Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 33
Filtrar
Mais filtros











Base de dados
Intervalo de ano de publicação
1.
Cell Calcium ; 123: 102933, 2024 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-39116710

RESUMO

The non-selective cation channel TRPC1 is highly expressed in the brain. Recent research shows that neuronal TRPC1 forms heteromeric complexes with TRPC4 and TRPC5, with a small portion existing as homotetramers, primarily in the ER. Given that most studies have focused on the role of heteromeric TRPC1/4/5 complexes, it is crucial to investigate the specific role of homomeric TRPC1 in maintaining brain homeostasis. This review highlights recent findings on TRPC1 in the brain, with a focus on the hippocampus, and compiles the latest data on modulators and their binding sites within the TRPC1/4/5 subfamily to stimulate new research on more selective TRPC1 ligands.


Assuntos
Hipocampo , Canais de Cátion TRPC , Canais de Cátion TRPC/metabolismo , Hipocampo/metabolismo , Humanos , Animais
2.
Transl Psychiatry ; 13(1): 304, 2023 10 02.
Artigo em Inglês | MEDLINE | ID: mdl-37783687

RESUMO

Externalizing disorders (ED) are a cause of concern for public health, and their high heritability makes genetic risk factors a priority for research. Adhesion G-Protein-Coupled Receptor L3 (ADGRL3) is strongly linked to several EDs, and loss-of-function models have shown the impacts of this gene on several core ED-related behaviors. For example, adgrl3.1-/- zebrafish show high levels of hyperactivity. However, our understanding of the mechanisms by which this gene influences behavior is incomplete. Here we characterized, for the first time, externalizing behavioral phenotypes of adgrl3.1-/- zebrafish and found them to be highly impulsive, show risk-taking in a novel environment, have attentional deficits, and show high levels of hyperactivity. All of these phenotypes were rescued by atomoxetine, demonstrating noradrenergic mediation of the externalizing effects of adgrl3.1. Transcriptomic analyses of the brains of adgrl3.1-/- vs. wild-type fish revealed several differentially expressed genes and enriched gene clusters that were independent of noradrenergic manipulation. This suggests new putative functional pathways underlying ED-related behaviors, and potential targets for the treatment of ED.


Assuntos
Transtorno do Deficit de Atenção com Hiperatividade , Peixe-Zebra , Animais , Peixe-Zebra/metabolismo , Norepinefrina , Transtorno do Deficit de Atenção com Hiperatividade/genética , Encéfalo/metabolismo , Receptores Acoplados a Proteínas G/genética
3.
BMC Biol ; 20(1): 97, 2022 05 02.
Artigo em Inglês | MEDLINE | ID: mdl-35501893

RESUMO

BACKGROUND: Aggression is an adaptive behaviour that animals use to protect offspring, defend themselves and obtain resources. Zebrafish, like many other animals, are not able to recognize themselves in the mirror and typically respond to their own reflection with aggression. However, mirror aggression is not an all-or-nothing phenomenon, with some individuals displaying high levels of aggression against their mirror image, while others show none at all. In the current work, we have investigated the genetic basis of mirror aggression by using a classic forward genetics approach - selective breeding for high and low mirror aggression zebrafish (HAZ and LAZ). RESULTS: We characterized AB wild-type zebrafish for their response to the mirror image. Both aggressive and non-aggressive fish were inbred over several generations. We found that HAZ were on average more aggressive than the corresponding LAZ across generations and that the most aggressive adult HAZ were less anxious than the least aggressive adult LAZ after prolonged selective breeding. RNAseq analysis of these fish revealed that hundreds of protein-encoding genes with important diverse biological functions such as arsenic metabolism (as3mt), cell migration (arl4ab), immune system activity (ptgr1), actin cytoskeletal remodelling (wdr1), corticogenesis (dgcr2), protein dephosphorylation (ublcp1), sialic acid metabolism (st6galnac3) and ketone body metabolism (aacs) were differentially expressed between HAZ and LAZ, suggesting a strong genetic contribution to this phenotype. DAVID pathway analysis showed that a number of diverse pathways are enriched in HAZ over LAZ including pathways related to immune function, oxidation-reduction processes and cell signalling. In addition, weighted gene co-expression network analysis (WGCNA) identified 12 modules of highly correlated genes that were significantly associated with aggression duration and/or experimental group. CONCLUSIONS: The current study shows that selective breeding based of the mirror aggression phenotype induces strong, heritable changes in behaviour and gene expression within the brain of zebrafish suggesting a strong genetic basis for this behaviour. Our transcriptomic analysis of fish selectively bred for high and low levels of mirror aggression revealed specific transcriptomic signatures induced by selective breeding and mirror aggression and thus provides a large and novel resource of candidate genes for future study.


Assuntos
Transcriptoma , Peixe-Zebra , Agressão/fisiologia , Animais , Comportamento Animal/fisiologia , Perfilação da Expressão Gênica , Peixe-Zebra/genética
4.
Int J Mol Sci ; 22(2)2021 Jan 13.
Artigo em Inglês | MEDLINE | ID: mdl-33450841

RESUMO

Endothelial lipase (EL) is a strong modulator of the high-density lipoprotein (HDL) structure, composition, and function. Here, we examined the impact of EL on HDL paraoxonase 1 (PON1) content and arylesterase (AE) activity in vitro and in vivo. The incubation of HDL with EL-overexpressing HepG2 cells decreased HDL size, PON1 content, and AE activity. The EL modification of HDL did not diminish the capacity of HDL to associate with PON1 when EL-modified HDL was incubated with PON1-overexpressing cells. The overexpression of EL in mice significantly decreased HDL serum levels but unexpectedly increased HDL PON1 content and HDL AE activity. Enzymatically inactive EL had no effect on the PON1 content of HDL in mice. In healthy subjects, EL serum levels were not significantly correlated with HDL levels. However, HDL PON1 content was positively associated with EL serum levels. The EL-induced changes in the HDL-lipid composition were not linked to the HDL PON1 content. We conclude that primarily, the interaction of enzymatically active EL with HDL, rather than EL-induced alterations in HDL size and composition, causes PON1 displacement from HDL in vitro. In vivo, the EL-mediated reduction of HDL serum levels and the consequently increased PON1-to-HDL ratio in serum increase HDL PON1 content and AE activity in mice. In humans, additional mechanisms appear to underlie the association of EL serum levels and HDL PON1 content.


Assuntos
Arildialquilfosfatase/metabolismo , Hidrolases de Éster Carboxílico/metabolismo , Endotélio/enzimologia , Lipase/metabolismo , Lipoproteínas HDL/metabolismo , Arildialquilfosfatase/química , Hidrolases de Éster Carboxílico/química , Linhagem Celular Tumoral , Ativação Enzimática , Humanos , Lipase/sangue , Lipase/química , Espectroscopia de Ressonância Magnética , Espectrometria de Massas , Ligação Proteica
5.
Sci Rep ; 11(1): 564, 2021 01 12.
Artigo em Inglês | MEDLINE | ID: mdl-33436730

RESUMO

The regulatory (neuro)peptide galanin and its three receptors (GAL1-3R) are involved in immunity and inflammation. Galanin alleviated inflammatory bowel disease (IBD) in rats. However, studies on the galanin receptors involved are lacking. We aimed to determine galanin receptor expression in IBD patients and to evaluate if GAL2R and GAL3R contribute to murine colitis. Immunohistochemical analysis revealed that granulocytes in colon specimens of IBD patients (Crohn's disease and ulcerative colitis) expressed GAL2R and GAL3R but not GAL1R. After colitis induction with 2% dextran sulfate sodium (DSS) for 7 days, mice lacking GAL3R (GAL3R-KO) lost more body weight, exhibited more severe colonic inflammation and aggravated histologic damage, with increased infiltration of neutrophils compared to wild-type animals. Loss of GAL3R resulted in higher local and systemic inflammatory cytokine/chemokine levels. Remarkably, colitis-associated changes to the intestinal microbiota, as assessed by quantitative culture-independent techniques, were most pronounced in GAL3R-KO mice, characterized by elevated numbers of enterobacteria and bifidobacteria. In contrast, GAL2R deletion did not influence the course of colitis. In conclusion, granulocyte GAL2R and GAL3R expression is related to IBD activity in humans, and DSS-induced colitis in mice is strongly affected by GAL3R loss. Consequently, GAL3R poses a novel therapeutic target for IBD.


Assuntos
Colite Ulcerativa/genética , Colite Ulcerativa/microbiologia , Doença de Crohn/genética , Doença de Crohn/microbiologia , Microbioma Gastrointestinal , Expressão Gênica , Receptor Tipo 3 de Galanina/fisiologia , Animais , Colite Ulcerativa/terapia , Doença de Crohn/terapia , Humanos , Inflamação , Camundongos Endogâmicos C57BL , Camundongos Knockout , Terapia de Alvo Molecular , Ratos , Receptor Tipo 3 de Galanina/genética , Receptor Tipo 3 de Galanina/metabolismo
6.
Sci Rep ; 10(1): 18212, 2020 10 23.
Artigo em Inglês | MEDLINE | ID: mdl-33097784

RESUMO

Model fish species such as sticklebacks and zebrafish are frequently used in studies that require DNA to be collected from live animals. This is typically achieved by fin clipping, a procedure that is simple and reliable to perform but that can harm fish. An alternative procedure to sample DNA involves swabbing the skin to collect mucus and epithelial cells. Although swabbing appears to be less invasive than fin clipping, it still requires fish to be netted, held in air and handled-procedures that can cause stress. In this study we combine behavioural and physiological analyses to investigate changes in gene expression, behaviour and welfare after fin clipping and swabbing. Swabbing led to a smaller change in cortisol release and behaviour on the first day of analysis compared to fin clipping. It also led to less variability in data suggesting that fewer animals need to be measured after using this technique. However, swabbing triggered some longer term changes in zebrafish behaviour suggesting a delayed response to sample collection. Skin swabbing does not require the use of anaesthetics and triggers fewer changes in behaviour and physiology than fin clipping. It is therefore a more refined technique for DNA collection with the potential to improve fish health and welfare.


Assuntos
DNA/isolamento & purificação , Modelos Biológicos , Smegmamorpha/genética , Peixe-Zebra/genética , Animais , DNA/genética , Hidrocortisona/metabolismo
7.
Acta Physiol (Oxf) ; 230(4): e13543, 2020 12.
Artigo em Inglês | MEDLINE | ID: mdl-32743878

RESUMO

AIM: Aggression is a behavioural trait characterized by the intention to harm others for offensive or defensive purposes. Neurotransmitters such as serotonin and dopamine are important mediators of aggression. However, the physiological role of the histaminergic system during this behaviour is currently unclear. Here, we aimed to better understand histaminergic signalling during aggression by characterizing the involvement of the histamine H3 receptor (Hrh3). METHODS: We have generated a novel zebrafish Hrh3 null mutant line using CRISPR-Cas9 genome engineering and investigated behavioural changes and alterations to neural activity using whole brain Ca2+ imaging in zebrafish larvae and ribosomal protein S6 (rpS6) immunohistochemistry in adults. RESULTS: We show that genetic inactivation of the histamine H3 receptor (Hrh3) reduces aggression in zebrafish, an effect that can be reproduced by pharmacological inhibition. In addition, hrh3-/- zebrafish show behavioural impairments consistent with heightened anxiety. Larval in vivo whole brain Ca2+ imaging reveals higher neuronal activity in the forebrain of mutants, but lower activity in specific hindbrain areas and changes in measures of functional connectivity between subregions. Adult hrh3-/- zebrafish display brain region-specific neural activity changes in response to aggression of both key regions of the social decision-making network, and the areas containing histaminergic neurons in the zebrafish brain. CONCLUSION: These results highlight the importance of zebrafish Hrh3 signalling for aggression and anxiety and uncover the brain areas involved. Targeting this receptor might be a potential novel therapeutic route for human conditions characterized by heightened aggression.


Assuntos
Receptores Histamínicos H3 , Agressão , Animais , Encéfalo/metabolismo , Histamina , Humanos , Prosencéfalo/metabolismo , Receptores Histamínicos H3/metabolismo , Serotonina , Peixe-Zebra/metabolismo
8.
Eur J Nutr ; 59(5): 1831-1844, 2020 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-31263983

RESUMO

PURPOSE: Pro- and synbiotics have been reported to ameliorate the adverse (dysbiotic) effects of antibiotics on the gut microbial architecture, but little is known how synbiotics and antibiotics interact with each other in shaping the gut microbiota. To explore this mutual interaction we examined, first, the effect of a multi-strain synbiotic on antibiotic-induced dysbiosis and, second, the dysbiotic effect of antibiotics followed by prolonged synbiotic exposure. METHODS: The synbiotic containing nine bacterial strains was administered to male mice via the drinking water, while the antibiotic mix containing bacitracin, meropenem, neomycin, and vancomycin was administered via oral gavage. Two experimental protocols were used. In protocol 1, mice were administered placebo or synbiotic for 3 weeks prior to and during an 11-day vehicle or antibiotic treatment. In protocol 2 the synbiotic was administered for a prolonged period of time, starting 3 weeks prior and continuing for 12 weeks after an 11-day vehicle or antibiotic treatment. Subsequently, the fecal microbiome was analyzed by 16S rRNA sequencing using oligonucleotide primers 16s_515_S3_fwd: GATTGCCAGCAGCCGCGGTAA and 16s_806_S2_rev: GGACTACCAGGGTATCTAAT followed by sequencing using the Ion Torrent One. The final sequence files were analyzed by QIIME 1.8 workflow scripts. RESULTS: Antibiotic treatment markedly decreased the bacterial richness and diversity of the fecal microbiota. Synbiotic administration for 3 weeks prior to and during an 11-day antibiotic treatment preserved the Lactobacillales and expanded the Verrucomicrobiales and Bifidobacteriales order, but did not prevent the depletion of Bacteroidales and the short-term proliferation of Enterobacteriales. When the synbiotic administration was continued for 12 weeks after the end of antibiotic treatment, the rise of Verrucomicrobiales was maintained, whereas the preservation of Lactobacillales and boost of Bifidobacteriales was lost. The abundance of Clostridiales was enhanced by long-term synbiotic treatment after short-term exposure to antibiotics, while the antibiotic-depleted Bacteroidales underwent a delayed recovery. CONCLUSIONS: There are complex synergistic and antagonistic interactions of synbiotics and antibiotics in influencing distinct bacterial orders of the fecal microbiota. The impact of a short-term antibiotic exposure is profoundly different when analyzed after synbiotic pretreatment or following prolonged synbiotic administration in the post-antibiotic period.


Assuntos
Microbiota , Simbióticos , Animais , Antibacterianos , Fezes , Masculino , Camundongos , RNA Ribossômico 16S/genética
9.
Sci Rep ; 9(1): 20217, 2019 12 27.
Artigo em Inglês | MEDLINE | ID: mdl-31882991

RESUMO

Inflammatory bowel disease (IBD) patients frequently suffer from anxiety disorders and depression, indicating that altered gut-brain axis signalling during gastrointestinal inflammation is a risk factor for psychiatric disease. Microglia, immune cells of the brain, is thought to be involved in a number of mental disorders, but their role in IBD is largely unknown. In the current work, we investigated whether colitis induced by dextran sulphate sodium (DSS), a murine model of IBD, alters microglial phenotypes in the brain. We found that colitis caused a reduction of Iba-1 and CD68 immunoreactivity, microglial activation markers, in specific brain regions of the limbic system such as the medial prefrontal cortex (mPFC), while other areas remained unaffected. Flow cytometry showed an increase of monocyte-derived macrophages during colitis and gene expression analysis in the mPFC showed pronounced changes of microglial markers including cluster of differentiation 86 (CD86), tumour necrosis factor-α, nitric oxide synthase 2, CD206 and chitinase-like protein 3 consistent with both M1 and M2 activation. Taken together, these findings suggest that experimental colitis-induced inflammation is propagated to the brain altering microglial function.


Assuntos
Encéfalo/metabolismo , Colite/metabolismo , Doenças Inflamatórias Intestinais/metabolismo , Microglia/metabolismo , Animais , Antígenos CD/genética , Antígenos CD/metabolismo , Antígenos de Diferenciação Mielomonocítica/genética , Antígenos de Diferenciação Mielomonocítica/metabolismo , Proteínas de Ligação ao Cálcio/genética , Proteínas de Ligação ao Cálcio/metabolismo , Colite/induzido quimicamente , Colite/genética , Sulfato de Dextrana , Expressão Gênica , Humanos , Doenças Inflamatórias Intestinais/genética , Ativação de Macrófagos , Macrófagos/classificação , Macrófagos/metabolismo , Masculino , Camundongos Endogâmicos C57BL , Proteínas dos Microfilamentos/genética , Proteínas dos Microfilamentos/metabolismo , Microglia/citologia , Óxido Nítrico Sintase Tipo II/genética , Óxido Nítrico Sintase Tipo II/metabolismo , Córtex Pré-Frontal/metabolismo , Fator de Necrose Tumoral alfa/genética , Fator de Necrose Tumoral alfa/metabolismo
10.
Methods Mol Biol ; 2011: 121-132, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31273697

RESUMO

Zebrafish are an emerging model in behavioral neuroscience. They display a wide range of measurable behaviors such as locomotion, aggression, anxiety, learning and memory, and social behavior. In addition, the relative ease of genetic manipulation and the increasing availability of disease models mean that zebrafish have gained in popularity as an animal model for various neurological and psychiatric diseases including autism spectrum disorder (ASD). In order to better characterize social behavior and behavioral abnormalities in zebrafish, we have developed the visually mediated social preference (VMSP) test, a novel assay to measure social preference and social novelty in two consecutive 5-min sessions. Using recording and video tracking, the time spent in different areas of the tank, the time spent immobile, swimming speed, and distance moved can be easily measured and analyzed. Untreated experimentally naive AB WT zebrafish typically show a strong preference for spending time near and interacting with a compartment containing unfamiliar conspecifics over the empty compartments during session 1 and a stronger preference for a group of unfamiliar zebrafish over familiar conspecifics from session 1, during session 2 of the test. Research in our lab has shown that the VMSP is suitable to measure the social behavior of individual zebrafish, to uncover social phenotypes of mutant strains, and to better understand animal models of disease that include impaired sociability such as ASD. The current paper provides a step-by-step guide on how to implement and perform this test and highlights important considerations for data acquisition, analysis, and interpretation.


Assuntos
Comportamento Animal , Comportamento Social , Peixe-Zebra , Animais , Transtorno do Espectro Autista/etiologia , Transtorno do Espectro Autista/psicologia , Interpretação Estatística de Dados , Modelos Animais de Doenças , Suscetibilidade a Doenças
11.
Mol Cell Neurosci ; 99: 103390, 2019 09.
Artigo em Inglês | MEDLINE | ID: mdl-31276749

RESUMO

Aberrant insulin signaling constitutes an early change in Alzheimer's disease (AD). Insulin receptors (IR) and low-density lipoprotein receptor-related protein-1 (LRP-1) are expressed in brain capillary endothelial cells (BCEC) forming the blood-brain barrier (BBB). There, insulin may regulate the function of LRP-1 in Aß clearance from the brain. Changes in IR-ß and LRP-1 and insulin signaling at the BBB in AD are not well understood. Herein, we identified a reduction in cerebral and cerebrovascular IR-ß levels in 9-month-old male and female 3XTg-AD (PS1M146V, APPSwe, and tauP301L) as compared to NTg mice, which is important in insulin mediated signaling responses. Reduced cerebral IR-ß levels corresponded to impaired insulin signaling and LRP-1 levels in brain. Reduced cerebral and cerebrovascular IR-ß and LRP-1 levels in 3XTg-AD mice correlated with elevated levels of autophagy marker LC3B. In both genotypes, high-fat diet (HFD) feeding decreased cerebral and hepatic LRP-1 expression and elevated cerebral Aß burden without affecting cerebrovascular LRP-1 and IR-ß levels. In vitro studies using primary porcine (p)BCEC revealed that Aß peptides 1-40 or 1-42 (240 nM) reduced cellular levels and interaction of LRP-1 and IR-ß thereby perturbing insulin-mediated signaling. Further mechanistic investigation revealed that Aß treatment accelerated the autophagy-lysosomal degradation of IR-ß and LRP-1 in pBCEC. LRP-1 silencing in pBCEC decreased IR-ß levels through post-translational pathways further deteriorating insulin-mediated responses at the BBB. Our findings indicate that LRP-1 proves important for insulin signaling at the BBB. Cerebral Aß burden in AD may accelerate LRP-1 and IR-ß degradation in BCEC thereby contributing to impaired cerebral and cerebromicrovascular insulin effects.


Assuntos
Peptídeos beta-Amiloides/metabolismo , Barreira Hematoencefálica/metabolismo , Células Endoteliais/metabolismo , Insulina/metabolismo , Proteína-1 Relacionada a Receptor de Lipoproteína de Baixa Densidade/metabolismo , Receptor de Insulina/metabolismo , Transdução de Sinais , Peptídeos beta-Amiloides/farmacologia , Animais , Autofagia , Barreira Hematoencefálica/citologia , Células Cultivadas , Células Endoteliais/efeitos dos fármacos , Feminino , Humanos , Lisossomos/metabolismo , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Suínos
12.
Neurotherapeutics ; 16(4): 1335-1349, 2019 10.
Artigo em Inglês | MEDLINE | ID: mdl-31338703

RESUMO

Neuropeptide Y (NPY) has been demonstrated to exert stress buffering effects and promote resilience. Non-invasive intranasal (IN) application of NPY to rodents is able to mitigate traumatic stress-induced behavioral changes as well as dysfunction of the hypothalamic-pituitary-adrenal (HPA) axis. However, it is unknown whether IN NPY could prevent the behavioral, pro-inflammatory and neurochemical responses to peripheral immune activation by the Toll-like receptor 4 (TLR4) stimulant lipopolysaccharide (LPS). Therefore, we analyzed the effects of IN NPY (100 µg) on the behavioral sickness response (reduced locomotion and exploration) and the underlying molecular mechanisms, 3 h and 21 h after intraperitoneal injections of LPS (0.03 mg/kg) in male C57BL/6N mice. The acute behavioral sickness response was significantly dampened by pretreatment with IN NPY 3 h after LPS injection. This effect was accompanied by diminished weight loss and lowered plasma corticosterone (CORT) levels 21 h after LPS injection. In contrast, acute circulating cytokine levels and hypothalamic cytokine mRNA expression remained unaltered by IN NPY, which indicates that the peripheral and cerebral immune response to LPS was left undisturbed. Our findings are in agreement with the reported activity of NPY to dampen the response of the HPA axis to stress. We propose that IN NPY ablates sickness behavior at a site beyond the peripheral and cerebral cytokine response, an action that is associated with reduced activity of the HPA axis as determined by decreased plasma CORT.These results indicate that IN NPY administration may be relevant to the management of neuropsychiatric disorders arising from immune-induced neuroendocrine dysfunction.


Assuntos
Sistema Hipotálamo-Hipofisário/efeitos dos fármacos , Comportamento de Doença/efeitos dos fármacos , Imunidade Celular/efeitos dos fármacos , Lipopolissacarídeos/toxicidade , Neuropeptídeo Y/administração & dosagem , Sistema Hipófise-Suprarrenal/efeitos dos fármacos , Administração Intranasal , Animais , Corticosterona/sangue , Corticosterona/imunologia , Sistema Hipotálamo-Hipofisário/imunologia , Sistema Hipotálamo-Hipofisário/metabolismo , Comportamento de Doença/fisiologia , Imunidade Celular/fisiologia , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Sistema Hipófise-Suprarrenal/imunologia , Sistema Hipófise-Suprarrenal/metabolismo
13.
Front Neurosci ; 13: 359, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31057355

RESUMO

Intermitted fasting and other forms of calorie restriction are increasingly demonstrated to exert potential health benefits. Interestingly, restricted feeding is also able to mitigate sickness in response to bacterial factors stimulating Toll-like receptor 4 (TLR4). However, little is known about how fasting modifies the activity of virus-associated molecular patterns. We therefore analyzed the impact of an intermittent fasting (IF) regimen on the immune and behavioral response to the TLR3 agonist and viral mimic polyinosinic:polycytidylic acid [Poly(I:C)] in mice. The effects of intraperitoneally injected Poly(I:C) (12 mg/kg) on plasma and cerebral cytokine expression and behavior (locomotion, exploration, and ingestion) were examined in male C57BL/6N mice under control conditions and following a 9 days period of intermittent (alternate day) fasting (IF). Poly(I:C) increased the circulating levels of cytokines (TNF-α, MCP-1, IL-6, IL-10, IFN-α, IFN-γ), an effect amplified by IF. In addition, IF aggravated sickness behavior in response to Poly(I:C), while cerebral cytokine expression was enhanced by application of Poly(I:C) in the absence of a significant effect of IF. Furthermore, IF augmented the expression of neuropeptide Y (NPY) mRNA in the hypothalamus and increased the plasma levels of corticosterone, while Poly(I:C) had little effect on these readouts. Our data show that IF does not abate, but exaggerates the immune and sickness response to the viral mimic Poly(I:C). This adverse effect of IF occurs despite increased hypothalamic NPY expression and enhanced plasma corticosterone. We therefore propose that the effects of IF on the immune and behavioral responses to viral and bacterial factors are subject to different neuronal and neuroendocrine control mechanisms.

14.
J Vis Exp ; (146)2019 04 13.
Artigo em Inglês | MEDLINE | ID: mdl-31033944

RESUMO

Investigations of the ultrastructural features of neurons and their synapses are only possible with electron microscopy. Especially for comparative studies of the changes in densities and distributions of such features, an unbiased sampling protocol is vital for reliable results. Here, we present a workflow for the image acquisition of brain samples. The workflow allows systematic uniform random sampling within a defined brain region, and the images can be analyzed using a disector. This technique is much faster than extensive examination of serial sections but still presents a feasible approach to estimate the densities and distributions of ultrastructure features. Before embedding, stained vibratome sections were used as a reference to identify the brain region under investigation, which helped speed up the overall specimen preparation process. This approach was used for comparative studies investigating the effect of an enriched-housing environment on several ultrastructural parameters in the mouse brain. Based on the successful use of the workflow, we adapted it for the purpose of elemental analysis of brain samples. We optimized the protocol in terms of the time of user-interaction. Automating all the time-consuming steps by compiling a script for the open source software SerialEM helps the user to focus on the main work of acquiring the elemental maps. As in the original workflow, we paid attention to the unbiased sampling approach to guarantee reliable results.


Assuntos
Microscopia Eletrônica de Transmissão/métodos , Neurônios/ultraestrutura , Animais , Encéfalo/citologia , Encéfalo/ultraestrutura , Feminino , Processamento de Imagem Assistida por Computador , Masculino , Camundongos , Neurônios/citologia , Neurociências , Software , Sinapses/ultraestrutura , Fluxo de Trabalho
15.
Sci Rep ; 9(1): 3040, 2019 02 28.
Artigo em Inglês | MEDLINE | ID: mdl-30816294

RESUMO

The formation of social groups is an adaptive behaviour that can provide protection from predators, improve foraging and facilitate social learning. However, the costs of proximity can include competition for resources, aggression and kleptoparasitism meaning that the decision whether to interact represents a trade-off. Here we show that zebrafish harbouring a mutation in endothelin receptor aa (ednraa) form less cohesive shoals than wild-types. ednraa-/- mutants exhibit heightened aggression and decreased whole-body cortisol levels suggesting that they are dominant. These behavioural changes correlate with a reduction of parvocellular arginine vasopressin (AVP)-positive neurons in the preoptic area, an increase in the size of magnocellular AVP neurons and a higher concentration of 5-HT and dopamine in the brain. Manipulation of AVP or 5-HT signalling can rescue the shoaling phenotype of ednraa-/- providing an insight into how the brain controls social interactions.


Assuntos
Agressão/fisiologia , Comportamento Animal/fisiologia , Endotelinas/metabolismo , Receptores de Endotelina/metabolismo , Proteínas de Peixe-Zebra/metabolismo , Animais , Animais Geneticamente Modificados , Arginina Vasopressina/metabolismo , Técnicas de Observação do Comportamento , Encéfalo/metabolismo , Dopamina/metabolismo , Feminino , Masculino , Modelos Animais , Neurônios/metabolismo , Receptores de Endotelina/genética , Serotonina/metabolismo , Peixe-Zebra , Proteínas de Peixe-Zebra/genética
16.
Nutr Neurosci ; 22(12): 877-893, 2019 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-29697017

RESUMO

Objectives: The biological mechanisms linking diet-related obesity and depression remain unclear. Therefore, we examined the impact of high-fat diet (HFD) on murine behaviour, intestinal microbiome, brain metabolome, neuropeptide Y (NPY) expression, and dipeptidyl peptidase-4 (DPP-4) activity.Methods: Male C57Bl/6J mice were fed an HFD (60 kJ% from fat) or control diet (12 kJ% from fat) for 8 weeks, followed by behavioural phenotyping. Caecal microbiome was analysed by 16S rDNA sequencing, brain metabolome by 1H nuclear magnetic resonance, NPY expression by PCR and immunoassay, and dipeptidyl peptidase-4 (DPP-4) activity by enzymatic assay. The effect of a 4-week treatment with imipramine (7 mg/kg/day) and the DPP-4 inhibitor sitagliptin (50 mg/kg/day) on HFD-induced behavioural changes was also tested.Results: HFD led to a depression-like phenotype as revealed by reduced sociability and sucrose preference. In the caecum, HFD diminished the relative abundance of Bacteroidetes and increased the relative abundance of Firmicutes and Cyanobacteria. In the brain, HFD modified the metabolome of prefrontal cortex and striatum, changing the relative concentrations of molecules involved in energy metabolism (e.g. lactate) and neuronal signalling (e.g. γ-aminobutyric acid). The expression of NPY in hypothalamus and hippocampus was decreased by HFD, whereas plasma NPY and DPP-4-like activity were increased. The HFD-induced anhedonia remained unaltered by imipramine and sitagliptin.Discussion: The depression-like behaviour induced by prolonged HFD in mice is associated with distinct alterations of intestinal microbiome, brain metabolome, NPY system, and DPP-4-like activity. Importantly, the HFD-evoked behavioural disturbance remains unaltered by DPP-4 inhibition and antidepressant treatment with imipramine.


Assuntos
Encéfalo/metabolismo , Depressão/etiologia , Dieta Hiperlipídica/efeitos adversos , Microbioma Gastrointestinal/fisiologia , Metaboloma/fisiologia , Neuropeptídeo Y/metabolismo , Animais , Comportamento Animal/fisiologia , Corpo Estriado/metabolismo , Expressão Gênica , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Neuropeptídeo Y/sangue , Neuropeptídeo Y/genética , Córtex Pré-Frontal/metabolismo , Aumento de Peso
17.
Front Immunol ; 8: 1613, 2017.
Artigo em Inglês | MEDLINE | ID: mdl-29213271

RESUMO

Stress refers to a dynamic process in which the homeostasis of an organism is challenged, the outcome depending on the type, severity, and duration of stressors involved, the stress responses triggered, and the stress resilience of the organism. Importantly, the relationship between stress and the immune system is bidirectional, as not only stressors have an impact on immune function, but alterations in immune function themselves can elicit stress responses. Such bidirectional interactions have been prominently identified to occur in the gastrointestinal tract in which there is a close cross-talk between the gut microbiota and the local immune system, governed by the permeability of the intestinal mucosa. External stressors disturb the homeostasis between microbiota and gut, these disturbances being signaled to the brain via multiple communication pathways constituting the gut-brain axis, ultimately eliciting stress responses and perturbations of brain function. In view of these relationships, the present article sets out to highlight some of the interactions between peripheral immune activation, especially in the visceral system, and brain function, behavior, and stress coping. These issues are exemplified by the way through which the intestinal microbiota as well as microbe-associated molecular patterns including lipopolysaccharide communicate with the immune system and brain, and the mechanisms whereby overt inflammation in the GI tract impacts on emotional-affective behavior, pain sensitivity, and stress coping. The interactions between the peripheral immune system and the brain take place along the gut-brain axis, the major communication pathways of which comprise microbial metabolites, gut hormones, immune mediators, and sensory neurons. Through these signaling systems, several transmitter and neuropeptide systems within the brain are altered under conditions of peripheral immune stress, enabling adaptive processes related to stress coping and resilience to take place. These aspects of the impact of immune stress on molecular and behavioral processes in the brain have a bearing on several disturbances of mental health and highlight novel opportunities of therapeutic intervention.

18.
Sci Rep ; 7: 40968, 2017 01 20.
Artigo em Inglês | MEDLINE | ID: mdl-28106168

RESUMO

Altered levels of colonic peptide YY (PYY) have been reported in patients suffering from functional and inflammatory bowel disorders. While the involvement of neuropeptide Y (NPY) and Y receptors in the regulation of nociception is well established, the physiological role of PYY in somatic and visceral pain is poorly understood. In this work, the role of PYY in pain sensitivity was evaluated using PYY knockout (PYY(-/-)) mice and Y2 receptor ligands. PYY(-/-) mice were more sensitive to somatic thermal pain compared to wild type (WT) mice. Visceral pain was assessed by evaluating pain-related behaviors, mouse grimace scale (MGS) and referred hyperalgesia after intrarectal administration of allyl isothiocyanate (AITC, 1 or 2%) or its vehicle, peanut oil. The pain-related behaviors induced by AITC were significantly exaggerated by PYY deletion, whereas the MGS readout and the referred hyperalgesia were not significantly affected. The Y2 receptor antagonist, BII0246, increased pain-related behaviors in response to intrarectal AITC compared to vehicle treatment while the Y2 receptor agonist, PYY(3-36), did not have a significant effect. These results indicate that endogenous PYY has a hypoalgesic effect on somatic thermal and visceral chemical pain. The effect on visceral pain seems to be mediated by peripheral Y2 receptors.


Assuntos
Comportamento Animal/efeitos dos fármacos , Comportamento Animal/efeitos da radiação , Hiperalgesia/fisiopatologia , Peptídeo YY/deficiência , Receptores dos Hormônios Gastrointestinais/antagonistas & inibidores , Animais , Temperatura Alta , Isotiocianatos/administração & dosagem , Camundongos , Camundongos Knockout
19.
Brain Behav Immun ; 60: 174-187, 2017 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-27751870

RESUMO

Microbial metabolites are known to affect immune system, brain, and behavior via activation of pattern recognition receptors such as Toll-like receptor 4 (TLR4). Unlike the effect of the TLR4 agonist lipopolysaccharide (LPS), the role of other TLR agonists in immune-brain communication is insufficiently understood. We therefore hypothesized that the TLR2 agonist lipoteichoic acid (LTA) causes immune activation in the periphery and brain, stimulates the hypothalamic-pituitary-adrenal (HPA) axis and has an adverse effect on blood-brain barrier (BBB) and emotional behavior. Since LTA preparations may be contaminated by LPS, an extract of LTA (LTAextract), purified LTA (LTApure), and pure LPS (LPSultrapure) were compared with each other in their effects on molecular and behavioral parameters 3h after intraperitoneal (i.p.) injection to male C57BL/6N mice. The LTAextract (20mg/kg) induced anxiety-related behavior in the open field test, enhanced the circulating levels of particular cytokines and the cerebral expression of cytokine mRNA, and blunted the cerebral expression of tight junction protein mRNA. A dose of LPSultrapure matching the amount of endotoxin/LPS contaminating the LTAextract reproduced several of the molecular and behavioral effects of LTAextract. LTApure (20mg/kg) increased plasma levels of tumor necrosis factor-α (TNF-α), interleukin-6 and interferon-γ, and enhanced the transcription of TNF-α, interleukin-1ß and other cytokines in the amygdala and prefrontal cortex. These neuroinflammatory effects of LTApure were associated with transcriptional down-regulation of tight junction-associated proteins (claudin 5, occludin) in the brain. LTApure also enhanced circulating corticosterone, but failed to alter locomotor and anxiety-related behavior in the open field test. These data disclose that TLR2 agonism by LTA causes peripheral immune activation and initiates neuroinflammatory processes in the brain that are associated with down-regulation of BBB components and activation of the HPA axis, although emotional behavior (anxiety) is not affected. The results obtained with an LTA preparation contaminated with LPS hint at a facilitatory interaction between TLR2 and TLR4, the adverse impact of which on long-term neuroinflammation, disruption of the BBB and mental health warrants further analysis.


Assuntos
Ansiedade/tratamento farmacológico , Barreira Hematoencefálica/efeitos dos fármacos , Inflamação/induzido quimicamente , Lipopolissacarídeos/farmacologia , Ácidos Teicoicos/farmacologia , Animais , Barreira Hematoencefálica/metabolismo , Citocinas/metabolismo , Modelos Animais de Doenças , Sistema Hipotálamo-Hipofisário/efeitos dos fármacos , Sistema Hipotálamo-Hipofisário/metabolismo , Interferon gama/metabolismo , Receptores de Lipopolissacarídeos/metabolismo , Masculino , Camundongos Endogâmicos C57BL , Sistema Hipófise-Suprarrenal/efeitos dos fármacos , Sistema Hipófise-Suprarrenal/metabolismo , Fator de Necrose Tumoral alfa/metabolismo
20.
Sci Rep ; 6: 28182, 2016 06 16.
Artigo em Inglês | MEDLINE | ID: mdl-27305846

RESUMO

Environmental enrichment (EE) refers to the provision of a complex and stimulating housing condition which improves well-being, behaviour and brain function of laboratory animals. The mechanisms behind these beneficial effects of EE are only partially understood. In the current report, we describe a link between EE and neuropeptide Y (NPY), based on findings from NPY knockout (KO) mice exposed to EE. Relative to EE-housed wildtype (WT) animals, NPY KO mice displayed altered behaviour as well as molecular and morphological changes in amygdala and hippocampus. Exposure of WT mice to EE reduced anxiety and decreased central glucocorticoid receptor expression, effects which were absent in NPY KO mice. In addition, NPY deletion altered the preference of EE items, and EE-housed NPY KO mice responded to stress with exaggerated hyperthermia, displayed impaired spatial memory, had higher hippocampal brain-derived neurotrophic factor mRNA levels and altered hippocampal synaptic plasticity, effects which were not seen in WT mice. Accordingly, these findings suggest that NPY contributes to the anxiolytic effect of EE and that NPY deletion reverses the beneficial effects of EE into a negative experience. The NPY system could thus be a target for "enviromimetics", therapeutics which reproduce the beneficial effects of enhanced environmental stimulation.


Assuntos
Ansiedade/genética , Comportamento Animal/fisiologia , Fator Neurotrófico Derivado do Encéfalo/genética , Febre/genética , Abrigo para Animais , Plasticidade Neuronal/genética , Neuropeptídeo Y/genética , Memória Espacial/fisiologia , Animais , Febre/patologia , Masculino , Aprendizagem em Labirinto , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Neuropeptídeo Y/metabolismo , RNA Mensageiro/biossíntese , Receptores de Glucocorticoides/metabolismo
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA