Lactobacillus fermentum NCIMB 5221 and NCIMB 2797 as cholesterol-lowering probiotic biotherapeutics: in vitro analysis.

Cardiovascular and coronary artery disease risk are correlated with cholesterol levels and are significant health concerns. Current cholesterol-lowering approaches includes lifestyle and diet modifications, as well as statins which presents numerous shortcomings. The probiotic bacteria, Lactobacillus fermentum NCIMB 5221 and NCIMB 2797, have demonstrated cholesterol-lowering potential in animal studies. However, there is a lack in understanding the mechanism(s) behind these observed effects. The goal of this work is to investigate, in vitro, the cholesterol-lowering mechanisms of these two strains. To determine the cholesterol-lowering mechanisms, probiotic cholesterol assimilation, colon epithelial adhesion and inhibition of cholesterol uptake by colon epithelial (Caco-2) cells were investigated. L. fermentum NCIMB 2797 (P=0.012) and NCIMB 5221 (P=0.003) assimilated cholesterol and their cell surface hydrophobicity was 70.30±8.85% and 55.60±2.59%, respectively. Both L. fermentum strains showed no significant impact (P>0.05) on Caco-2 cell viability. Of most interest, Caco-2 pre-exposure to L. fermentum NCIMB 5221 significantly decreased (P=0.015) cholesterol uptake, with 85.98±2.07% uptake compared to the untreated cells. Similarly, L. fermentum NCIMB 2797 probiotic cells significantly decreased (P=0.019) cholesterol uptake by Caco-2 cells, with 86.45±1.71% uptake observed compared to the control cells. The results demonstrate that L. fermentum NCIMB 5221 and L. fermentum NCIMB 2797 have the potential via various modes of action to lower cholesterol. Additional studies are required to understand the mechanism(s) of action behind probiotic cholesterol assimilation and behind the cholesterol uptake inhibition by colon epithelial cells.

Investigation of probiotic bacteria as dental caries and periodontal disease biotherapeutics.

Oral diseases, specifically dental caries and periodontal disease, are characterised by increases in pathogenic microorganisms, increased demineralisation and increased inflammation and levels of inflammatory markers. Despite the therapeutic strategies, oral diseases have elevated prevalence rates. Recent work has demonstrated that probiotic bio-therapeutics can decrease oral pathogen counts, including caries-causing Streptococcus mutans and oral inflammation. The aim of this work was to investigate putative probiotic bacteria, selected for S. mutans inhibition and for their oral health-promoting characteristics. The probiotic bacteria were screened for S. mutans inhibition, probiotic bacteriocin activity, salivary pH modulation, probiotic nutrient (sucrose) competition, probiotic co-aggregation with S. mutans, bacterial attachment to oral epithelial keratinocytes, bacterial nitric oxide production and bacterial antioxidant activity. The results indicate that Lactobacillus reuteri strains NCIMB 701359, NCIMB 701089, NCIMB 702655 and NCIMB 702656 inhibited S. mutans to non-detectable levels (<10 cfu/ml). L. reuteri strains also demonstrated the highest antioxidant capacity of the tested strains (7.73-13.99 µM Trolox equivalents), suggesting their use as both caries and periodontal disease therapeutics. Although Lactobacillus fermentum NCIMB 5221 inhibited S. mutans at lower levels, it significantly buffered the pH (4.18) of saliva containing S. mutans, co-aggregated with S. mutans (10.09%), demonstrated high levels of sucrose consumption (138.11 mM) and successfully attached to gingival epithelial cells (11%). This study identified four L. reuteri strains and one L. fermentum strain to be further investigated as oral disease biotherapeutics.

Antibodies against IFN gamma-binding proteins recognize a member of IFN alpha R complex.

Recombinant human IFN alpha 2b coupled to a silica support was used for the purification of the IFN alpha-binding proteins from placental cell membrane extracts. The 100-kDa (p100) and 64-kDa (p64) proteins, which bind preferentially to an IFN alpha 2b-silica matrix, were identified. Using a monoclonal antibody (A6) against IFN-gammaR1, it was able to isolate p100 and p70, but only if IFN alpha 2b was present during chromatography. Similar interactions were observed using polyclonal antibody anti-IFN gamma binding proteins, as assayed in Western blot. These interactions were identified as conformation dependent. We speculate that IFN alpha 2b receptor complex shares an IFN gamma receptor complex epitope.

Selective adsorption of poly-His tagged glutaryl acylase on tailor-made metal chelate supports.

A poly-His tag was fused in the glutaryl acylase (GA) from Acinetobacter sp. strain YS114 cloned in E. coli yielding a fully active enzyme. Biochemical analyses showed that the tag did not alter the maturation of the chimeric GA (poly-His GA) that undergoes a complex post-translational processing from an inactive monomeric precursor to the active heterodimeric enzyme. This enzyme has been used as a model to develop a novel and very simple procedure for one-step purification of poly-His proteins via immobilized metal-ion affinity chromatography on tailor-made supports. It was intended to improve the selectivity of adsorption of the target protein on tailor-made chelate supports instead of performing a selective desorption. The rate and extent of the adsorption of proteins from a crude extract from E. coli and of pure poly-His tagged GA on different metal chelate supports was studied. Up to 90% of proteins from E. coli were adsorbed on commercial chelate supports having a high density of ligands attached to the support through long spacer arms, while this adsorption becomes almost negligible when using low ligand densities, short spacer arms and Zn2+ or Co2+ as cations. On the contrary, poly-His GA adsorbs strongly enough on all supports. A strong affinity interaction between the poly-His tail and a single chelate moiety seems to be the responsible for the adsorption of poly-His GA. By contrast, multipoint weak interactions involving a number of chelate moieties seem to be mainly responsible for adsorption of natural proteins. By using tailor-made affinity supports, a very simple procedure for one-step purification of GA with minimal adsorption of host proteins could be performed. Up to 20 mg of GA were adsorbed on each ml of chelate support while most of accompanying proteins were hardly adsorbed on such supports. Following few washing steps, the target enzyme was finally recovered (80% yield) by elution with 50 mM imidazole with a very high increment of specific activity (up to a 120 purification factor).

Alpha-2 macroglobulin is genetically associated with Alzheimer disease.

Alpha-2-macroglobulin (alpha-2M; encoded by the gene A2M) is a serum pan-protease inhibitor that has been implicated in Alzheimer disease (AD) based on its ability to mediate the clearance and degradation of A beta, the major component of beta-amyloid deposits. Analysis of a deletion in the A2M gene at the 5' splice site of 'exon II' of the bait region (exon 18) revealed that inheritance of the deletion (A2M-2) confers increased risk for AD (Mantel-Haenzel odds ratio=3.56, P=0.001). The sibship disequilibrium test (SDT) also revealed a significant association between A2M and AD (P=0.00009). These values were comparable to those obtained for the APOE-epsilon4 allele in the same sample, but in contrast to APOE-epsilon4, A2M-2 did not affect age of onset. The observed association of A2M with AD did not appear to account for the previously published linkage of AD to chromosome 12, which we were unable to confirm in this sample. A2M, LRP1 (encoding the alpha-2M receptor) and the genes for two other LRP ligands, APOE and APP (encoding the amyloid beta-protein precursor), have now all been genetically linked to AD, suggesting that these proteins may participate in a common neuropathogenic pathway leading to AD.

Use of dextrans as long and hydrophilic spacer arms to improve the performance of immobilized proteins acting on macromolecules.

New dextran-agarose supports, suitable for covalent immobilization of enzymes and proteins acting on macromolecular substrates, were prepared. The thick internal fibers of agarose gels were covered by a low-density layer of long, flexible, hydrophilic, and inert dextran molecules. Rennin and protein A were immobilized on these novel supports and the resulting derivatives exhibited a very high capacity for biological recognition of soluble macromolecular substrates. Caseinolytic activity of this immobilized enzyme was 15-fold higher than activity of directly immobilized rennin, through short spacer arms, on agarose gels. Similarly, the new derivatives of immobilized protein A were able to adsorb up to 2 molecules of immunoglobulin per each molecule of immobilized protein A. When the immobilized proteins were secluded away from the support surface by using these new long and hydrophilic spacer arms, they exhibit minimal steric hindrances that could be promoted by the proximity of the support surface.

A novel presenilin-1 mutation: increased beta-amyloid and neurofibrillary changes.

The prevalence of known mutations in presenilin genes (PS1 and PS2) causing early-onset familial Alzheimer's disease (FAD) was assessed in a population of 98 singleton early-onset AD cases, 29 early-onset FAD cases, and 15 late-onset FAD cases. None of the cases tested positive for the eight mutations initially reported, and none of these mutations were observed in 60 age-matched controls. A novel mutation (R269H) in PS1 was found in a single case of early-onset AD but not in any other AD or control case. Thus, the PS mutations tested are quite rare in early-onset AD. Amyloid beta protein (A beta) deposition was investigated in the temporal cortex of the R269H mutation case using end-specific monoclonal antibodies to detect the presence of A beta x-40 and A beta x-42 subspecies. Stereologically unbiased tangle and neuropil thread counts were obtained from the same region. R269H PS1 mutation was associated with early age of dementia onset, higher amounts of total A beta and A beta x-42, and increased neuronal cytoskeletal changes. Thus, if the changes observed on this case prove to be typical of PS1 mutations, PS1 mutations may impact both amyloid deposition and neurofibrillary pathology.

ApoE-4 and age at onset of Alzheimer's disease: the NIMH genetics initiative.

OBJECTIVE: To explore the impact of apoE-4 on Alzheimer's disease (AD) and its age at onset. DESIGN: A genetic linkage study using affected relative pairs, predominantly siblings. SETTING: Three academic medical centers ascertained subjects from memory disorder clinics, nursing homes, and the local community. SUBJECTS: 310 families including 679 subjects with AD by NINCDS/ADRDA and/or Khachaturian criteria and 231 unaffected subjects. OUTCOME MEASURE: ApoE genotype. ANALYTIC METHODS: Association, affected pedigree member, sibling pair, and lod score analyses. RESULTS: ApoE-4 was strongly associated with AD in this sample (allele frequency = 0.46 vs. 0.14 in controls, p < 0.000001). Results of lod score, affected pedigree member analysis, and sib-pair analysis also supported apoE-4 as a risk factor for AD. When the sample was stratified on family mean age at onset, the risk conferred by apoE-4 was most marked in the 61 to 65 age group. Individuals with two copies of apoE-4 had a significantly lower age at onset than those with one or no copies (66.4 vs. 72.0, p < 0.001), but individuals with one copy did not differ from those with none. Within families, the individual with the earliest age at onset had, on average, significantly more apoE-4 alleles (p < 0.0001) than the individual with the latest onset. DISCUSSION: This work supports previous reports of an association between apoE-4 and the development of AD and demonstrates that apoE-4 exerts its maximal effect before age 70. These findings have important implications for the potential use of apoE genotyping for diagnosis and prediction of disease. They also underscore the need to identify additional genetic factors involved in AD with onset beyond age 70 years.

Purification and application of a single-chain Fv antibody fragment specific to hepatitis B virus surface antigen.

Immobilized metal affinity chromatography (IMAC) has been recently applied to the purification of of recombinant proteins bearing multi-histidine domains at their N or C terminus. We have now used this procedure for the single-step purification of an anti-Hepatitis B virus surface antigen (HBsAg) single-chain Fv (scFv) antibody fragment. Adjusting the metal ion (Cu+2 or Ni+2) and elution conditions (pH or imidazole), we efficiently separated active scFv forms from inactive molecules. Achieved purity was 93%, with a 20% yield with respect to the scFv content in the initial material. The pure scFv was coupled to CNBr-activated Sepharose 4B and compared the original monoclonal antibody (MAb) CB-Hep.1 in the immunoaffinity purification of a vaccine recombinant HBsAg (r-HBsAg). Results indicate that eluted antigen per mg of coupled ligand was similar for the scFv and the MAb when pure r-HBsAg was used as starting material. Preliminary results with unpurified starting material are also encouraging.

Síntesis química rápida de desoxioligonucleótidos por el método del triéster fosfórico en fase sólida / Rapid chemical synthesis of deoxyoligonucleotides by solid phase phosphotriester method

En este trabajo se describen modificaciones al método de síntesis de oligodeoxinucleótidos en fase sólida que permiten alcanzar rendimientos superiores al 95 por ciento en cada etapa de alargamiento de la cadena nucleotídica y acortar cada ciclo a 10 minutos

Síntesis química rápida de desoxioligonucleótidos por el método del triéster fosfórico en fase sólida / Rapid chemical synthesis of deoxyoligonucleotides by solid phase phosphotriester method

En este trabajo se describen modificaciones al método de síntesis de oligodeoxinucleótidos en fase sólida que permiten alcanzar rendimientos superiores al 95 por ciento en cada etapa de alargamiento de la cadena nucleotídica y acortar cada ciclo a 10 minutos

Síntesis química de oligonucleótidos por el método de fosfotriéster / Chemical synthesis of oligonucleotides by the phosphotriester approach

En este trabajo se reporta la síntesis química de los desoxioligonucleótidos siguientes: ACTTCTTAACCT, GATCACACATTT, ACACTTCTTTAT, GACAGACTACCT, CTGCTCTGACAACCT, AAATGTCT, AGCATGCT, TCTGAATGACCTGCATTAAAATAT, GTAAAACGACGGCCAGT y AAACCTCATCTGTGT. Estos fueron obtenidos mediante el método del triéster en solución, empleando distintos tipos de agentes de condensación e introduciendo modificaciones en el procedimiento de aislamiento de los productos de reacción. Todos los desoxioligonucleótidos sintetizados fueron purificados, una vez desprotegidos, por cromatografía líquida de alta eficacia en columnas de intercambio iónico y fase inversa sucesivamente y comprobada su secuencia por el método de Maxam y Gilbert

Síntesis química de oligonucleótidos por el método de fosfotriéster / Chemical synthesis of oligonucleotides by the phosphotriester approach

En este trabajo se reporta la síntesis química de los desoxioligonucleótidos siguientes: ACTTCTTAACCT, GATCACACATTT, ACACTTCTTTAT, GACAGACTACCT, CTGCTCTGACAACCT, AAATGTCT, AGCATGCT, TCTGAATGACCTGCATTAAAATAT, GTAAAACGACGGCCAGT y AAACCTCATCTGTGT. Estos fueron obtenidos mediante el método del triéster en solución, empleando distintos tipos de agentes de condensación e introduciendo modificaciones en el procedimiento de aislamiento de los productos de reacción. Todos los desoxioligonucleótidos sintetizados fueron purificados, una vez desprotegidos, por cromatografía líquida de alta eficacia en columnas de intercambio iónico y fase inversa sucesivamente y comprobada su secuencia por el método de Maxam y Gilbert