Viral Metagenomic-Based Screening of Sugarcane from Florida Reveals Occurrence of Six Sugarcane-Infecting Viruses and High Prevalence of Sugarcane yellow leaf virus.

A viral metagenomics study of the sugarcane virome in Florida was carried out in 2013 to 2014 to analyze occurrence of known and potentially new viruses. In total, 214 sugarcane leaf samples were collected from different commercial sugarcane (Saccharum interspecific hybrids) fields in Florida and from other Saccharum and related species taken from two local germplasm collections. Virion-associated nucleic acids (VANA) metagenomics was used for detection and identification of viruses present within the collected leaf samples. VANA sequence reads were obtained for 204 leaf samples and all four previously reported sugarcane viruses occurring in Florida were detected: Sugarcane yellow leaf virus (SCYLV, 150 infected samples out of 204), Sugarcane mosaic virus (1 of 204), Sugarcane mild mosaic virus (13 of 204), and Sugarcane bacilliform virus (54 of 204). High prevalence of SCYLV in Florida commercial fields and germplasm collections was confirmed by reverse-transcription polymerase chain reaction. Sequence analyses revealed the presence of SCYLV isolates belonging to two different phylogenetic clades (I and II), including a new genotype of this virus. This viral metagenomics approach also resulted in the detection of a new sugarcane-infecting mastrevirus (recently described and named Sugarcane striate virus), and two potential new viruses in the genera Chrysovirus and Umbravirus.

Anatomy of equine incisors: Pulp horns and subocclusal dentine thickness.

BACKGROUND: Equine incisors are often reduced in height during corrective dental procedures. Increased knowledge of subocclusal dentine thickness and pulp morphology may help prevent iatrogenic pulpar exposure. Although such data exist for equine cheek teeth, there are currently no reliable data for incisors. OBJECTIVES: To measure the distances between pulp cavities and the occlusal as well as the labial surfaces of equine incisors and to test if these distances change with age. Furthermore, pulp morphology with regard to number and orientation of pulp horns was investigated. STUDY DESIGN: Observational study using cadaver material and high-resolution computed tomography. METHODS: Upper and lower incisor arcades were removed from heads of 13 horses and scanned with high-resolution computed tomography. 3D Models were reconstructed and configuration as well as number of the pulp horns was evaluated. Anatomical marker points were set to measure distances between the pulp horn tips and the labial and occlusal surfaces. RESULTS: Subocclusal dentine thickness ranged between 1.5 and 11.7 mm in upper and 0.7 and 6.7 mm in lower incisors. It decreased with tooth age. Distance to labial aspect ranged between 3.5 and 9.0 mm in upper and 3.8 and 8.1 mm in lower incisors and increased with tooth age. MAIN LIMITATIONS: Details of horse management, feeding and previous dental care were not available. Therefore, it remains unknown how these factors influenced the results. CONCLUSIONS: Although mean subocclusal dentine thickness of greater than 4.1 mm was found, equine incisors occasionally have less than 1 mm of thickness with potential for iatrogenic pulpar exposure during incisor reduction. Therefore, great care should be exercised by any practitioner during incisor reduction.

First Report of Acidovorax avenae subsp. avenae Causing Sugarcane Red Stripe in Gabon.

During a disease inspection at the sugarcane estate SUCAF near Franceville, Gabon, in March 2011, 1- to 3-mm wide and several dm long dark red stripes were observed on sugarcane (Saccharum spp.) leaves of many plants of cultivar R570. These plants were 5.5 months old in the first ratoon crop. Additionally, spindle leaves of several stalks were rotted and could be easily pulled out of the top of the stalk. Longitudinal sections of diseased stalks showed reddish-brown discoloration of the upper stem and the rotted spindle had an unpleasant odor. Circular, convex, smooth, yellow-cream pigmented bacterial colonies with 2 to 3 mm diameter were isolated after 3 days at 28°C from young leaf lesions on YPGA (yeast extract 7 g/L, peptone 7 g/L, glucose 7 g/L, agar 15 g/L, pH 6.8 to 7.0). The 16S-23S internal transcribed spacer (ITS) of two representative colonies was PCR amplified, and the nucleotide sequences were shown to be 99% identical to the 16S-23S ITS sequence from the genome of Acidovorax avenae subsp. avenae strain ATCC 19860 (GenBank: CP002521.1). One of these A. avenae subsp. avenae isolates from Gabon was inoculated into greenhouse grown plants of sugarcane cultivar R570. Plants were inoculated by injection into the sheath of spindle leaves above the meristem with the bacterial strain (12 plants) or with a water control (six plants). In this method, the bacteria (108 CFU/ml) were injected using a syringe through the leaf sheath until filling the leaf whorl. Three weeks post-inoculation, one to several cm long red-brown stripes were observed on leaves of 11 of 12 inoculated plants. Seven weeks post-inoculation, all plants exhibited symptoms, from red, brown, or black stripes to leaf necrosis, rotting, and death of the spindle leaves (six plants). All six control plants were symptomless. In a second experiment, 6 of 12 plants showed symptoms 3 weeks post inoculation, and the pathogen was successfully re-isolated from all six symptomatic plants with YPGA medium. The 16S-23S ITS of three single colonies obtained each from different symptomatic plants were PCR amplified and the nucleotide sequences were again found 99% identical to the 16S-23S ITS sequence from the genome of A. avenae subsp. avenae ATCC 19860. To our knowledge, this is the first report of A. avenae subsp. avenae, the causal agent of sugarcane red stripe (also reported as top rot), in Gabon. It is also the first description of the occurrence of the top rot form of the disease in R570, a cultivar that is grown in several locations of Africa, the Mascarene Islands, and the French West Indies. A large-scale survey needs to be undertaken to determine the distribution of red stripe in Gabon, a disease for which several outbreaks have been reported recently worldwide (1,2). References: (1) M. P. Grisham and R. M. Johnson. Phytopathology 101:564, 2011. (2) S. Zia-ul-Hussnain et al. Afr. J. Biotechnol. 10:7191, 2011.

First Report of Sugarcane Leaf Scald in Gabon Caused by a Highly Virulent and Aggressive Strain of Xanthomonas albilineans.

During a disease inspection at the sugarcane estate SUCAF near Franceville, Gabon, in March 2011, 0.5 to 1 cm wide chlorotic stripes covered with many small red streaks were observed on sugarcane (Saccharum spp.) leaves of a single plant of cultivar R581. After removal of the leaves covering the base of the stalks, abnormal development of basal side shoots was also observed. Transversal sections of a diseased stalk showed reddening of the vessels near the nodes. Circular, convex, smooth, shiny, translucent, non-mucoid, honey-yellow pigmented bacterial colonies were isolated from stalk pieces and side shoots on XAS selective agar medium (1). The nucleotide sequence of the 16S-23S internal transcribed spacer (ITS) of a representative colony was shown to be 100% identical to the 16S-23S ITS sequence from the genome of Xanthomonas albilineans strain GPE PC73 (GenBank: FP565176.1). This strain from Gabon was named GAB266. Sugarcane stalks of greenhouse grown cultivar CP68-1026 were inoculated with X. albilineans strains XaFL07-1 from Florida, GPE PC73 from Guadeloupe, and GAB266. Five stalks were inoculated by the modified decapitation method (3) with each strain or with a water control. One month post-inoculation (MPI), white pencil lines and severe necrosis were observed on leaves inoculated with strains XaFL07-1 and GPE PC73, and no disease symptoms appeared on non-inoculated leaves that developed 2 to 3 MPI. These results are in agreement with those generally obtained after inoculation of susceptible sugarcane cultivars with X. albilineans strains from various geographical locations under greenhouse conditions (Rott, unpublished results). In contrast, 1 MPI, only discrete white to red pencil lines were observed along with necrosis on leaves inoculated with strain GAB266, and by 2 to 3 MPI, all five inoculated plants were wilted. The pathogen was successfully reisolated by the stalk blot inoculation technique (3) with XAS medium, from all five inoculated stalks and from 98 of 114 internodes. In a second greenhouse experiment, the same three strains of X. albilineans were inoculated as described above into five sugarcane cultivars differing in resistance to leaf scald in Guadeloupe (2) (CP68-1026, highly susceptible; B69566, susceptible; R570, tolerant; B8008, resistant; Co6415, highly resistant). The same symptoms as those described above were again observed on inoculated leaves of the five sugarcane cultivars 1 MPI. Strains XaFL07-1 and GPE PC73 produced occasionally a single pencil line on non-inoculated leaves 2 to 3 MPI, but only strain GAB266 caused leaf scalding and/or plant death 2 to 3 MPI: cultivar CP68-1026 (5 of 5 plants), B69566 (5 of 5 plants), R570 (4 of 5 plants), B8008 (5 of 5 plants), and only non-inoculated leaves of cultivar Co6415 remained symptomless (5 plants). Strain GAB266 from Gabon appeared, therefore, more virulent and aggressive than the two strains of X. albilineans from Florida and Guadeloupe. To our knowledge, this is the first report of leaf scald of sugarcane in Gabon and the first description of an unusual highly virulent and aggressive strain of X. albilineans. A large-scale survey needs to be undertaken to determine the distribution of leaf scald disease and this new pathotype/race of X. albilineans in Gabon and other geographical locations. References: (1) M. J. Davis et al. Plant Dis. 78:78, 1994. (2) P. Rott et al. Phytopathology 87:1202, 1997 (3) P. Rott et al. Mol. Plant-Microbe Interact. 24:594, 2011.

Epiphytic Populations of Xanthomonas albilineans and Subsequent Sugarcane Stalk Infection Are Linked to Rainfall in Guadeloupe.

Three separate field trials were established in Guadeloupe under different agronomic and rainfall conditions to study phyllosphere contamination and infection of sugarcane plants by Xanthomonas albilineans, the causal agent of sugarcane leaf scald. Disease-free and leaf scald susceptible cv. B69566 was planted and monitored during three 1-year crop cycles. Presence of leaf scald contaminated sugarcane fields in the proximity of the disease-free trials appeared critical in early contamination of the sugarcane phyllosphere. Later on, particular meteorological events, such as tropical storms, were also important in aerial spread of the pathogen. A positive correlation was found between epiphytic populations of X. albilineans and severity of leaf necrotic symptoms, but occurrence of leaf symptoms was not always related to subsequent stalk infection. However, when the data of the three crop seasons were considered together, a high correlation was found between rainfall and maximum epiphytic populations of X. albilineans, and between rainfall and subsequent stalk infections. Consequently, rainfall is a key factor to be considered in evaluation of risks of leaf scald epidemics, and protocols for propagation of healthy sugarcane material and screening methods for leaf scald resistance may have to be revised in humid tropical locations.

Yellow leaf of sugarcane is caused by at least three different genotypes of sugarcane yellow leaf virus, one of which predominates on the Island of Réunion.

The genetic diversity of sugarcane yellow leaf virus (SCYLV) was analyzed with 43 virus isolates from Réunion Island and 17 isolates from world-wide locations. We attempted to amplify by reverse-transcription polymerase chain reaction (RT-PCR), clone, and sequence four different fragments covering 72% of the genome of these virus isolates. The number of amplified isolates and useful sequence information varied according to each fragment, whereas an amplicon was obtained with diagnostic primers for 59 out of 60 isolates (98%). Phylogenetic analyses of the sequences determined here and additional sequences of 11 other SCYLV isolates available from GenBank showed that SCYLV isolates were distributed in different phylogenetic groups or belonged to single genotypes. The majority of isolates from Réunion Island were grouped in phylogenetic clusters that did not contain any isolates from other origins. The complete six ORFs (5612 bp) of five SCYLV isolates (two from Réunion Island, one from Brazil, one from China, and one from Peru) were amplified, cloned, and sequenced. The existence of at least three distinct genotypes of SCYLV was shown by phylogenetic analysis of the sequences of these isolates and additional published sequences of three SCYLV isolates (GenBank accessions). The biological significance of these genotypes and of the origin of the distinct lineage of SCYLV in Réunion Island remains to be determined.

High Variation in Pathogenicity of Genetically Closely Related Strains of Xanthomonas albilineans, the Sugarcane Leaf Scald Pathogen, in Guadeloupe.

ABSTRACT Pathogenicity of 75 strains of Xanthomonas albilineans from Guadeloupe was assessed by inoculation of sugarcane cv. B69566, which is susceptible to leaf scald, and 19 of the strains were selected as representative of the variation in pathogenicity observed based on stalk colonization. In vitro production of albicidin varied among these 19 strains, but the restriction fragment length polymorphism pattern of their albicidin biosynthesis genes was identical. Similarly, no genomic variation was found among strains by pulsed-field gel electrophoresis. Some variation among strains was found by amplified fragment length polymorphism, but no relationship between this genetic variation and variation in pathogenicity was found. Only 3 (pilB, rpfA, and xpsE) of 40 genes involved in pathogenicity of bacterial species closely related to X. albilineans could be amplified by polymerase chain reaction from total genomic DNA of all nine strains tested of X. albilineans differing in pathogenicity in Guadeloupe. Nucleotide sequences of these genes were 100% identical among strains, and a phylogenetic study with these genes and housekeeping genes efp and ihfA suggested that X. albilineans is on an evolutionary road between the X. campestris group and Xylella fastidiosa, another vascular plant pathogen. Sequencing of the complete genome of Xanthomonas albilineans could be the next step in deciphering molecular mechanisms involved in pathogenicity of X. albilineans.

Variation in Albicidin Biosynthesis Genes and in Pathogenicity of Xanthomonas albilineans, the Sugarcane Leaf Scald Pathogen.

ABSTRACT Total genomic DNA from 137 strains of Xanthomonas albilineans from worldwide locations was hybridized with two DNA probes that together harbor the entire 49-kb albicidin biosynthesis gene cluster and two additional 3-kb genomic regions required for albicidin production. Fourteen haplotypes and two major genetic groups (albicidin [ALB]-restriction fragment length polymorphism [RFLP] A and ALB-RFLP B) were identified, and strains that were isolated after recent outbreaks of leaf scald disease belonged to group ALB-RFLP B. Albicidin genetic diversity was very similar to the previously described genetic diversity of the pathogen based on the whole genome. No relationship was found between variability of albicidin biosynthesis genes and the amount of albicidin produced in vitro by X. albilineans. Leaf scald-susceptible sugarcane cv. H70-144 was inoculated with 20 strains of the pathogen belonging to different ALB-RFLP haplotypes. Among them, 10 strains from Guadeloupe belonged to the same ALB-RFLP group but differed in the amount of albicidin produced in vitro. Strains were distributed in at least three different pathogenicity groups based on symptom severity and pathogen population density in the stalk. These two pathogenicity factors varied concurrently; however, no relationship between variation in albicidin biosynthesis genes, variation in the amount of albicidin produced in vitro, and variation in pathogenicity of X. albilineans was found. Further investigation is necessary to identify other genes involved in pathogenicity of X. albilineans.

First Report of Leifsonia xyli subsp. xyli, Causal Agent of Ratoon Stunting of Sugarcane, in Jamaica.

To our knowledge, this is the first report that Leifsonia xyli subsp. xyli, previously named Clavibacter xyli subsp. xyli (2), has been detected and identified in sugarcane in Jamaica. Although ratoon stunting (also known as ratoon stunting disease or RSD) has been reported in Jamaica since 1961, presence of the pathogen had never been confirmed in symptomatic tissues. A major industry-wide survey conducted in 1987 using the fluorescent antibody staining technique failed to detect positives in any of the 61 fields sampled in Jamaica. A new survey was conducted in 2004 on eight estates and the Sugar Industry Research Institute (SIRI) in Jamaica. Six arbitrarily selected stalks were sampled from each of 64 fields representing 25 different sugarcane cultivars. A 1-cm diameter core was extracted from the center of the bottom part of the stalk and used to detect the pathogen by tissue blot immunoassay (TBIA) (3). L. xyli subsp. xyli was detected in 26 of 384 samples (7%). At least one positive sample was found in 10 fields and seven cultivars and in one case (sugarcane cv. D14146 at the St Thomas Sugar Estate), all six stalks sampled in a field were positive. The highest number of infected fields (6 of 10) occurred at Worthy Park where cane yield in 2004 was 86.54 tons per ha compared with an average of 68.04 tons per ha for major estates in Jamaica (1). This latter result would indicate that where good quality agronomic practices are maintained, the effect of ratoon stunting might not be substantial or that sugarcane cultivars grown at this location were resistant to ratoon stunting. Pathogen identification was confirmed using nested polymerase chain reaction (PCR) with three samples from a TBIA-positive field of cv. D14146. Primary primers were RSD 33 (CTGGCACCCTGTGTTGTTTTC) and RSD 297 (TTCGGTTCTCATCTCAGCGTC) and secondary, nested primers were RST60 (TCAACGCAGAGATTGTCCAG) and RST59 (CGTCTTGAAGACACAGCGATGAG). The thermocycler parameters were denaturization at 94°C for 4 min, 31 cycles at 94°C for 30 s, 55°C for 30 s, 65°C for 1 min, and final extension at 65°C for 3 min. The nested-PCR product (approximately 230 bp) of each sample was cloned and sequenced. It showed 99 to 100% identity with the 16S-23S intergenic spacer region of L. xyli subsp. xyli, thus confirming occurrence of ratoon stunting in Jamaica. Since this study, the SIRI has installed a hot-water treatment plant and will heat-treat cuttings before planting the nurseries with new sugarcane clones selected for release to growers. The SIRI will also conduct screening for ratoon stunting resistance to ensure that susceptible clones are not released to the industry. Meanwhile, the SIRI will do a more intense survey so that a more comprehensive picture may be obtained of the presence of ratoon stunting in Jamaica. References: (1) Anonymous. Annual Report of the Sugar Industry Research Institute, Jamaica, 2004. (2) L. I. Evtushenko et al. Int. J. Syst. Evol. Microbiol. 50:371, 2000. (3) N. A. Harrison and M. J. Davis. Phytopathology 78:722, 1988.

Polyphasic characterization of xanthomonads isolated from onion, garlic and Welsh onion (Allium spp.) and their relatedness to different Xanthomonas species.

Bacterial blight is an emerging disease that affects primarily onion, but also garlic and Welsh onion. The present study was undertaken to characterize the causative xanthomonad(s) by a polyphasic approach using a worldwide collection of 33 bacterial strains. Analysis of 16S rRNA gene sequence similarities indicated that the causal agent belongs to the campestris core in the genus Xanthomonas, which is in agreement with results of phenotypic characterization (analyses of carbon source utilization and fatty acid methyl esters). However, DNA-DNA hybridization, thermal stability of DNA reassociation and fluorescent amplified fragment length polymorphism analysis allowed the causal agent to be identified as a pathovar of Xanthomonas axonopodis.

Genetic diversity in the coat protein coding region of eighty-six sugarcane mosaic virus isolates from eight countries, particularly from Cameroon and Congo.

Fifty-eight sugarcane virus isolates were obtained from leaves showing mosaic symptoms, and collected in Cameroon (26 isolates), Congo (20 isolates), Egypt (1 isolate), South Africa (3 isolates) and the U.S.A. (8 isolates). All these isolates belonged to Sugarcane mosaic virus (SCMV) based on the amplification product obtained by RT-PCR with SCMV-specific primers. The amplicons (0.9 kb) from the coat protein (CP) coding region were cloned, sequenced and compared to each other as well as to the sequences (GenBank accessions) of 16 SCMV isolates from sugarcane (Australia, South Africa and U.S.A.) and 12 SCMV isolates from maize (Australia, Germany and China). Maximum likelihood and maximum parsimony analyses robustly supported two major monophyletic groups that were correlated with the host of origin: the SCE or sugarcane group that included all isolates from sugarcane and the MZ or maize group that contained all isolates from maize. The 86 virus isolates were distributed in 13 minor phylogenetic groups, four (I-IV) restricted to maize and nine (V-XIII) to sugarcane. A strong correlation was observed between the sugarcane groups and the geographical origin of the SCMV isolates. Each SCMV type strain from sugarcane (A, B, D, E and SC) was distributed in a different phylogenetic group or subgroup. The 26 isolates from Cameroon constituted a relatively homogeneous group (group V) whereas the 20 isolates from Congo belonged to two other groups (VI and VII). All the isolates from Cameroon and Congo were different from the SCMV type strains and other strains or isolates studied so far. It appears, therefore, that the population of SCMV from sugarcane in Africa contains virus genotypes that have not yet been described.

[Cesarean section on request--a medical and psychosomatic problem]. / Die Wunschsektio--medizinische und psychosomatische Problematik.

Caesarean section on request of the mother turned out lately to be very actual in obstetrical discussions. To come to rational decisions the scientific results of several medical disciplines should be taken into consideration. There is no scientific evidence for benefits of such elective c-section in paediatrics and psychosocial medicine. The obstetricians view shows both benefits and disadvantages, the later overweighing the first. In the light of these data, elective caesarean without other indication but the mothers request does not show to be an acceptable routine procedure.

Resistance of Sugarcane Cultivar R 570 to Puccinia melanocephala Isolatesfrom Different Geographic Locations.

Two different inoculation techniques were investigated before studying the reaction of the major rust resistance gene of sugarcane cultivar R 570 against isolates of Puccinia melanocephala from different geographic locations. Cultivar R 570 exhibited severe rust symptoms when in vitro plantlets were inoculated with a rust isolate from Réunion Island, but a good correlation with field resistance was observed when detached leaves were inoculated with the pathogen. This latter technique was then used to inoculate R 570 and a sample of its self progeny with rust isolates from Brazil, Colombia, Florida (three isolates), Guadeloupe, Réunion Island, and Zimbabwe. R 570 was resistant to all isolates of P. melanocephala, and the segregation of resistance in the progeny did not change with the isolates, suggesting that a single gene, or a single chromosomic region, was involved in the resistance against all tested isolates. This major resistance gene has, therefore, potential value to improve resistance to rust in various geographic regions.

Detection of Sugarcane yellow leaf virus in Quarantine and Production of Virus-free Sugarcane by Apical Meristem Culture.

Sugarcane yellow leaf virus (SCYLV) was detected for the first time in 1996 in the Centre de Coopération Internationale en Recherche Agronomique pour le Développement (CIRAD) sugarcane quarantine at Montpellier by reverse transcription-polymerase chain reaction (RT-PCR) in varieties from Brazil, Florida, Mauritius, and Réunion. Between 1997 and 2000, the virus was found by RT-PCR and/or tissue-blot immunoassay (TBIA) in additional varieties from Barbados, Cuba, Guadeloupe, Indonesia, Malaysia, Philippines, Puerto Rico, and Taiwan, suggesting a worldwide distribution of the pathogen. An excellent correlation was observed between results obtained for the two diagnostic techniques. However, even though only a few false negative results were obtained by either technique, both are now used to detect SCYLV in CIRAD's sugarcane quarantine in Montpellier. The pathogen was detected by TBIA or RT-PCR in all leaves of sugarcane foliage, but the highest percentage of infected vascular bundles was found in the top leaves. The long hot water treatment (soaking of cuttings in water at 25°C for 2 days and then at 50°C for 3 h) was ineffective in eliminating SCYLV from infected plants. Sugarcane varieties from various origins were grown in vitro by apical bud culture and apical meristem culture, and the latter proved to be the most effective method for producing SCYLV-free plants.

First Report of Sugarcane yellow leaf virus in Peru.

Two sugarcane cultivars, H 50-7209 and H 32-8560, have exhibited unusual, severe leaf yellowing for more than 18 years at Agro Industrial Paramonga S.A. (AIPSA) in Peru. In 1999, these varieties occupied about 4,600 ha (74% of the cultivated area), and almost all fields showed these symptoms. Symptoms first appear on the upper third of the leaf blades, which turns light green to light yellow in young canes up to 6 to 8 months of age. Between 10 and 16 months of age, the symptoms are visible on the spindle and first to third visible dewlap leaves. Tips and margins of older leaves become necrotic, and leaves can turn completely necrotic as the necrosis progresses down the leaves. The abaxial surface of leaf midribs is rarely bright yellow, which differs from the characteristic symptom of yellow leaf syndrome caused by the Sugarcane yellow leaf virus (ScYLV) (1). The most severe symptoms occur when the leaves of stalks that flower turn completely yellow and die. Samples from 98 plants exhibiting different types of yellowing were collected from six commercial fields of cultivars H 50-7209 and H 32-8560 and the germ plasm collection (cultivars PCG 59-1609, Trojan, CP 48-103, CP 72-2086, Q 87, and PR 908) at Paramonga. Tissue blot immunoassay was used to detect ScYLV in the midrib of the top visible dewlap leaf using antiserum provided by B. E. L. Lockhart (University of Minnesota) (2). ScYLV was detected in all 49 commercial field samples and in 35 out of 49 germ plasm samples. All six cultivars of the germ plasm collection were found to be infected, but ScYLV was detected in only a few leaves of Trojan and CP 72-2086. Eighteen cuttings from diseased stalks of cultivars H 50-7209 and H 32-8560 were grown in a greenhouse in Montpellier, France. Yellowing of the underside of the midribs and of the leaf tips appeared after 3 months in cultivar H 50-7209 but only after 9 months in cultivar H 32-8560. At 9 months, the top leaf with a visible dewlap and the four leaves immediately below it of cultivar H 50-7209 exhibited severe yellowing. Reverse transcription polymerase chain reaction with specific ScYLV primers, provided by M. S. Irey (U.S. Sugar Corp., Clewiston, FL) were used to detect ScYLV in the top visible dewlap leaf (1), and ScYLV was found in all nine samples taken from 6-month-old plants of the two cultivars. This is the first report of ScYLV in Peru. References: (1) J. C. Comstock et al. Sugar Cane 4:21, 1998. (2) S. Schenck et al. Sugar Cane 4:5, 1997.

First Report of Sugarcane Yellow Leaf Virus in the French West Indies.

Unusually severe leaf yellowing symptoms, similar to those described for yellow leaf syndrome (1), have been observed in several sugarcane clones in Guadeloupe since 1994, and since 1997 in Martinique. Leaf samples exhibiting various types of yellowing were taken from five different sugarcane clones, and analyzed by immunosorbent electron microscopy. Spherical particles, 24 to 28 nm in diameter and characteristic of luteoviruses, were found in two of five samples. The two infected samples showed yellowing on the underside of the midrib and one had a pinkish coloration on the upper side. The presence of sugarcane yellow leaf virus (ScYLV), the causal agent of sugarcane yellow leaf disease, was confirmed by reverse transcription-polymerase chain reaction (2) in these two samples and in 36 of 184 sugarcane clones bred in Guadeloupe and sent to Cirad's quarantine station in Montpellier, France. Following these observations, surveys were undertaken with a tissue blot enzyme immunoassay to analyze the distribution of ScYLV in sugarcane clones in the French West Indies. The midrib base of the first visible dewlap leaf was used to detect the presence of the virus in the phloem. In a first survey, clones of various origins worldwide were taken from germplasm collections. Two to three leaf samples per clone were analyzed from 78 clones in a collection in Guadeloupe and from 36 in a collection in Mar-tinique. Fifty of the 114 clones were infected by ScYLV, and ScYLV was detected in 21 of the 32 clones exhibiting severe leaf yellowing (score 3 or higher on a 1 to 5 scale). In a second survey, 19 leaf samples were taken from each of 53 clones from plants produced by Cirad's breeding program in Guadeloupe. The virus was detected in at least one sample for 25 of these 53 clones. ScYLV incidence in commercial fields was tested in Martinique in the variety B5992, which constitutes 57% of the cultivated area. Twenty leaves from different stools were sampled in six different fields, five of which had ScYLV-infected plants. The percentage of virus-infected stalks ranged from 0 to 90% whereas the percentage of stalks showing symptoms ranged from 50 to 100%. ScYLV appears widespread in the French West Indies, perhaps because a vector (Melanaphis sacchari) exists in Martinique and Guadeloupe. However, ScYLV was not found in all symptomatic plants, indicating that even if this luteovirus is a causal agent of leaf yellowing in the French West Indies, there may be other causal agents as well. References: (1) J. C. Comstock et al. Sugar J. 3:33, 1994. (2) J. C. Comstock et al. Sugar Cane 4:21, 1998.

Intraspecific Genomic Variation Within Xanthomonas albilineans, the Sugarcane Leaf Scald Pathogen.

ABSTRACT To better understand the nature of recent outbreaks of leaf scald disease of sugarcane in a number of sugarcane production regions of the world including Florida, Guadeloupe, Louisiana, Mauritius, Taiwan, and Texas, a study of the worldwide genetic variation of the pathogen was undertaken. A total of 218 strains from 31 geographic locations were examined. Genomic DNA of each strain was digested with the rare cutting restriction enzyme SpeI, and the fragments were separated by pulsed-field gel electrophoresis (PFGE). A total of 102 bands were identified, and 54 different DNA banding patterns (haplotypes) were observed. Eight groups of banding patterns, designated PFGE groups A through H, were consistently detected by visual, principal component, and cluster analyses. Five groups were comprised of multiple haplotypes representing numerous strains, and three were comprised of single haplotypes representing one strain each. The leaf scald outbreaks in Florida, Louisiana, Texas, and possibly Guadeloupe and Taiwan could be attributed to the introduction of strains belonging to PFGE group B. When infection by two strains each of the newly introduced strains (PFGE group B) and those previously present in Florida (PFGE group A) was analyzed in 22 sugarcane cultivars by reisolation 24 weeks after inoculation, a significantly greater mean frequency was detected for PFGE group B strains and no cultivar by PFGE group interaction was observed. Inadvertent dispersal of the pathogen among plants, possibly by means of aerosols or splashing water, was detected in a subsequent experiment. Strains of PFGE group B were recovered from the internal tissues of some plants inoculated with PFGE group A strains and were also found to be epiphytic colonizers of nonsymptomatic, noninoculated plants adjacent to the inoculated plants; whereas strains of PFGE group A were recovered only from plants that had been inoculated with them. Thus, the possibility became more apparent that strain variation might be associated, at least in part, with factors governing plant-to-plant spread of the pathogen in nature.

First Report of Leaf Scald Disease and Ratoon Stunting Disease of Sugarcane in French Guyana.

In December 1995, leaf scald symptoms were observed in sugarcane (Saccharum sp.) cultivar B64277 in French Guyana. Symptomatic plants occurred both in a sugarcane germplasm collection near the road between Sinnamary and Saint-Elie and in a nursery near Sinnamary. Sugarcane imported from Martinique had been used to establish the germplasm collection that in turn had been used to establish the nursery. Ten-month-old mature plants in the germplasm collection had abnormal side shoots on the lower part of the stalks and suckers (nonmillable stalks) with white scalded areas on leaves. Leaves on 1-month-old shoots in the nursery exhibited chlorosis and white, pencil-line streaks. Samples prepared from symptomatic stalks from the two locations were plated on a selective medium (1), and two isolates of Xanthomonas albilineans were recovered. Both of these isolates caused leaf scald symptoms on leaves of sugarcane cultivar B69566 inoculated by a decapitation technique, and belong to serovar 3 previously reported in the Caribbean from Guadeloupe, Martinique, and St. Kitts. The RFLP (restriction fragment length polymorphism) pattern of these two isolates was different from the 54 patterns among 218 other strains collected throughout the world (2), but similar to the pattern of a strain of serovar 3 from Martinique. This indicated that the pathogen might have been introduced with cuttings imported from Martinique. Three stalks of mature cane from varieties B5992, B64277, and R570 from the germplasm collection were tested for the presence of Clavibacter xyli subsp. xyli, causal agent of ratoon stunting disease. Immunofluorescence tests on sap (3) revealed the presence of the pathogen in the three stalks of B64277. All sugarcane plants in the nursery and the germplasm collection were destroyed by the use of glyphosate sprays in January 1996 in an attempt to arrest the spread of the two bacterial pathogens. In order to obtain healthy seed cane for future planting, a new germplasm collection of 0.6 ha and consisting of 11 cultivars was planted in January 1996 with disease-free, tissue-cultured plants provided by the CIRAD sugarcane breeding station in Guadeloupe. References: (1) M. J. Davis et al. Plant Dis. 78:78, 1994. (2) M. J. Davis et al. Phytopathology 87:316, 1997. (3) M. J. Davis and J. L. Dean. Plant Dis. 68:896, 1984.

Resistance to Leaf Scald Disease Is Associated with Limited Colonization of Sugarcane and Wild Relatives by Xanthomonas albilineans.

ABSTRACT A streptomycin- and rifampicin-resistant mutant of Xanthomonas al-bilineans was used to study symptom expression of leaf scald disease (LSD) and colonization of sugarcane (Saccharum spp.) and its wild relatives by this bacterial pathogen. A total of 40 sugarcane cultivars and 15 clones from the Saccharum complex that differed in resistance to LSD were inoculated by a decapitation technique in both field and greenhouse experiments. In the plant crop, disease severity varied between 0 for the most resistant genotypes and 100 for the most susceptible ones. Resistance to LSD was characterized by limited colonization of the host plant by X. albilineans. Although almost all genotypes were colonized by the pathogen, the greatest bacterial population densities were found in the susceptible cultivars. There was a high correlation between disease severity and pathogen population in the apex. Several genotypes exhibited no or slight symptoms even though they were highly colonized in the upper and/or basal nodes of stalks. Two mechanisms, therefore, may play an important role in resistance to LSD: resistance to colonization of the apex, which is characterized by absence of symptoms, and resistance to colonization of the upper and lower parts of the stalk. In contrast, disease severity and pathogen population densities in the first ratoon crop in the field were nil or very low in the stalks, except for the highly susceptible cv. CP68-1026. Sugarcane ratoons, therefore, may recover from the disease after plant cane infection. Nevertheless, because low levels of the pathogen were still detected in some stalks, it is possible that LSD could develop from latent infections if favorable environmental conditions occur.

At least two separate gene clusters are involved in albicidin production by Xanthomonas albilineans.

Transposon mutagenesis was used to obtain mutations affecting production of the toxin albicidin in Xanthomonas albilineans, which causes leaf scald disease of sugarcane and is also pathogenic to corn. Transposon Tn5-gusA inserted randomly into genomic DNA of X. albilineans Xa23R1 at a frequency of 10(-4) to 10(-5) per recipient after conjugal transfer from Escherichia coli. Fifty prototrophic mutants defective in albicidin production were isolated from 7,100 Tn5-gusA insertional derivatives tested for toxin production by an antibiosis bioassay. EcoRI fragments containing Tn5 flanking sequences from two mutants (AM15 and AM40) were cloned and used to probe a wild-type Xa23R1 DNA library by colony hybridization. Nine cosmids showed homology to the AM15 probe, and six showed homology to the AM40 probe. Four cosmid clones hybridized to both probes. Forty-five of the 50 defective mutants were restored to albicidin production with two overlapping cosmid clones. Restriction mapping showed that these mutants span a genomic region of about 48 kb. At least one other gene cluster is also involved in albicidin production in Xa23R1. DNA fragments from the 48-kb cluster proved to be very specific to X. albilineans. Some mutants affected in albicidin production retain their ability to colonize sugarcane cultivated in vitro.