Sequence analysis of exons 30 and 31 of LAMA3 gene variants and its association with human papillomavirus infection predisposition: no evidence was found.

OBJECTIVE: Human papillomavirus (HPV) is associated with cervical cancer. For the infection to occur, most HPV types depend on interactions with heparan sulfate proteoglycans (HSPGs); however, non-HSPGs receptors are also involved. Laminin 332 is a crucial component of the epidermis's base membrane. It has shown interactions with HPV that suggest its function as a transient viral receptor in the extracellular matrix (ECM). We provide new information about Laminin 332 and HPV by identifying LAMA3 gene allelic variants from exons 30 and 31 and their distribution among women with and without HPV infection. PATIENTS AND METHODS: We included 192 cervical cancer scrape samples from two groups of patients, 96 samples from patients with a low-grade squamous intraepithelial lesion (LSIL) and 96 samples from HPV-negative samples without LSIL. Identification of the HPV type was performed using an LCD-Array kit. Exons 30 and 31 of LAMA3 were amplified by PCR and analyzed by Sanger's sequencing. RESULTS: We identified a wide range of HPV types. The most frequent low-risk (lrHPV) HPV types were 6, 42, 44, and 90. For high-risk (hrHPV) HPV were 16, 31, 56, and 66. Only the genetic variant rs1131521 was identified in both groups. However, no significant association was observed between rs1131521 and the study groups. CONCLUSIONS: A single silent polymorphism was identified in both groups with similar frequency, whereas no mutations related to increased epithelial friability were identified.

Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.

Hemoglobin S is caused by a nucleotide change in HBB gene (HBB:c.20A>T, p.Glu6Val), is presented in diverse forms: simple carriers (HbSA), homozygotes (HbSS) also known as sickle cell anemia, and compound heterozygotes with other ß-hemoglobinopathies. It is worldwide distributed, in Mexico, is frequently observed in the southern states Guerrero, Oaxaca and Chiapas. Elevated fetal hemoglobin (HbF) is associated with mild phenotype; single-nucleotide variants (SNVs) in modifier genes, such as BCL11A, HBG2, HBBP1 pseudogene and HBS1L-MYB intergenic region, upregulate HbF synthesis. The aim of this study was to identify HbF regulating genetic variants in HbSS and HbSA Mexican subjects. We studied 39 individuals (HbSS = 24, 61%, HbSA = 15, 39%) from Chiapas (67%) and Guerrero (33%), peripheral blood was collected in ethylenediamine tetraacetic acid (EDTA) for molecular and hematological studies, DNA was isolated by salting-out technic and genotyping was performed through allelic discrimination by real time polymerase chain reaction (RT-PCR) using Taqman® probes for 15 SNV (in BCL11A: rs6706648, rs7557939, rs4671393, rs11886868, rs766432, rs7599488, rs1427407; HBS1L-MYB: rs28384513, rs7776054, rs9399137, rs4895441, rs9402686, rs1320963; HBG2: rs7482144; and HBBP1: rs10128556). The obtained data were analyzed using IMB SPSS v.22.0 software. All minor alleles were observed in frequencies over 0.05, the most frequent was rs9402686 (0.82), while the less frequent was rs101028556 (0.08). In HbSS group, the mean fetal hemoglobin was 11.9 ± 5.9% and was significantly elevated in BCL11A rs11886868 wildtype homozygotes and in carriers of HBS1L-MYB intergenic region rs7776054 (p = 0.04 and p = 0.03, respectively). In conclusion, in HbSS Mexican patients, two SNVs were observed related to increased HbF; BCL11A rs11886868 and HBS1L-MYB rs7776054.

Sickle cell anemia (SCA) is one of the most common types of hemoglobinopathies in people of African ancestry, it is caused by homozygosity of HbS mutation (HBB:c.20A>T). It is known that fetal hemoglobin plays a key role in decreasing HbS polymerization which damages the erythrocyte structure and is responsible for the characteristic hemolytic crises endured by these patients. Single-nucleotide variant (SNV) in genes that regulate fetal hemoglobin (HbF) after birth have been associated with its increment, thus ameliorating the hematologic phenotype of this pathology and other ß-hemoglobinopathies. Therefore, in this study, we identified, for the first time in Mexican patients with SCA (HbSS) and HbS carriers (HbSA), the presence of 15 SNVs on BCL11A, HBS1L-MYB and HBG2; all HbSS patients had anemia and elevated HbF; 2 variants were related to increased HbF rs11688888C of BCL11A and rs7776054G of HBSIL-MYB; and finally, all minor alleles were found at a frequency higher than 0.05.

Mutational spectrum of the iduronate-2-sulfatase gene in Mexican patients with Hunter syndrome.

OBJECTIVE: Hunter syndrome, or mucopolysaccharidosis type II (MPS II), is caused by deficiency of the lysosomal enzyme iduronate-2-sulfatase (IDS), which is responsible for degrading heparan and dermatan sulfate. The IDS gene is located on chromosome Xq28; pathological variants in this gene mostly consist of missense mutations and small and larger deletions, which produce different phenotypes. However, there is only one record in our population concerning the molecular mechanism of this disease; a genotype-phenotype description is not available. PATIENTS AND METHODS: There were included 24 unrelated male patients; clinical features were recorded at a database, fluorometric IDS enzyme activity testing was done for each individual, followed by Sanger sequencing to identify mutations. RESULTS: The mutational spectrum was found in 16 out of 24 Mexican patients with MPS II, and its range of phenotypes was described. The most frequent variants were of the missense type. The most affected exons were exon 3 (c.275T>G, c.284_287del, c.325T>C), exon 8 (c.1035G>C, c.550G>A), exon 9 (c.1403G>C, c.1229_1229del), and exon 7 (c.979A>C; this variant has not been previously reported). Exon 5 (c.438C>T, a non-pathogenic variant) was the least frequent. It was also found that the most severely affected patients were those with large deletions (2 out of 24) [rsaIDS: IDSP1 (P164)x0, FMR1, AFF2 (P164)x2] involving genes and pseudogenes. We found 2 patients with a synonymous mutation in exon 4. CONCLUSIONS: Our results confirmed reports in the literature, since the most frequent variants were reported in exons 3 and 8. However, this result varies from one previous report in our population, which mentions large deletions and rearrangements as the most frequent alterations, since complex rearrangements were not found. According to what has been previously found, the most severely affected patients are those in which a whole gene has been deleted.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

INTRODUCTION: Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (ß-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and ß-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . METHODS: Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. ß-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δß-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. RESULTS: In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a ß-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a ß-thal mutation Cd39, IVS1:110, and Spanish δß-thal. CONCLUSION: α-thal is relatively common in Mexican patients, the combination with ß-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and ß-genes defects in patients showing microcytic hypochromic anemia.

5' and 3' ß-globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups.

OBJECTIVE: The purpose of this study was to determine the ß-globin cluster haplotype variability of two Mexican indigenous groups-Purepechas (PUR) and Tarahumaras (TAR)-and their relationship with other world populations. METHODS: The 5' and 3' haplotypes (Hp) of the ß globin cluster in 71 PUR and 53 TAR individuals were analyzed. Five polymorphisms in the 5'Hp (ε, (G) γ, (A) γ, 5'ψß and 3'ψß) and five in the 3'Hp (IVS2: 16, 46, 74, 81 and 3' end +339) were identified by restriction enzymes and direct DNA sequencing. 5'Hp and 3'Hp frequencies in PUR and TAR were compared with reported frequencies from 47 and 10 worldwide populations, respectively. RESULTS: Sixteen different 5'Hps were observed in the indigenous Mexican groups, 11 in each population, with the most common being 5'Hp 1. Eight 3'Hps were detected, seven in PUR and six in TAR, the most frequent being 3'Hp C. Three new 3'Hps were found, A8 (CTGCT) in both populations, C9 (GTGCA) in TAR and E1 (GTTCT) in PUR. The comparative analysis showed that 5'Hp frequencies in PUR were significantly different than those in all populations except the Brazilian-Guarani, while TAR were significantly similar to Aché and North Han Chinese. 3'Hp frequencies were similar between PUR and TAR, as well as with Nuu-Chah-Nulth, Mongolian and Sumatran populations. CONCLUSIONS: The 5'Hp analysis showed great variability in worldwide populations, including PUR and TAR, while 3'Hp frequencies were similar among indigenous Mexican and other populations with Asiatic origins. This suggests that 5'Hp exposes the microevolutionary process of each population and the 3'Hp establishes genetic relationships among populations.