RESUMO
Tomato (Solanum lycopersicum L.) is an important vegetable crop in Mexico. The national production in 2009 was 2,043,814 metric tons with a value of $163,560,636 US. Since 2007, abnormal yellow and crispy leaves were observed in commercial tomato fields in Ensenada County, Baja California, Mexico. In affected fields from two localities (San Quintín Valley and Ensenada), symptomatic plants were randomly distributed and symptoms resembled previous descriptions of crinivirus infections in tomato (3). The symptoms and the presence of whiteflies (Bemisia tabaci and Trialeurodes vaporariorum) in the affected fields suggested a viral etiology. Leaf samples of 143 symptomatic tomato plants were collected in the 2007 and 2008 growing seasons. Total RNA was extracted and analyzed by reverse transcription (RT)-PCR assay for simultaneous detection of Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV). Degenerate primers (HS-11/HS-12) were used in combination with specific primers (TIC-3/TIC-4 and ToC-5/ToC-6) for detection of these viruses by nested-PCR (2). A PCR fragment of the expected size for TICV (223 bp) was amplified in 26 of 143 samples. None of the samples tested positive for ToCV. In addition, considering that whiteflies are vectors of begomoviruses, samples were also tested for presence of viral DNA. Results showed 30 positive samples and one with mixed infection. It is therefore possible that the viral disease symptoms observed could be caused in part by viruses other than TICV. Three amplicons from RT-PCR of tomato samples were cloned into the pGEM-T easy vector system II (Promega Corporation, Madison, WI) and sequenced. The sequence of one amplicon (GenBank Accession No. FJ609651) was compared with the sequences of other criniviruses reported in the NCBI/GenBank database using the Clustal V alignment method of the sequence analysis software suite Lasergene (MegAling, DNASTAR Inc., Madison, WI). Sequence analysis of the 223-bp PCR fragment corresponding to TICV showed 99.1% identity with a TICV isolate from Japan (GenBank Accession No. AB085602) and 100% identity with TICV isolates from the United States (GenBank Accession No. TIU67449). Although the presence of another crinivirus, ToCV, was reported previously in Mexico associated with tomato crops and two native weeds, S. nigrescens and Datura stramonium (1), this virus was not detected in Baja California during the present work. To our knowledge, this is the first report of TICV associated with tomato diseases in Mexico. The emerging of a previously unreported virus disease in tomato production areas of Mexico complicates disease management efforts. References: (1) P. Álvarez-Ruíz et al. Plant Pathol. 56:1043, 2007. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) G. C. Wisler et al. Plant Dis. 82:270, 1998.
RESUMO
Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of $259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 83:1178, 1999. (2) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (3) C. Gámez-Jímenez et al. (Abstr.) Phytopathology 96(suppl.):S38. 2006.
