Association of Burkholderia glumae and B. gladioli with Panicle Blight Symptoms on Rice in Panama.

Panicle blight of rice, caused by Burkholderia glumae, has been a serious problem on rice in Japan since 1955. It has been reported from other rice-producing countries around the world and recently was reported on rice in the southern United States (2). A rice producer in Panama contacted us to verify the occurrence of bacterial panicle blight in rice fields where heavy losses were associated with a disease of unknown etiology, but with typical bacterial panicle blight symptoms (2). The observed grain discoloration, sterility, and abortion were thought to be due to the spinki mite, Steneotarsonemus spinki Smiley. After obtaining a USDA-APHIS import permit (73325), rice panicle samples from seven fields in Panama were sent to our laboratory in 2006. Bacteria were isolated from grains showing typical panicle blight symptoms on the semiselective S-Pg medium. Nonfluorescing colonies producing toxoflavin on King's B medium were selected for further identification. Initial PCR analyses, made with DNA isolated directly from grain crushed in sterile water, with B. glumae specific primers (BGF 5'ACACGG AACACCTGGGTA3' and BGR 5'TCGCTCTCCCGAAGAGAT3') gave a positive reaction for B. glumae in all seven samples. Biolog tests (Biolog Inc, Hayward, CA), fatty acid analysis, and PCR using species-specific primers for B. glumae and B. gladioli (BLF 5'CGAGCT AATACCGCGAAA3' and BLR 5'AGACTCGA GTCAACTGA3') identified 19 B. glumae and 6 B. gladioli strains among 35 bacterial strains isolated. Only the Biolog and fatty acid analyses identified B. gladioli strains. PCR analysis did not identify B. gladioli strains. To confirm B. gladioli, PCR amplification of the 16S rDNA gene from eight representative strains (four each for B. glumae and B. gladioli) using universal primers (16SF 5'AGAGTTTGATCCTGGCTCAG3' and 16SR5'GGCTACCTTGTTACGACTT3') and further sequencing of the PCR product was performed. A BLAST analysis of 16S rDNA sequences in the Genbank data base showed 99% sequence similarity for these two species with other published sequences. Our APHIS import permit did not allow us to perform pathogenicity tests with the strains isolated from Panama, but the B. glumae and B. gladioli strains obtained corresponded closely with pathogenic control cultures isolated from rice grown in the United States or with strains obtained from the ATCC. Other B. glumae strains recently isolated from rice in Panama, and identified by PCR, were tested for pathogenicity in tests conducted at CIAT in Colombia and were found to be pathogenic and highly virulent. These strains caused disease on seedlings when inoculated and typical bacterial panicle blight symptoms on panicles when spray inoculated. This disease has caused severe losses in Panama's rice crop for at least 3 years. Similar symptoms reported in Cuba, Haiti, and the Dominican Republic were attributed to damage from the spinki mite in association with Sarocladium oryzae (Sawada) W. Gams & D. Hawksw. (1). Zeigler and Alvarez (3) reported the occurrence of B. glumae in Columbia in 1987, but not in other Latin American countries. Pseudomonas fuscovaginae was reported in association with rice grain discoloration in Panama (4), but to our knowledge, this is the first report of these two Burkholderia species being associated with panicle blight symptoms on rice in Panama. References: (1) T. B. Bernal et al. Fitosanidad 6:15, 2002. (2). A. K. M. Shahjahan et al. Rice J. 103:26, 2000. (3). R. S. Zeigler and E. Alvarez. Plant Dis. 73:368, 1989. (4). R. S. Zeigler et al. Plant Dis. 71:896, 1987.

Intramuscular versus enteral vitamin A supplementation in very low birth weight neonates.

We conducted a randomized trial in very low birth weight neonates (n = 51) to determine whether vitamin A supplementation by enteral administration would increase plasma vitamin A concentrations to the same degree as by intramuscular administration. Mean plasma vitamin A concentrations were significantly higher in the intramuscular-administration group than in the enteral-administration group by postnatal day 7; this effect persisted throughout the remainder of the trial. At the dosage used in this trial, vitamin A supplementation by the enteral route is not as effective as that by the intramuscular route in very low birth weight neonates.

Double-blind, placebo-controlled trial of alternate-day furosemide therapy in infants with chronic bronchopulmonary dysplasia.

To test the hypothesis that alternate-day administration of furosemide will result in a sustained improvement in pulmonary function without causing alterations in electrolyte or mineral homeostasis, we conducted a randomized, double-blind, placebo-controlled study of 11 hospitalized, oxygen-dependent, spontaneously breathing infants with chronic bronchopulmonary dysplasia. Infants were randomly selected to receive either furosemide, 4 mg/kg in two divided doses on alternate days orally, or placebo for 8 days, followed by crossover to the alternate-therapy for an additional 8-day period. The two study periods were separated by a 48-hour washout period. Dynamic compliance, total pulmonary resistance, the concentration of electrolytes in serum, and the concentrations of calcium and creatinine in urine were measured on nontreatment days. Alternate-day furosemide therapy increased dynamic lung compliance by 76 +/- 112% and decreased total pulmonary resistance by 20 +/- 39%, compared with placebo (both variables p = 0.032). Alternate-day furosemide therapy did not result in increased urine output, electrolyte abnormalities, or increased urinary calcium excretion. We conclude that this simplified treatment regimen may be useful in the management of infants with chronic bronchopulmonary dysplasia. The results support our previous speculation that furosemide improves pulmonary function by mechanisms unrelated to its diuretic properties.

Plasma retinol-binding protein response to vitamin A administration in infants susceptible to bronchopulmonary dysplasia.

We hypothesized that changes in plasma retinol-binding protein (RBP) concentration in response to vitamin A administration might be useful for evaluating vitamin A status of very low birth weight infants susceptible to bronchopulmonary dysplasia. We prospectively studied 24 consecutively admitted neonates (birth weight less than 1350 gm, gestational age less than 31 weeks, ventilator dependent for greater than 24 hours after birth), who were eligible to receive 2000 IU supplemental vitamin A by intramuscular injection on postnatal day 1 and on alternate days thereafter for 28 days. In addition to serial assessment of vitamin A status, we measured plasma RBP just before and 1, 3, and 6 hours after an intramuscular injection of vitamin A (2000 IU/kg retinyl palmitate) on days 1 and 28. The percent increase in plasma RBP (delta-RBP) was high (mean +/- SD: 61 +/- 37%) and plasma vitamin A and RBP values were low on day 1, indicative of vitamin A deficiency. Supplemental vitamin A improved vitamin A status of all infants as shown by low delta-RBP (mean +/- SD: 8 +/- 9%) and normal plasma vitamin A and RBP values on day 28. Bronchopulmonary dysplasia was diagnosed in 12 of 24 infants. Infants with bronchopulmonary dysplasia had a higher mean (+/- SD) delta-RBP on day 28 than those without bronchopulmonary dysplasia (13 +/- 10% vs 3 +/- 3%, p less than 0.01), indicative of persistence of low vitamin A status in infants with lung disease despite supplementation. We conclude that the plasma RBP response to vitamin A is a useful indicator of vitamin A status in very low birth weight infants. Although vitamin A supplementation at the dosage used in this study normalizes conventional plasma indexes of vitamin A in very low birth weight infants, the plasma RBP response to vitamin A may continue to reflect persistence of low vitamin A status in the more immature infants with significant lung disease. We suggest that the plasma RBP response to vitamin A may be a useful functional test in such infants.

Effect of spironolactone-hydrochlorothiazide on lung function in infants with chronic bronchopulmonary dysplasia.

To test the hypothesis that spironolactone-hydrochlorothiazide (Aldactazide) will improve urine output and lung function in infants with bronchopulmonary dysplasia, we studied 21 hospitalized, spontaneously breathing, oxygen-dependent infants with chronic bronchopulmonary dysplasia. Infants were randomly assigned to receive either a 1:1 mixture of spironolactone and hydrochlorothiazide orally (n = 12) (3 mg/kg/day of both compounds) or no treatment (n = 9) for 6 to 8 days each. Dynamic lung compliance, total pulmonary resistance, and hemoglobin oxygen saturation were measured on the first and last days of each study period. Fluid intake and urine output were measured each day. Although the treatment significantly increased urine output, neither lung mechanics nor oxygenation were improved by the drug. The magnitude of the diuresis achieved with spironolactone-hydrochlorothiazide treatment was comparable to the diuresis achieved in a previous study of furosemide treatment (J Pediatr 1986:109;1034-9). Statistical analysis indicated that a type II error was an unlikely explanation for our failure to detect a beneficial effect. In three patients, doubling the oral dose did not improve lung mechanics or oxygenation. We speculate that diuresis per se is not responsible for lung function improvement during treatment with other drugs with diuretic properties.