Characterization of Three New Outer Membrane Adhesion Proteins in Fusobacterium necrophorum.

Fusobacterium necrophorum, an anaerobic Gram-negative pathogen, causes necrotic cattle infections, impacting livestock health and the US feedlot industry. Antibiotic administration is the mainstay for treating F. necrophorum infections, although resistance hampers their effectiveness. Vaccination, especially targeting outer membrane proteins (OMPs) due to their antigenic properties and host specificity, offers an alternative to antibiotics. This study identified high-binding-affinity adhesion proteins from F. necrophorum using binding and pull-down assays with bovine adrenal gland endothelial cells (EJG). Four OMP candidates (17.5 kDa/OmpH, 22.7 kDa/OmpA, 66.3 kDa/cell surface protein (CSP), and a previously characterized 43 kDa OMP) were expressed as recombinant proteins and purified. Rabbit polyclonal antibodies to recombinant OMPs were generated, and their ability to inhibit bacterial binding in vitro was assessed. The results show that treatment with individual polyclonal antibodies against 43 kDa significantly inhibited bacterial adhesion, while other antibodies were less potent. However, combinations of two or more antibodies showed a more prominent inhibitory effect on host-cell adhesion. Thus, our findings suggest that the identified OMPs are involved in fusobacterial attachment to host cells and may have the potential to be leveraged in combination for vaccine development. Future in vivo studies are needed to validate their roles and test the feasibility of an OMP-based subunit vaccine against fusobacterial infections.

Outer-Membrane Vesicles of Fusobacterium necrophorum: A Proteomic, Lipidomic, and Functional Characterization.

Outer-membrane vesicles (OMVs) are extruded nanostructures shed by Gram-negative bacteria, containing periplasmic contents, and often including virulence factors with immunogenic properties. To assess their potential for use in vaccine development, we purified OMVs from the Fusobacterium necrophorum subspecies necrophorum, an opportunistic necrotic infection-causing pathogen, and characterized these structures using proteomics, lipid-profiling analyses, and cytotoxicity assays. A proteomic analysis of density-gradient-purified F. necrophorum OMVs identified 342 proteins, a large proportion of which were outer-membrane proteins (OMPs), followed by cytoplasmic proteins, based on a subcellular-localization-prediction analysis. The OMPs and toxins were among the proteins with the highest intensity identified, including the 43-kDa-OMP-, OmpA-, and OmpH-family proteins, the cell-surface protein, the FadA adhesin protein, the leukotoxin-LktA-family filamentous adhesin, the N-terminal domain of hemagglutinin, and the OMP transport protein and assembly factor. A Western blot analysis confirmed the presence of several OMPs and toxins in the F. necrophorum OMVs. The lipid-profiling analysis revealed phospholipids, sphingolipids, and acetylcarnitine as the main lipid contents of OMVs. The lactate-dehydrogenase-cytotoxicity assays showed that the OMVs had a high degree of cytotoxicity against a bovine B-lymphocyte cell line (BL-3 cells). Thus, our data suggest the need for further studies to evaluate the ability of OMVs to induce immune responses and assess their vaccine potential in vivo.

Deep convolutional neural network based hyperspectral brain tissue classification.

BACKGROUND: Hyperspectral brain tissue imaging has been recently utilized in medical research aiming to study brain science and obtain various biological phenomena of the different tissue types. However, processing high-dimensional data of hyperspectral images (HSI) is challenging due to the minimum availability of training samples. OBJECTIVE: To overcome this challenge, this study proposes applying a 3D-CNN (convolution neural network) model to process spatial and temporal features and thus improve performance of tumor image classification. METHODS: A 3D-CNN model is implemented as a testing method for dealing with high-dimensional problems. The HSI pre-processing is accomplished using distinct approaches such as hyperspectral cube creation, calibration, spectral correction, and normalization. Both spectral and spatial features are extracted from HSI. The Benchmark Vivo human brain HSI dataset is used to validate the performance of the proposed classification model. RESULTS: The proposed 3D-CNN model achieves a higher accuracy of 97% for brain tissue classification, whereas the existing linear conventional support vector machine (SVM) and 2D-CNN model yield 95% and 96% classification accuracy, respectively. Moreover, the maximum F1-score obtained by the proposed 3D-CNN model is 97.3%, which is 2.5% and 11.0% higher than the F1-scores obtained by 2D-CNN model and SVM model, respectively. CONCLUSION: A 3D-CNN model is developed for brain tissue classification by using HIS dataset. The study results demonstrate the advantages of using the new 3D-CNN model, which can achieve higher brain tissue classification accuracy than conventional 2D-CNN model and SVM model.

Structural, optical and antibacterial activity of pure and co-doped (Fe & Ni) tin oxide nanoparticles.

In this investigation, ferric (Fe) and nickel (Ni) co-doped tin oxide (SnO2) nanoparticles structural, optical, morphological, and antibacterial characteristics were synthesised, characterised, and examined. By employing SnCl2·2H2O and the transition metal precursors FeCl3 and NiCl2·6H2O with various Fe/Ni molar ratios, thermal annealing was carried out at a high temperature (700 °C). X-ray diffraction (XRD), UV-Visible spectroscopy, Photoluminescence (PL), FT-IR, and scanning electron microscopy (SEM) with energy dispersive X-ray techniques (EDX) were used to examine the materials' structural, chemical, optical, morphological, and anti-microbial capabilities. The average particle size of pure and co-doped SnO2 nanoparticles was determined to be around 52 nm and 15 nm, and SnO2 crystallites were observed to present tetragonal rutile structure with space group P42/mmm (No.136). Metal ions were replaced in the Sn lattice, as shown by Fe and Ni co-doped SnO2 nanoparticles. Pure and co-doped samples have capsule and sphere-like features in their SEM morphology. Using UV-visible diffuse reflectance spectroscopy, the optical property was examined, and it was observed that the band gaps for pure and co-doped SnO2 were 3.73 eV and 3.53 eV, respectively. The functional groups and incorporation of Fe and Ni in the prepared powder were also validated by FT-IR and EDX studies. By utilising the agar well diffusion technique and Nutrient agar, the antibacterial properties of pure, Ni-Fe co-doped SnO2 nanoparticles annealed at 700 °C were assessed. They were evaluated against various Gram-positive bacteria (Staphylococcus pheumoniae) and Gram-negative bacteria (Shigella dysenteria). The zone of incubation was found against the Gram +Ve and Gram -Ve bacterial strains.

Comparative Genomic Analysis of Fusobacterium necrophorum Provides Insights into Conserved Virulence Genes.

Fusobacterium necrophorum is a Gram-negative, filamentous anaerobe prevalent in the mucosal flora of animals and humans. It causes necrotic infections in cattle, resulting in a substantial economic impact on the cattle industry. Although infection severity and management differ within F. necrophorum species, little is known about F. necrophorum speciation and the genetic virulence determinants between strains. To characterize the clinical isolates, we performed whole-genome sequencing of four bovine isolates (8L1, 212, B17, and SM1216) and one human isolate (MK12). To determine the phylogenetic relationship and evolution pattern and investigate the presence of antimicrobial resistance genes (ARGs) and potential virulence genes of F. necrophorum, we also performed comparative genomics with publicly available Fusobacterium genomes. Using up-to-date bacterial core gene (UBCG) set analysis, we uncovered distinct Fusobacterium species and F. necrophorum subspecies clades. Pangenome analyses revealed a high level of diversity among Fusobacterium strains down to species levels. The output also identified 14 and 26 genes specific to F. necrophorum subsp. necrophorum and F. necrophorum subsp. funduliforme, respectively, which could be essential for bacterial survival under different environmental conditions. ClonalFrameML-based recombination analysis suggested that extensive recombination among accessory genes led to species divergence. Furthermore, the only strain of F. necrophorum with ARGs was F. necrophorum subsp. funduliforme B35, with acquired macrolide and tetracycline resistance genes. Our custom search revealed common virulence genes, including toxins, adhesion proteins, outer membrane proteins, cell envelope, type IV secretion system, ABC (ATP-binding cassette) transporters, and transporter proteins. A focused study on these genes could help identify major virulence genes and inform effective vaccination strategies against fusobacterial infections. IMPORTANCE Fusobacterium necrophorum is an anaerobic bacterium that causes liver abscesses in cattle with an annual incidence rate of 10% to 20%, resulting in a substantial economic impact on the cattle industry. The lack of definite biochemical tests makes it difficult to distinguish F. necrophorum subspecies phenotypically, where genomic characterization plays a significant role. However, due to the lack of a good reference genome for comparison, F. necrophorum subspecies-level identification represents a significant challenge. To overcome this challenge, we used comparative genomics to validate clinical test strains for subspecies-level identification. The findings of our study help predict specific clades of previously uncharacterized strains of F. necrophorum. Our study identifies both general and subspecies-specific virulence genes through a custom search-based analysis. The virulence genes identified in this study can be the focus of future studies aimed at evaluating their potential as vaccine targets to prevent fusobacterial infections in cattle.

Sunlight-driven rapid and facile synthesis of Silver nanoparticles using Allium ampeloprasum extract with enhanced antioxidant and antifungal activity.

Green nanotechnology has acquired immense demand due to its cost-effective, eco-friendly and benevolent approach for the synthesis of nanoparticles. Among the biological methods, plants aid as a significant green resource for synthesizing nanoparticles that are safe and non-toxic for human use. In the present investigation, Silver nanoparticles (AgNPs) were synthesized using bulbs extract of Allium ampeloprasum under the influence of sunlight irradiation and characterized using different techniques. Distinct in-vitro assays were performed to test the antioxidant and anticandida potential of the synthesized AgNPs. Results suggested the efficient and rapid sunlight-driven synthesis of AgNPs using A. ampeloprasum extract. UV-Vis spectrum showed absorption peak at 446 nm which confirmed the formation of AgNPs. FTIR analysis suggested the presence of functional groups associated with flavonoids and sulfur compounds in A. ampeloprasum extract. The synthesized AgNPs showed Face Centred Cubic (FCC) structure with an average size of 35 nm. Spherical, quasi spherical, triangular and ellipsoidal morphology of the NPs were observed from the TEM micrograph. The synthesized AgNPs showed pronounced free radical scavenging potential for DPPH, ABTS∙+ and H2O2 radicals. The anticandida potency of the synthesized AgNPs was observed as follows: C. albicans ≥ C. tropicalis ≥ C. glabrata ≥ C. parapsilosis ≥ C. krusei. Results showed that sunlight driven nanoparticle synthesis of AgNPs is rapid, facile and exhibit enhanced antioxidant and antifungal activity.

Characterization and distribution of microplastics and plastic debris along Silver Beach, Southern India.

Microplastics are causing serious environmental threats worldwide. To evaluate the current state of microplastics pollution, 28 sediment samples were examined for microplastics and plastic debris contamination along Silver Beach, Southern India. Visual identification followed by FT-IR spectroscopy was used to estimate the overall distribution and characterization of plastic debris. The results reveal that white-colored (44%) and irregularly-shaped (82%) plastics are prevalent in the study area. Moreover, the dominant polymer in the study area is polyvinyl chloride (79%) followed by polyethylene (14%) and nylon (7%). Based on size fractions, mesoplastics are widely distributed in the beach sediments (65%), followed by microplastics (18%) and macroplastics (17%). The regional sources of plastic debris are tourism and fishing activities followed by storm water runoff through the Gadilam river and wave-induced deposition through high tides. Strict policy measures need to be implemented in recreational beaches like Silver beach to reduce plastic pollution.

Development of RT-PCR degenerate primers for the detection of two mandariviruses infecting citrus cultivars in India.

Indian citrus ringspot virus (ICRSV) and Citrus yellow vein clearing virus (CYVCV) are the mandariviruses infecting various citrus cultivars in India and around the world. In the fields, it was observed that citrus plants infected by both the viruses and frequently expressed only ringspot symptoms. The ICRSV-specific polyclonal-antibody used in immuno-sorbent electron microscopy (ISEM) and enzyme linked immuno-sorbent assay (ELISA) could detect only ICRSV in mixed infections. Therefore, the conserved sequences of the RNA dependent RNA polymerase (RdRP) gene of the alphaflexiviruses were exploited for developing a RT-PCR based assay for detection of both the mandariviruses simultaneously, if present. A degenerate primer pair was designed to amplify a ∼435bp fragment by multiple alignments of the RdRP gene sequences of the members of genera Mandarivirus, Potexvirus and Allexivirus. The developed RT-PCR assay was validated for detecting both, CYVCV and ICRSV in mixed infections as well as in single virus-infected citrus plants. The presence of ICRSV or CYVCV or both of them together in such plants were confirmed by using primer pair specific to each of these viruses. Further, the identity of the amplicons was confirmed by sequencing and the virus species were determined with BLASTN analysis. The degenerate primers also amplified the corresponding target sequences of an allexivirus and a potexvirus from the respective infected garlic/ onion and tobacco plants. The use of the degenerate primers for the detection of these virus species of the genus Mandarivirus will be useful in citrus certification programmes.

Genome characterization of citrus yellow vein-clearing virus: limited heterogeneity of viral genomes in Mandarivirus-infecting different citrus species.

Citrus yellow vein-clearing virus (CYVCV) is a mandarivirus infecting citrus producing yellow vein-clearing symptoms. The leaf samples collected during surveys of different citrus-growing areas in India exhibited diverse symptoms and 40% of the plants were positive for CYVCV in RT-PCR, indicating the wide distribution of the virus in India. It was reported for first time that CYVCV infects kinnow mandarin and sweet oranges and produces chlorotic ringspots symptoms identical to Indian citrus ringspot virus (ICRSV). The complete genome sequences of CYVCV infecting four citrus cultivars have been deciphered through overlapping primers. All the four genomes comprise of 7531 nucleotides excluding the 3' poly (A) tail. The sequence identity of genomes of four CYVCV isolates in the present study ranged from 95.2 to 99.8% with genome sequences of 31 CYVCV isolates available in public domain and the mean genomic diversity was 0.017, indicating low level of heterogeneity. The phylogenetic analysis revealed that CYVCV isolates from India, Pakistan, and Turkey were clustered in the same clad apart from China isolates. The least normalized dN/dS mean value (0.092) indicated that RdRP region evolved under relatively stronger selection constraints than the other five coding regions of CYVCV. The four intragenic putative recombination events detected in RDP4 program occurred naturally in CYVCV genome, indicating the evolutionary progress of the virus. Tajima's and Fu and Li's D parameters were performed using genomic sequences in DnaSP v5 program and the retrieved negative values indicated the presence of limited genetic variability in CYVCV genomes. To the best of our knowledge, this is the first comprehensive report on molecular characterization of CYVCV from India. It will be helpful in understanding the evolutionary relationship of CYVCV and ICRSV.

N-terminal in coat protein of Garlic virus X is indispensible for its serological detection.

Conserved coat protein region of plant viruses is often used as source of antigen for production of polyclonal antibodies for broad-based detection of closely related viruses. Antigenic region in coat protein is located either on N-terminal, and/or C-terminal or in the middle of coat protein. A study was undertaken to determine if antigenic region resides in N-terminal in Garlic virus X (GarV-X) of Allexivirus. In allexiviruses, N-terminal of coat protein region (1-57 amino acids) was highly variable. A complete coat protein of 27 kDa and a truncated protein without N-terminal (20 kDa) of GarV-X were expressed in pET expression vector and confirmed in western blotting using anti-His antisera. These expressed proteins were purified and used for antisera production. Specific and strong reaction was obtained for antisera generated against GarV-X full CP and GarV-X was detected in field-grown allium crops viz., onion, garlic, leek, and bunching onion and chives in ELISA. Antisera against GarV-X CPΔ1-61 (truncated CP) did not show reaction for GarV-X detection in immunoassay. Epitope mapping also indicated N-terminal as major antigenic determinant region with highest antigenic signal score. Our studies confirm that antigenic signals or epitopes reside in the N-terminal region of GarV-X which can be synthesized and used for production of monoclonal antibodies for specific detection purposes.

Isolation of antioxidant peptides from clam, Meretrix casta (Chemnitz).

The antioxidant activity of marine clam, Meretrix casta (Chemnitz) protein hydrolysates prepared from different organs (body, foot and viscera), using the commercial enzymes (pepsin, trypsin and papain) were determined. The protein hydrolysate had a high antioxidant activity where, pepsin hydrolysate of viscera and trypsin hydrolysate of body and foot showed good activity. The viscera pepsin hydrolysate and foot trypsin hydrolysates were purified using FPLC on ion exchange and gel filtration chromatography procedure and activity was determined by DPPH radical scavenging and reducing ability assays. Further the amino acid content of the purified fractions was analyzed using HPLC. Active fractions contained good quantity of both essential and non-essential amino acids.

Applications of next generation high throughput sequencing technologies in characterization, discovery and molecular interaction of plant viruses.

Present era of molecular biology is witnessing revolutionary developments in sequencing technology. This advancement has considerably influenced plant virology in the field of diagnostics and host virus interaction. Next generation high-throughput sequencing technology has made it possible to directly detect, identify and discover novel viruses in several plants in an unbiased manner without antibodies or prior knowledge of the virus sequences. Entire viral genome could be sequenced from symptomatic or asymptomatic plants through next generation sequencing of total nucleic acids including small RNAs. It provides census of viral population in a particular ecosystem or cropping system. Viral genome variability, evolution within the host and virus defence mechanism in plants can also be easily understood by massive parallel sequencing. In this article, we provide an overview of the applications of next generation sequencing technology in characterization, discovery and molecular interaction of plant viruses.

First Report of Grapevine leafroll-associated virus 1 Infecting Grapevines in India.

Viticulture, one of the most remunerative farming enterprises of India, is seriously affected by leafroll disease, which accounts for 62% of the losses in grape production worldwide due to viral diseases (4). Grapevine leafroll-associated virus 3 and 1 (GLRaV-3 and GLRaV-1) of the family Closteroviridae are the two most common viruses associated with the leafroll disease of grapevine (1). GLRaV-3 was previously confirmed in India through RT-PCR, cloning, and sequencing (2). A survey was conducted during 2010 and 2011 in the Nashik and Pune regions of western India and reddening of interveinal areas and downward rolling, typical symptoms of leafroll disease in dark fruited cultivars, were observed, first in 2010 and subsequently in 2011. Fourteen leafroll symptomatic samples from seven cultivars of seven vineyards were collected during 2011. Samples were subjected to double antibody sandwich (DAS)-ELISA using commercially available antibodies against GLRaV-3 and GLRaV-1 (Bioreba, Reinach, Switzerland) (2). An asymptomatic sample from another cultivar of a different vineyard and samples from two plantlets of two different cultivars produced in tissue culture were used as negative controls. GLRaV-1 was detected in two cultivars, Shiraj (Nashik region) and Pinot Noir (Pune region) using DAS-ELISA. GLRaV-1 was detected either alone in cultivar Pinot Noir or as mixed infection with GLRaV-3 in cultivar Shiraj. To further confirm the presence of GLRaV-1 in these two cultivars, crude extract from petioles of these two cultivars were subjected to one step reverse transcription (RT)-PCR using GLRaV-1 specific primers pORF9F and pORF9R (GGCTCGAGATGGCGTCACTTATACCTA and CCTCTAGACACCAAATTGCTAGCGA, respectively) (3). The ˜650 bp amplicons were cloned in pGEM-T easy vector and three independent clones of each amplicon were sequenced in both directions. The cloned amplified product was 646 bp, including 630 bp of p24 protein (ORF9) of GLRaV-1. Comparative sequence analysis, using the BioEdit 7.0.3 program ( http://www.mbio.ncsu.edu/BioEdit/BioEdit.html ), of ORF9 of the virus under study from the cultivars Pinot Noir and Shiraj shared maximum sequence identity of 95.8 and 96.1%, respectively, at the nucleotide level with the Clatervine isolate from the United States (GenBank Accession No. HQ833477). The corresponding values of maximum identities at the amino acid level were 96.6 and 96.1%, respectively, with the same Clatervine isolate. The maximum identity between these two isolates of GLRaV-1 was 96.1% at nucleotide level and 95.7% at amino acid level. To the best of our knowledge, this study represents the first report of GLRaV-1 from India. Grape production in India could be impacted by this virus; thus, identification of the virus is important. References: (1) B. Akbas et al. Hort. Sc. (Prague). 36: 97, 2009. (2) S. Kumar et al. Virus Genes. 45:195, 2012. (3) A. Little and M. A. Rezaian. Arch. Virol. 151:753, 2006. (4) A. Little et al. Virus Res. 80:109, 2001.

7-(4-Meth-oxy-phen-yl)-4,9-dimethyl-N-(4-methyl-phen-yl)-5,12-diaza-tetra-phen-6-amine.

In the title compound, C(32)H(27)N(3)O, the fused tetra-cycilc ring system is essentially planar [r.m.s. deviation = 0.07 (7) Å]. An intra-molecular N-H⋯π(arene) inter-action and a weak intra-molecular C-H⋯N hydrogen bond may influence the mol-ecular conformation. In the crystal, weak inter-molecular C-H⋯N hydrogen bonds link the mol-ecules into centrosymmetric dimers, forming R(2) (2)(14) motifs. In addition, weak π-π stacking inter-actions with centroid-centroid distances in the range 3.578 (1)-3.739 (1) Šprovide further stabilization.

4-Chloro-6-methyl-N-(4-methyl-phen-yl)quinolin-2-amine.

In the title compound C(17)H(15)ClN(2), the dihedral angle between the quinoline ring system and the phenyl ring is 50.18 (6)°. In the crystal, mol-ecules are linked into chains running along the c axis by N-H⋯N hydrogen bonds.

Effect of amendments on phytoavailability and fractionation of copper and zinc in a contaminated soil.

The ability of amendments to modify the soil properties and influence plants to immobilise Cu and Zn was studied in a naturally contaminated, additionally spiked podzolic soil. Lolium perenne L (perennial rye grass), Festuca rubra L (creeping red fescue) and Poa pratensis L (Kentucky blue grass) were tested in a pot study in the presence of soil amendments (lime, phosphate, and compost, individually and in combination) to assess the effect of soil-plant-amendment interaction on phytostabilisation. The ability of treatments to stabilize metals was assessed on the basis of metal fractionation in soil, partitioning of metals in plants, and metal uptake by the plants. Significant partitioning of Cu into immobile forms occurred as a result of the growth of Festuca rubra, and of Zn by the growth of Poa pratensis. Application of lime significantly reduced the exchangeable fraction of Zn, whereas phosphate application had an accelerating effect on exchangeable Cu. With combined application of amendments, the plant metal concentration decreased by more than 40% for Cu and 70% for Zn, compared to soils receiving no amendments. Combined application of amendments, in conjunction with growth of Festuca and Poa, can be recommended for phytostabilising of Cu and Zn in moderately contaminated acid soils of southwest British Columbia.

Microencapsulation techniques, factors influencing encapsulation efficiency.

Microencapsulation is one of the quality preservation techniques of sensitive substances and a method for production of materials with new valuable properties. Microencapsulation is a process of enclosing micron-sized particles in a polymeric shell. There are different techniques available for the encapsulation of drug entities. The encapsulation efficiency of the microparticle or microsphere or microcapsule depends upon different factors like concentration of the polymer, solubility of polymer in solvent, rate of solvent removal, solubility of organic solvent in water, etc. The present article provides a literature review of different microencapsulation techniques and different factors influencing the encapsulation efficiency of the microencapsulation technique.

Phytoavailability and fractionation of lead and manganese in a contaminated soil after application of three amendments.

Studies were conducted to determine the best management practice for immobilisation of toxic Pb and Mn in soil and the interaction of these metal contaminants with the associated plants. The research protocol comprises addition of soil amendments to accelerate physico-chemically driven sorption processes and growth of appropriate plant species to reduce physiologically driven uptake of Pb and Mn. Lolium perenne L (perennial rye grass), Festuca rubra L (creeping red fescue) and Poa pratensis L (Kentucky blue grass) were tested in the presence of soil amendments (lime, phosphate and compost, both individually and in combination). The effectiveness of treatments in stabilizing metals was assessed on the basis of metal speciation in soil, partitioning of metals in plants, and metal uptake. Significant partitioning of Pb in immobile forms was noticed by the growth of P. pratensis and Mn by the growth of L. perenne. Lime application lowered plant Pb and Mn, while phosphate decreased plant Pb and increased plant Mn. Combined amendment addition resulted in a significant decrease in the exchangeable (mobile) metal fraction in soils growing Poa for Pb and in soils growing Lolium for Mn. EC(root) (ratio of root concentration to soil concentration) and EC(shoot) (ratio of shoot concentration to soil concentration) for Pb in Poa decreased by 72% and 60% with combined application of amendments, while the corresponding decreases for Mn in Lolium were 48% and 43%.

2-Chloro-7-methyl-12-phenyldibenzo[b,g][1,8]naphthyridin-11(6H)-one.

In the title compound, C(23)H(15)ClN(2)O, the fused ring system is planar: the deviation of all the non-H atoms from the plane through all four fused rings is less than 0.31 Å. The plane of the phenyl ring is inclined at 71.78 (5)° to the mean plane of the 1,8-naphthrydine ring system. The crystal structure is devoid of any classical hydrogen bonds but π-π inter-actions are present.