Analysis of nonsynonymous SNPs in candidate genes that influence bovine temperament and evaluation of their effect in Brahman cattle.

BACKGROUND: Temperament is an important production trait in cattle and multiple strategies had been developed to generate molecular markers to assist animal selection. As nonsynonymous single nucleotide polymorphisms are markers with the potential to affect gene functions, they could be useful to predict phenotypic effects. Genetic selection of less stress-responsive, temperamental animals is desirable from an economic and welfare point of view. METHODS AND RESULTS: Two nonsynonymous single nucleotide polymorphisms identified in HTR1B and SLC18A2 candidate genes for temperament were analyzed in silico to determine their effects on protein structure. Those nsSNPs allowing changes in proteins were selected for a temperament association analysis in a Brahman population. Transversion effects on protein structure were evaluated in silico for each amino acid change model, revealing structural changes in the proteins of the HTR1B and SLC18A2 genes. The selected nsSNPs were genotyped in a Brahman population (n = 138), and their genotypic effects on three temperament traits were analyzed: exit velocity, pen score, and temperament score. Only the SNP rs209984404-HTR1B (C/A) showed a significant association (P = 0.0144) with pen score. The heterozygous genotype showed a pen score value 1.17 points lower than that of the homozygous CC genotype. CONCLUSION: The results showed that in silico analysis could direct the selection of nsSNPs with the potential to change the protein. Non-synonymous single nucleotide polymorphisms causing structural changes and reduced protein stability were identified. Only rs209984404-HTR1B shows that the allele affecting protein stability was associated with the genotype linked to docility in cattle.

Genetic evaluation of crossbred Bos indicus cow temperament at parturition.

Cow temperament at parturition may be mostly a measure of aggressiveness. The heritability of cow temperament at parturition in Bos taurus cows has been reported to be low. The objectives of this study were to estimate the heritability of cow temperament at parturition, conduct a genome-wide association analysis of cow temperament at the time of parturition, and estimate the correspondence of cow temperament at the time of parturition with cow productive performance and early-life temperament traits in Bos indicus crossbreds. Cow temperament was assessed from 1 to 5 indicating increasing levels of aggressiveness of cows (937 cows and 4,337 parturitions) from 2005 to 2022. Estimates of heritability and repeatability were 0.12 ±â€…0.024 and 0.24 ±â€…0.018. The estimates of proportion of phenotypic variance were 0.13 ±â€…0.019 and 0.02 ±â€…0.011 for permanent and maternal permanent environmental components, respectively. Estimates of heritability for maximum lifetime temperament score and proportions of temperament scores >1 were 0.18 ±â€…0.07 and 0.13 ±â€…0.072. Within cycles (generations), 2-yr-old cows had lower temperament score means than cows in most other age categories. There were low to moderate positive estimates of unadjusted correlation coefficients (r = 0.22 to 0.29; P < 0.05) of unadjusted temperament score with temperament measured on the same females when they were 8 mo old. There were low to moderate positive estimates of correlation coefficients (r = 0.09 to 0.37; P < 0.05) of unadjusted temperament score with calving rate, weaning rate, weaning weight per cow exposed, and weaning weight per 454 kg cow weight at weaning. Cows with the lowest temperament score had lower (P < 0.05) calving and weaning rate than cows in other temperament categories. Within 3 of 5 cycles, cows with the lowest temperament score (totally docile) had lower (P < 0.05) weaning weight per cow exposed than cows in other temperament categories. There were 2 SNP on BTA 4 associated with maximum lifetime temperament score (FDR < 0.05). The non-genetic influence of a cow's mother was documented in her own temperament measured at the time of calving; this may be a consequence of learned behavior. Less aggressiveness displayed by cows at the time of calving may be accompanied by lower reproductive and maternal performance.

Cow temperament was evaluated in 1/2 Nellore 1/2 Angus cows from four distinct generations (five herds) from 2005 to 2022. Cows were scored when their calves were processed (1 d age) as 1 = totally docile, 2 = protective, but not aggressive, 3 = moderately aggressive when calf is disturbed, 4 = very aggressive when calf is disturbed, and 5 = very aggressive even when calf is not disturbed. Similar to results in Bos taurus cows, the heritability of this trait was low. The repeatability was more moderate, indicating that additional records from a cow would be beneficial for selection purposes. Young cows had lower scores, indicating more docile behavior. This may be because a strong maternal protective instinct develops and strengthens over time. Temperament measured when cows were 8 mo old was moderately associated with their temperament as mature cows at the time of parturition. Cows with low temperament scores (more docile) had, in several cases, lower reproductive performance and production. Experiential accumulation appears to be important for cow temperament near the time of calving, including the cow's experience as a calf from her dam.

Telomere Dynamics in Livestock.

Telomeres are repeated sequences of nucleotides at the end of chromosomes. They deteriorate across mitotic divisions of a cell. In Homo sapiens this process of lifetime reduction has been shown to correspond with aspects of organismal aging and exposure to stress or other insults. The early impetus to characterize telomere dynamics in livestock related to the concern that aged donor DNA would result in earlier cell senescence and overall aging in cloned animals. Telomere length investigations in dairy cows included breed effects, estimates of additive genetic control (heritability 0.12 to 0.46), and effects of external stressors on telomere degradation across animal life. Evaluation of telomeres with respect to aging has also been conducted in pigs and horses, and there are fewer reports of telomere biology in beef cattle, sheep, and goats. There were minimal associations of telomere length with animal productivity measures. Most, but not all, work in livestock has documented an inverse relationship between peripheral blood cell telomere length and age; that is, a longer telomere length was associated with younger age. Because livestock longevity affects productivity and profitability, the role of tissue-specific telomere attrition in aging may present alternative improvement strategies for genetic improvement while also providing translational biomedical knowledge.

Differential Expression of Circadian Clock Genes in the Bovine Neuroendocrine Adrenal System.

Knowledge of circadian rhythm clock gene expression outside the suprachiasmatic nucleus is increasing. The purpose of this study was to determine whether expression of circadian clock genes differed within or among the bovine stress axis tissues (e.g., amygdala, hypothalamus, pituitary, adrenal cortex, and adrenal medulla). Tissues were obtained at an abattoir from eight mature nonpregnant Brahman cows that had been maintained in the same pasture and nutritional conditions. Sample tissues were stored in RNase-free sterile cryovials at -80 °C until the total RNA was extracted, quantified, assessed, and sequenced (NovaSeq 6000 system; paired-end 150 bp cycles). The trimmed reads were then mapped to a Bos taurus (B. taurus) reference genome (Umd3.1). Further analysis used the edgeR package. Raw gene count tables were read into RStudio, and low-expression genes were filtered out using the criteria of three minimum reads per gene in at least five samples. Normalization factors were then calculated using the trimmed mean of M values method to produce normalized gene counts within each sample tissue. The normalized gene counts important for a circadian rhythm were analyzed within and between each tissue of the stress axis using the GLM and CORR procedures of the Statistical Analysis System (SAS). The relative expression profiles of circadian clock genes differed (p < 0.01) within each tissue, with neuronal PAS domain protein 2 (NPAS2) having greater expression in the amygdala (p < 0.01) and period circadian regulator (PER1) having greater expression in all other tissues (p < 0.01). The expression among tissues also differed (p < 0.01) for individual circadian clock genes, with circadian locomotor output cycles protein kaput (CLOCK) expression being greater within the adrenal tissues and nuclear receptor subfamily 1 group D member 1 (NR1D1) expression being greater within the other tissues (p < 0.01). Overall, the results indicate that within each tissue, the various circadian clock genes were differentially expressed, in addition to being differentially expressed among the stress tissues of mature Brahman cows. Future use of these findings may assist in improving livestock husbandry and welfare by understanding interactions of the environment, stress responsiveness, and peripheral circadian rhythms.

Comparison of Telomere Length in Age-Matched Primiparous and Multiparous Brahman Cows.

Physiological and psychological stressors have been associated with the attrition of telomeres, which are the protective caps of chromosomes. This study compares the telomere length (TL) in 4-year-old Brahman cows grouped by the first parity (n = 8) and the second parity (n = 11). The cows were bled via jugular venipuncture, weighed, and had their body condition scores recorded at Day -28 prior to calving and at Day + 7 and Day + 28 post-calving. The duration of labor (Dlabor) and parturition ease were recorded. The peripheral leukocytes were isolated, the leukocyte blood count with differential was recorded, and the genomic DNA was extracted. The relative quantity of telomere products, which is proportional to the average TL, was determined via multiplex quantitative PCR using the ratio (T/S ratio) of bovine telomere and ß-globulin DNA. Standards of the bovine telomere (1012-107 dilution series) and ß-globulin (109-104 dilution series) genes were utilized to produce relative copy numbers. The samples were assayed in triplicate and were included if the triplicate Cq difference was less than 0.25 cycles. The parity was the fixed effect, and the random effects included the sire and day repeated with the cow as the subject. Statistical significance was not observed in the leukocyte number or type (p > 0.1). A reduction in the TL of approximately 9225 telomeric copies was found between Parity 1 and Parity 2 (p = 0.02). A trend was found between the TL and Dlabor (p = 0.06). The stress of parturition and raising the first calf of a cow's life may be responsible for TL attenuation. Parity may be considered a stressor of cow longevity.

Precision and Accuracy of Field Versus Laboratory Bioassay Insecticide Efficacy for the Control of Immature Bemisia tabaci.

Ecotoxicological studies often result in reports on the limitation and sometime failures of biological assay data to predict field response to similar treatments. Nevertheless, it is widely accepted that controlled bioassays can better quantify the specific mortality response of a target pest species to a specific toxin. To quantify the relationship between whitefly bioassay and field response data, we evaluated a controlled laboratory bioassay and a concurrent cucurbit field trial method to assess insecticide efficacy for controlling the sweetpotato whitefly, Bemisia tabaci (Gennadius) (Hemiptera: Aleyrodidae). This was based on oviposition and nymphal development. We specifically tested the assumptions that a maximum dose bioassay would more precisely measure insecticide efficacy as compared with a comparable field spray test evaluation, and the response would be equal between the bioassay and the field as a measure of control accuracy for both adult oviposition and development of nymphal stages. To make a direct comparison, we tested the same whitefly population subsamples from 352 plots in eight cucurbit field experiments in Georgia, USA, in 2021 and 2022. The bioassays provide significantly precision for estimating proportional whitefly response. As expected, treatment-specific nonequivalence in immature whitefly counts between the bioassay and field, i.e., a lack of accuracy, only occurred with insecticides that were not highly toxic to all growth stages of whiteflies.

Determining Field Insecticide Efficacy on Whiteflies with Maximum Dose Bioassays.

We conducted a rapid bioassay method to assess insecticide efficacy for controlling adult sweetpotato whitefly Bemisia tabaci in squash and cucumber crops before insecticide applications. The study aimed to evaluate the accuracy of a 24-hour laboratory bioassay in determining maximum dose insecticide efficacy in the field. Ten insecticides were evaluated using leaf-dip bioassays, and their effectiveness was tested across eight cucurbit field experiments in Georgia, USA, during the 2021 and 2022 field seasons. The maximum dose, defined as the highest labeled rate of an insecticide diluted in the equivalent of 935 L ha-1 of water, was used for all bioassays. Adult survival observed in the bioassay was compared to adult field count-based survival 24 h after treatment. A low concentration (1/10 rate) was used for imidacloprid, flupyradifurone, pyriproxyfen, and cyantraniliprole to assess insecticide tolerance in the whitefly population. Overall, significant positive correlation between laboratory bioassay and field efficacy was reported, explaining 50-91% of the observed variation. The addition of the low dosage was helpful, indicating that no rate response was consistent with susceptibility to the tested insecticide, while a rate response was associated with a loss of susceptibility between 2021 and 2022.

Genetic Variants and Their Putative Effects on microRNA-Seed Sites: Characterization of the 3' Untranslated Region of Genes Associated with Temperament.

The 3' untranslated region has an important role in gene regulation through microRNAs, and it has been estimated that microRNAs regulate up to 50% of coding genes in mammals. With the aim of allelic variant identification of 3' untranslated region microRNA seed sites, the 3' untranslated region was searched for seed sites of four temperament-associated genes (CACNG4, EXOC4, NRXN3, and SLC9A4). The microRNA seed sites were predicted in the four genes, and the CACNG4 gene had the greatest number with 12 predictions. To search for variants affecting the predicted microRNA seed sites, the four 3' untranslated regions were re-sequenced in a Brahman cattle population. Eleven single nucleotide polymorphisms were identified in the CACNG4, and eleven in the SLC9A4. Rs522648682:T>G of the CACNG4 gene was located at the predicted seed site for bta-miR-191. Rs522648682:T>G evidenced an association with both exit velocity (p = 0.0054) and temperament score (p = 0.0097). The genotype TT had a lower mean exit velocity (2.93 ± 0.4 m/s) compared with the TG and GG genotypes (3.91 ± 0.46 m/s and 3.67 ± 0.46 m/s, respectively). The allele associated with the temperamental phenotype antagonizes the seed site, disrupting the bta-miR-191 recognition. The G allele of CACNG4-rs522648682 has the potential to influence bovine temperament through a mechanism associated with unspecific recognition of bta-miR-191.

A Review of Successes and Impeding Challenges of IoT-Based Insect Pest Detection Systems for Estimating Agroecosystem Health and Productivity of Cotton.

Using artificial intelligence (AI) and the IoT (Internet of Things) is a primary focus of applied engineering research to improve agricultural efficiency. This review paper summarizes the engagement of artificial intelligence models and IoT techniques in detecting, classifying, and counting cotton insect pests and corresponding beneficial insects. The effectiveness and limitations of AI and IoT techniques in various cotton agricultural settings were comprehensively reviewed. This review indicates that insects can be detected with an accuracy of between 70 and 98% using camera/microphone sensors and enhanced deep learning algorithms. However, despite the numerous pests and beneficial insects, only a few species were targeted for detection and classification by AI and IoT systems. Not surprisingly, due to the challenges of identifying immature and predatory insects, few studies have designed systems to detect and characterize them. The location of the insects, sufficient data size, concentrated insects on the image, and similarity in species appearance are major obstacles when implementing AI. Similarly, IoT is constrained by a lack of effective field distance between sensors when targeting insects according to their estimated population size. Based on this study, the number of pest species monitored by AI and IoT technologies should be increased while improving the system's detection accuracy.

Inter-Individual Variation in DNA Methylation Patterns across Two Tissues and Leukocytes in Mature Brahman Cattle.

Quantifying the natural inter-individual variation in DNA methylation patterns is important for identifying its contribution to phenotypic variation, but also for understanding how the environment affects variability, and for incorporation into statistical analyses. The inter-individual variation in DNA methylation patterns in female cattle and the effect that a prenatal stressor has on such variability have yet to be quantified. Thus, the objective of this study was to utilize methylation data from mature Brahman females to quantify the inter-individual variation in DNA methylation. Pregnant Brahman cows were transported for 2 h durations at days 60 ± 5; 80 ± 5; 100 ± 5; 120 ± 5; and 140 ± 5 of gestation. A non-transport group was maintained as a control. Leukocytes, amygdala, and anterior pituitary glands were harvested from eight cows born from the non-transport group (Control) and six from the transport group (PNS) at 5 years of age. The DNA harvested from the anterior pituitary contained the greatest variability in DNA methylation of cytosine-phosphate-guanine (mCpG) sites from both the PNS and Control groups, and the amygdala had the least. Numerous variable mCpG sites were associated with retrotransposable elements and highly repetitive regions of the genome. Some of the genomic features that had high variation in DNA methylation are involved in immune responses, signaling, responses to stimuli, and metabolic processes. The small overlap of highly variable CpG sites and features between tissues and leukocytes supports the role of variable DNA methylation in regulating tissue-specific gene expression. Many of the CpG sites that exhibited high variability in DNA methylation were common between the PNS and Control groups within a tissue, but there was little overlap in genomic features with high variability. The interaction between the prenatal environment and the genome could be responsible for the differences in location of the variable DNA methylation.

DNA methylation patterns and gene expression from amygdala tissue of mature Brahman cows exposed to prenatal stress.

Prenatal stress can alter postnatal performance and temperament of cattle. These phenotypic effects may result from changes in gene expression caused by stress-induced epigenetic alterations. Specifically, shifts in gene expression caused by DNA methylation within the brain's amygdala can result in altered behavior because it regulates fear, stress response and aggression in mammals Thus, the objective of this experiment was to identify DNA methylation and gene expression differences in the amygdala tissue of 5-year-old prenatally stressed (PNS) Brahman cows compared to control cows. Pregnant Brahman cows (n = 48) were transported for 2-h periods at 60 ± 5, 80 ± 5, 100 ± 5, 120 ± 5, and 140 ± 5 days of gestation. A non-transported group (n = 48) were controls (Control). Amygdala tissue was harvested from 6 PNS and 8 Control cows at 5 years of age. Overall methylation of gene body regions, promoter regions, and cytosine-phosphate-guanine (CpG) islands were compared between the two groups. In total, 202 genes, 134 promoter regions, and 133 CpG islands exhibited differential methylation (FDR ≤ 0.15). Following comparison of gene expression in the amygdala between the PNS and Control cows, 2 differentially expressed genes were identified (FDR ≤ 0.15). The minimal differences observed could be the result of natural changes of DNA methylation and gene expression as an animal ages, or because this degree of transportation stress was not severe enough to cause lasting effects on the offspring. A younger age may be a more appropriate time to assess methylation and gene expression differences produced by prenatal stress.

Wild Radish (Raphanus raphanistrum L.) Is a Potential Reservoir Host of Cucurbit Chlorotic Yellows Virus.

Cucurbit chlorotic yellows virus (CCYV) belongs to the genus Crinivirus and is part of a complex of whitefly-transmitted viruses that cause yellowing disease in cucurbits. In the southeastern USA, heavy incidences of CCYV have been observed on all cucurbits grown in the fall. CCYV was detected from wild radish (Raphanus raphanistrum L.), a common weed that grows in the southeastern USA by high-throughput sequencing as well as RT-PCR. CCYV sequence from wild radish was 99.90% and 99.95%, identical to RNA 1 and RNA 2 of cucurbit isolates of CCYV from the region. Transmission assays using whiteflies demonstrated that wild radish is a good host for CCYV. Whiteflies were also able to acquire CCYV from wild radish and transmit the virus to cucurbit hosts, which developed typical symptoms associated with CCYV. Using quantitative PCR, the titer of CCYV in wild radish was also estimated to be on par with that of cucurbit hosts of the virus. Whitefly bioassays revealed that wild radish is an acceptable feeding and reproductive host plant. These results indicate that wild radish could serve as a reservoir host for CCYV in the USA and other parts of the world where similar conditions exist.

Skeletal Muscle Expression of Actinin-3 (ACTN3) in Relation to Feed Efficiency Phenotype of F2 Bos indicus - Bos taurus Steers.

In this study, actinin-3 (ACTN3) gene expression was investigated in relation to the feed efficiency phenotype in Bos indicus - Bos taurus crossbred steers. A measure of relative feed efficiency based on residual feed intake relative to predictions from the NRC beef cattle model was analyzed by the use of a mixed linear model that included sire and family nested within sire as fixed effects and age, animal type, sex, condition, and breed as random effects for 173 F2 Nellore-Angus steers. Based on these residual intake observations, individuals were ranked from most efficient to least efficient. Skeletal muscle samples were analyzed from 54 steers in three groups of 18 (high efficiency, low efficiency, and a statistically average group). ACTN3, which encodes a muscle-specific structural protein, was previously identified as a candidate gene from a microarray analysis of RNA extracted from muscle samples obtained from a subset of steers from each of these three efficiency groups. The expression of ACTN3 was evaluated by quantitative reverse transcriptase PCR analysis. The expression of ACTN3 in skeletal muscle was 1.6-fold greater in the inefficient steer group than in the efficient group (p = 0.007). In addition to expression measurements, blocks of SNP haplotypes were assessed for breed or parent of origin effects. A maternal effect was observed for ACTN3 inheritance, indicating that a maternal B. indicus block conferred improved residual feed efficiency relative to the B. taurus copy (p = 0.03). A SNP haplotype analysis was also conducted for m-calpain (CAPN2) and fibronectin 1 (FN1), and a significant breed effect was observed for both genes, with B. indicus and B. taurus alleles each conferring favorable efficiency when inherited maternally (p = 0.03 and p = 0.04). Because the ACTN3 structural protein is specific to fast-twitch (type II) muscle fibers and not present in slow-twitch muscle fibers (type I), muscle samples used for expression analysis were also assayed for fiber type ratio (type II/type I). Inefficient animals had a fast fiber type ratio 1.8-fold greater than the efficient animals (p = 0.027). Because these fiber-types exhibit different metabolic profiles, we hypothesize that animals with a greater proportion of fast-twitch muscle fibers are also less feed efficient.

First report of turnip yellows virus infecting cabbage (Brassica oleracea var. capitata) in the USA.

During the spring of 2021, cabbage (Brassica oleracea var. capitata) planted in the research farm at the University of Georgia, Tifton, exhibited leaf distortion, yellow and purple discoloration at the leaf margin of older leaves, and severe stunting. Symptoms were present on nearly 30% of the plants in the field. To identify the potential agents associated, leaf tissues from two symptomatic plants were sent for high throughput sequencing (HTS) of small RNA (sRNA; DNB sequencing, SE read 1x75bp) to Beijing Genomics Institute, China. From each sample, ~ 18 million raw reads were generated. The reads with poor quality and adapter sequences were removed using CLC Genomics Workbench 21.2 (Qiagen, Germantown, MD). Of the total reads, 2,093 and 3,889 reads aligned to the genome of turnip yellows virus (TuYV) in samples one and two, respectively. Reads of turnip mosaic virus (TuMV) were also detected (data not shown). Partial sequences of TuYV assembled from samples one and two showed 89.5% and 89.9% match and 86% and 93% coverage, respectively, with the genome of the type isolate of TuYV (NC_003743) from the United Kingdom. To confirm the presence of TuYV in the samples collected from the same location, specific primers were designed targeting the P0 region (FP- 5'ACAAAAGAAACCAG- GAGGGAATCC3'; RP-5'GCCTTTTCATACAAACATTTCGGTG3') and coat protein (CP) region (FP-5'GTTAATGAATACGGTCGTGGGTAG3'; RP-5'ATTCTGAAAGAACCAGCT- ATCGATG3') of the virus. Eight of 20 (40%) symptomatic samples were determined to be infected with TuYV based on the amplification of expected size products of the P0 (786 nt) and the CP gene (581 nt) in reverse transcription-PCR (RT-PCR). All samples were also tested for the presence of TuMV by RT-PCR as in Sanchez et al. (2003), but none tested positive despite being identified in HTS. Symptoms on samples from which eithervirus could not be detected indicates the involvement of other factors and would require further studies. The partial P0 and CP gene amplicons of TuYV from two samples each were Sanger sequenced bi-directionally at Genewiz (South Plainfield, NJ) and confirmed as TuYV using BLASTn. The partial CP gene sequences from two samples shared 98.7% nucleotide sequence identity with each other and 88.0% (OK349421) and 87.1% (OK349422) identity with the type isolate. The partial P0 gene sequences (OK349423 and OK349424) shared 99.6% nucleotide sequence identity with each other and 92.2% identity with the type isolate. TuYV, formerly known as beet western yellows virus (BWYV) (Mayo, 2002), genus Palerovirus, family Solemoviridae (Walker et al., 2021), is transmitted persistently by aphids (Stevens et al., 2008), and is distributed throughout temperate regions of the world (Kawakubo et al., 2021). TuYV has a wide host range, including brassica, vegetables and weeds (Stevens et al., 2008). However, losses have been reported primarily on canola (B. napus) in Australia (Jones, 2007) and Europe (Stevens et al., 2008). On cabbage, TuYV infections have been reported from China (Zhang et al., 2016), Serbia (Milosevic et al., 2020) and the Philippines (Buxton-Kirk et al, 2020). TuYV (BWYV) has been found infecting shepherd's purse (Capsella bursa-pastoris) in California (Falk and Duffus, 1984), but there are no reports of the virus from any cultivated crops in the USA. To our knowledge, this is the first report of TuYV in cabbage in the USA. More studies are needed to understand its occurrence and impact on cabbage crops in Georgia as well as other regions in the USA.

A Target Site Mutation Associated With Diamide Insecticide Resistance in the Diamondback Moth Plutella xylostella (Lepidoptera: Plutellidae) is Widespread in South Georgia and Florida Populations.

Laboratory colonies of diamondback moth (DBM) larvae were established from larvae collected from four sites in Georgia and Florida where diamide, specifically chlorantraniliprole, insecticide resistance was recently documented. Based on dose-response experiments, these colonies exhibited 109- to 4,298-fold resistance to chlorantraniliprole, compared to a commercially available susceptible control colony. Colonies exhibited 50- to 107-fold resistance to another diamide, cyantraniliprole, based on similar dose-response experiments. All colonies were screened for the presence of four known mutations in the ryanodine receptor (RyR), the target of diamide insecticides, previously associated with resistance in Asian DBM populations. One mutation, G4946E, was identified in colonies from all four field sites, but not the susceptible control colony. Three additional RyR target site mutations, E1338D, Q4594L, and I4790M, were not identified in any of the screened samples. The estimated allele frequency of the G4946E mutation in these colonies ranged from 32 to 90%. These data are consistent with recently reported chlorantraniliprole control failures in Georgia and Florida. It is likely that the G4946E mutation is currently an important contributing factor to chlorantraniliprole resistance in Georgia and Florida DBM populations.

A SNP within the PMCH gene as a molecular marker associated with fertility traits in Angus and Brangus beef heifers raised under a desert environment.

Components of the GH/IGF1 endocrine axis regulate growth and reproductive traits in cattle. The pro-melanin-concentrating hormone (PMCH) gene located within chromosome 5 belongs to this axis. Objective herein was to evaluate PMCH single-nucleotide polymorphisms (SNPs) as molecular markers associated with age at first calving, calving interval, and age at second calving in Angus and Brangus beef heifers raised in desert conditions. Five SNPs within the PMCH gene were included in the study. Three of these SNPs had minor allele frequency > 10% and only one SNP did not deviate from Hardy-Weinberg equilibrium. A genotype to phenotype association analyses was performed using a mixed-effects model which included phenotype as the response variable, SNP genotype, breed, year of birth and age of dam as fixed terms, and sire as a random effect. Genotypes from the SNP rs135033882 were found to be associated (P < 0.05) with all evaluated fertility traits, and the term breed resulted as a significant source of variation only for age at second calving. The allele A was the favorable allele because it decreased the age at first calving 98.6 days, the calving interval 85.3 days, and the age at second calving 183.1 days, in Angus and Brangus heifers. In conclusion, we proposed a SNP within the PMCH gene as a potential candidate marker associated with reproductive performance in Angus and Brangus beef heifers raised in a desert climate.

Improving Whitefly Management.

Whiteflies (Hemiptera: Aleyrodidae), especially the sweetpotato or cotton whitefly, Bemisia tabaci (Gennadius), are among the most destructive and difficult to manage polyphagous insect pests around the globe [...].

Analysis of Polycerate Mutants Reveals the Evolutionary Co-option of HOXD1 for Horn Patterning in Bovidae.

In the course of evolution, pecorans (i.e., higher ruminants) developed a remarkable diversity of osseous cranial appendages, collectively referred to as "headgear," which likely share the same origin and genetic basis. However, the nature and function of the genetic determinants underlying their number and position remain elusive. Jacob and other rare populations of sheep and goats are characterized by polyceraty, the presence of more than two horns. Here, we characterize distinct POLYCERATE alleles in each species, both associated with defective HOXD1 function. We show that haploinsufficiency at this locus results in the splitting of horn bud primordia, likely following the abnormal extension of an initial morphogenetic field. These results highlight the key role played by this gene in headgear patterning and illustrate the evolutionary co-option of a gene involved in the early development of bilateria to properly fix the position and number of these distinctive organs of Bovidae.

Genetic characteristics of Korean Jeju Black cattle with high density single nucleotide polymorphisms.

OBJECTIVE: Conservation and genetic improvement of cattle breeds require information about genetic diversity and population structure of the cattle. In this study, we investigated the genetic diversity and population structure of the three cattle breeds in the Korean peninsula. METHODS: Jeju Black, Hanwoo, Holstein cattle in Korea, together with six foreign breeds were examined. Genetic diversity within the cattle breeds was analyzed with minor allele frequency (MAF), observed and expected heterozygosity (HO and HE), inbreeding coefficient (FIS) and past effective population size. Molecular variance and population structure between the nine breeds were analyzed using a model-based clustering method. Genetic distances between breeds were evaluated with Nei's genetic distance and Weir and Cockerham's FST. RESULTS: Our results revealed that Jeju Black cattle had lowest level of heterozygosity (HE = 0.21) among the studied taurine breeds, and an average MAF of 0.16. The level of inbreeding was -0.076 for Jeju Black, while -0.018 to -0.118 for the other breeds. Principle component analysis and neighbor-joining tree showed a clear separation of Jeju Black cattle from other local (Hanwoo and Japanese cattle) and taurine/indicine cattle breeds in evolutionary process, and a distinct pattern of admixture of Jeju Black cattle having no clustering with other studied populations. The FST value between Jeju Black cattle and Hanwoo was 0.106, which was lowest across the pair of breeds ranging from 0.161 to 0.274, indicating some degree of genetic closeness of Jeju Black cattle with Hanwoo. The past effective population size of Jeju Black cattle was very small, i.e. 38 in 13 generation ago, whereas 209 for Hanwoo. CONCLUSION: This study indicates genetic uniqueness of Jeju Black cattle. However, a small effective population size of Jeju Black cattle indicates the requirement for an implementation of a sustainable breeding policy to increase the population for genetic improvement and future conservation.