has been made in the molecular characterization of many of the viruses that infect Rubus spp. Currently, reverse transcription-polymerase chain reaction detection methods are available for most of the viruses known to infect Rubus. The goals of this article are to update the knowledge on previously characterized viruses of Rubus, highlight recently described viruses, review the virus-induced symptoms, describe the advances made in their detection, and discuss our knowledge about several virus complexes that cause serious diseases in Rubus. Virus complexes have been identified recently as the major cause of diseases in blackberries and raspberries.

Population structure of blackberry chlorotic ringspot virus in the United States.

Blackberry chlorotic ringspot virus is a subgroup 1 ilarvirus, detected in several rosaceous hosts exhibiting disease symptoms in Europe and the United States. The population structure of the virus was studied using isolates collected from wild and cultivated plants from six states in the United States. The results suggest a homogeneous virus population in the United States, similar to what observed within single orchards for other ilarviruses. Given the lack of evidence for host or geography-driven adaptation, it is hypothesized that the virus was recently introduced into the New World.

Population structure of Blackberry yellow vein associated virus, an emerging crinivirus.

Blackberry yellow vein disease (BYVD), a disorder caused by virus complexes, has become a major threat to fresh market blackberry production in the United States. Blackberry yellow vein associated virus (BYVaV) is the most prevalent virus in the BYVD complexes; detected in about 50% of samples exhibiting typical disease symptoms. Thirty-four virus isolates infecting wild and cultivated blackberries were collected from several areas with high BYVD incidence. Sequence variability and virus evolution predictions were calculated for four genomic regions coding for six proteins and accounting for about 30% of the virus genome. Nucleotide diversity ranged between 7 and 12%, and all proteins studied were under negative selection. Several isolates were identified as potential recombinants suggesting that recombination might be a driving force behind BYVaV evolution.

Diodia vein chlorosis virus is a group-1 crinivirus.

Members of the family Closteroviridae have emerged as a major problem in agricultural crops in the past two decades. Diodia vein chlorosis virus (DVCV) is an understudied whitefly-transmitted closterovirus. Given the presence of the primary host for the virus in major agricultural production areas in the United States, we characterized the virus at the molecular level, demonstrating that it belongs in the genus Crinivirus, developed detection protocols, evaluated its host range among hosts known to harbor viruses closely related to DVCV, and confirmed transmission by a second whitefly species, Trialeurodes vaporariorum.