Primary arthrodesis versus open reduction and internal fixation following intra-articular calcaneal fractures: a weight-bearing CT analysis.

PURPOSE: To compare primary arthrodesis (PA) versus open reduction and internal fixation (ORIF) in displaced intra-articular calcaneal fractures (DIACFs), based on clinical outcome and 2D and 3D geometrical analyses obtained from weight-bearing (WB) cone-beam CT images. MATERIALS AND METHODS: In this prospective study, 40 patients with surgically treated calcaneal fractures were included, consisting of 20 PA and 20 ORIF patients. Weight-bearing cone-beam CT-images of the left and right hindfoot and forefoot were acquired on a Planmed Verity cone-beam CT-scanner after a minimum of 1-year follow-up. Automated 2D and 3D geometric analyses, i.e., (minimal and average) talo-navicular joint space, calcaneal pitch (CP), and Meary's angle (MA), were obtained for injured and healthy feet. Clinical outcomes were measured using the EQ5D and FFI questionnaires. RESULTS: Overall, there were no differences in baseline patient characteristics apart from age (p < 0.005). The calcaneal pitch in 2D after treatment by ORIF (13.8° ± 5.6) was closer to the uninjured side (18.1° ± 5.5) compared to PA (10.9° ± 4.5) (p < 0.001). Meary's angle in 2D was closer to the uninjured side (8.7° ± 6.3) after surgery in the PA cohort (7.0° ± 5.8) compared to the ORIF cohort (15.5° ± 5.9) (p = 0.046). In 3D measurements, CP was significantly decreased for both cohorts after surgery (- 4.09° ± 6.2) (p = 0.001). MA was not significantly affected overall or between cohorts in 3D. Clinical outcomes were not significantly different between the ORIF and PA cohorts. None of the radiographic measurements in 2D or 3D correlated with any of the clinical outcomes studied. CONCLUSION: Three-dimensional WB CT imaging enables functional 2D and 3D analyses under natural load in patients with complex calcaneal fractures. Based on clinical outcome, both PA and ORIF appear viable treatment options. Clinical correlation with geometrical outcomes remains to be established.

Cost-effectiveness of on-demand removal of syndesmotic screws.

PURPOSE: Syndesmotic screw removal following acute syndesmotic injury is a commonly performed procedure. However, recent studies suggest that the removal does not result in improved patient reported outcome, while the procedure has proved not to be without complications. The aim of this study was to present a health-economic evaluation of on-demand removal (ODR) compared to routine removal (RR) of the syndesmotic screw. METHODS: Data were collected from the RODEO trial, a randomized controlled non-inferiority trial comparing functional outcome of ODR with RR. Economic evaluation resulted in total costs, costs (in Euro) per quality adjusted life year (QALY) and costs per point improvement on the Olerud Molander Ankle Score (OMAS). This included both direct and indirect costs. RESULTS: Total costs for ODR were significantly lower with a mean difference of 3160 euro compared to RR (p < 0.001). The difference in QALY was not significant. The difference in OMAS at 12 months was 1.79 with an incremental cost-effectiveness ratio (ICER) of €-1763 (p = 0.512). The ICER was well below the willingness to pay. Although unit costs might vary between hospitals and countries, these results provide relevant data of cost-effectiveness. CONCLUSION: The clinical effectiveness of both ODR and RR can be considered equal. The costs are lower for patients treated with ODR, which leads to the conclusion that ODR is cost-effective.

Brachytherapy in paediatric craniopharyngiomas: a systematic review and meta-analysis of recent literature.

PURPOSES: Brachytherapy has been indicated as an alternative option for treating cystic craniopharyngiomas. Despite the difficulties regarding the complex nuclear infrastructure and consequent small number of brachytherapy studies, recent discoveries relating tumour characteristics to sensitivity to brachytherapy have stimulated this extensive systematic review and meta-analysis of the recent results aiming to summarise its efficacy and complications. METHODS: The systematic review was structured using PRISMA statements. The MEDLINE database was systematically reviewed from March 2010 to February 2021 to identify qualified trials dealing with radioisotope brachytherapy in cystic craniopharyngiomas in the paediatric population, emphasising tumour control rates and complications. RESULTS: A total of 228 individuals were analysed, of which 66 were children. The minimum average follow-up was 5 years. Considering the paediatric trials, partial and complete responses were achieved in 89% of patients with exclusively cystic lesions, compared to 58% in non-exclusively cystic lesions. The former observed progression in 3% of patients, while in the latter, 35% was reported. Visual and endocrine improvement reached 64% and 20%, respectively, in the first group, in contrast to 48% and 7% in the second group, respectively. There were similar results considering the non-exclusive paediatric series, but with less expressive numbers. CONCLUSION: These results reinforce the positive impact of radioisotope brachytherapy in the treatment of predominant monocystic or multicystic craniopharyngiomas, especially in the paediatric population, grounded by impressive tumour control rates, lower morbidities and single application in the majority of the cases. In the future, specific morphological tumour characteristics might be considered for a more assertive patient selection.

Correction to: Routine versus on demand removal of the syndesmotic screw; a protocol for an international randomised controlled trial (RODEO-trial).

An amendment to this paper has been published and can be accessed via the original article.

Risk factors for surgical site infections with the Sinus Tarsi Approach in displaced intra-articular calcaneal fractures; a prospective cohort study with a minimum of one year follow-up.

BACKGROUND: In the last decade, the sinus tarsi approach (STA) has gained interest over the extensile lateral approach (ELA) in the operative treatment of displaced intra-articular calcaneal fractures (DIACF's), mainly because of the lower rate of surgical site infections (SSIs). However, most studies are small and retrospective. The aim of this study was to evaluate the rate of SSIs of the STA in a large, prospective series of patients and to identify predictors for SSIs. METHODS: In this prospective cohort study, all consecutive patients who were operatively treated for a DIACF in our Level 1 trauma center between August 2012 and January 2019 were included and followed for at least one year. All operative procedures were performed by two specialized foot and ankle trauma surgeons using the STA. Using multinomial logistic regression, risk factors for SSIs were identified. RESULTS: A total of 237 calcaneal fractures in 214 patients were included, of which 179 underwent open reduction and internal fixation and 58 a primary arthrodesis. Most patients were male (73.6%) and the mean age was 45.9 years. There were 16 patients that developed a SSI (6.8%), of which 9 (3.8%) were deep and 7 (3%) were superficial infections. The multivariate analysis pointed out that surgery within one week after injury increased the chance of a SSI, as well as an ASA of 2 or higher and more than 150 cc of blood loss during the procedure. CONCLUSION: This study confirms the low risk of SSI in DIACFs treated via STA. Significant predictors for SSIs were surgery within one week after injury, ASA of 2 or higher and blood loss > 150cc.

Recurrence after totally extraperitoneal (TEP) inguinal hernia repair: the role of physical examination and ultrasound.

PURPOSE: Physical examination (PE) combined with ultrasound (US) is recommended to confirm a recurrent hernia. However, the evidence is rather weak. The aim of this study was to evaluate PE and appraise the added value of US in alleged recurrent inguinal hernias after totally extraperitoneal (TEP) inguinal hernia repair. METHODS: All adult patients who were re-operated for suspicion of a recurrent hernia after a primary unilateral or bilateral TEP between 2006 and 2017 were identified and investigated retrospectively. Patient characteristics, PE, additional imaging and intra-operative findings were registered. PE outcomes were compared with intra-operative findings to calculate the positive predictive value (PPV) of PE. In case of clinical doubt, the added value of US was evaluated by comparing US findings with the intra-operative findings. RESULTS: A total of 130 patients were re-operated for suspicion of 137 recurrent hernias. In 75 patients, US was performed. PE was positive for an inguinal hernia in 101 groins (73.7%), negative in 30 (21.9%) and inconclusive in 6 (4.4%). PE matched the operative findings in 75.2%. The PPV of diagnosing a recurrent hernia (or lipoma) on PE was 97%. In case of clinical doubt (n = 36), positive US matched the operative findings in 20 cases (87.0%). CONCLUSION: US does not necessarily need to be incorporated in the standard diagnostic workup of a recurrent inguinal hernia. After PE alone, a recurrent hernia (or lipoma) can be diagnosed with a PPV of 97%. Only in case of clinical doubt, US has additional value.

Rapid Access to Contrast-Enhanced spectral mammogRaphy in women recalled from breast cancer screening: the RACER trial study design.

BACKGROUND: In the Dutch breast cancer screening program, women recalled with a BI-RADS 0 score are referred for additional imaging, while those with BI-RADS 4/5 scores are also directed to an outpatient breast clinic. Approximately six out of ten women are recalled without being diagnosed with a malignancy. However, these recalls require additional imaging and doctor visits, which result in patient anxiety and increased health care costs. Conventional types of imaging used for additional imaging are full-field digital mammography and tomosynthesis. Contrast-enhanced spectral mammography has proved to have higher sensitivity and specificity than conventional imaging in women recalled from screening. Therefore, the aim is to study if CESM instead of conventional imaging is a more accurate, patient-friendly, and cost-effective strategy in the work-up of women recalled from breast cancer screening. METHODS: This prospective, multicenter, randomized controlled trial will be conducted at four centers and will include 528 patients recalled for suspicious breast lesions from the Dutch breast cancer screening program. Participants are randomized in two groups: (1) standard care using conventional breast imaging techniques as initial imaging after recall versus (2) work-up primarily based on CESM. Written informed consent will be collected prior to study inclusion. The primary outcome is the diagnostic accuracy for detection of breast cancer. Secondary outcomes are numbers of additional diagnostic exams, days until final diagnosis, health care costs, and experienced patient anxiety. DISCUSSION: Based on previously published retrospective studies, we expect to demonstrate in this prospective multicenter randomized controlled trial, that using CESM as a primary work-up tool in women recalled from breast cancer screening is a more accurate, cost-effective, and patient-friendly strategy. TRIAL REGISTRATION: Netherlands Trial Register, NL6413/NTR6589. Registered on 6 July, 2017.

Functional outcome of implant removal following fracture fixation below the level of the knee: a prospective cohort study.

AIMS: The aim of this study was to evaluate the functional outcome in patients undergoing implant removal (IR) after fracture fixation below the level of the knee. PATIENTS AND METHODS: All adult patients (18 to 75 years) undergoing IR after fracture fixation below the level of the knee between November 2014 and September 2016 were included as part of the WIFI (Wound Infections Following Implant Removal Below the Knee) trial, performed in 17 teaching hospitals and two university hospitals in The Netherlands. In this multicentre prospective cohort, the primary outcome was the difference in functional status before and after IR, measured by the Lower Extremity Functional Scale (LEFS), with a minimal clinically important difference of nine points. RESULTS: A total of 179 patients were included with a median age of 50 years (interquartile range (IQR) 37 to 60), of whom 71 patients (39.7%) were male. With a median score of 60 before IR (IQR 45 to 72) and 66 after IR (IQR 51 to 76) on the LEFS, there was a statistically significant improvement in functional outcome (p < 0 .001). A total of 31 surgical site infections (17.3%) occurred. CONCLUSION: Although IR led to a statistically significant improvement of functional outcome, the minimal clinically important difference was not reached. In conclusion, this study shows that IR does not result in a clinically relevant improvement in functional outcome. These results, in combination with the high complication rate, highlight the importance of carefully reviewing the indication for IR. Cite this article: Bone Joint J 2019;101-B:447-453.

Elastic compression stockings one year after DVT diagnosis: Who might discontinue?

BACKGROUND: Elastic compression stockings (ECS) are uncomfortable to wear but may prevent post-thrombotic syndrome (PTS). The ability to predict PTS may help clinical decision making regarding the optimal duration of ECS after deep vein thrombosis (DVT). AIMS: Predefined endpoint analysis of the Octavia study that randomized patients who compliantly used ECS up to one year after DVT to continue or discontinue ECS treatment. Primary aim was to identify predictors of PTS. METHODS: Patient characteristics were collected and ultrasonography was performed to assess reflux, residual thrombosis and persistent thrombus load 12 months after DVT. Multivariable analyses were performed to identify factors related to PTS. RESULTS: Thrombus score ≥ 3, BMI ≥ 26, duration of symptoms before DVT diagnosis ≥ 8 days and a Villalta score of 2-4 points were statistically significant predictors of PTS. The predictive value for PTS for the assessed variables was not different between the 2 treatment groups. In the stop ECS group, 3.2% (95%CI 0.08-18) of patients without any predictors for PTS were diagnosed with mild PTS during follow-up, and none with severe PTS, for a sensitivity of 98% (95% CI 89-100), a specificity of 14% (95% CI 10-20), a positive predictive value of 20% (95% CI 19-22), and a negative predictive value of 97% (95% CI 81-100). CONCLUSION: We identified 4 predictors of PTS occurring in the 2nd year after DVT. Our findings may be used to decide on whether to continue ECS treatment for an additional year, after one year of compliant ECS use, keeping in mind that patients with none of the predictors will have the lowest PTS incidence.

Athletes with inguinal disruption benefit from endoscopic totally extraperitoneal (TEP) repair.

PURPOSE: Inguinal disruption, a common condition in athletes, is a diagnostic and therapeutic challenge. The aim of this study was to evaluate the effect of endoscopic totally extraperitoneal (TEP) repair in athletes with inguinal disruption, selected through a multidisciplinary, systematic work-up. METHODS: An observational, prospective cohort study was conducted in 32 athletes with inguinal disruption. Athletes were assessed by a sports medicine physician, radiologist and hernia surgeon and underwent subsequent endoscopic TEP repair with placement of polypropylene mesh. The primary outcome was pain reduction during exercise on the numeric rating scale (NRS) 3 months postoperatively. Secondary outcomes were sports resumption, physical functioning and long-term pain intensity. Patients were assessed preoperatively, 3 months postoperatively and after a median follow-up of 19 months. RESULTS: Follow-up was completed in 30 patients (94%). The median pain score decreased from 8 [interquartile range (IQR) 7-8] preoperatively to 2 (IQR 0-5) 3 months postoperatively (p < 0.001). At long-term follow-up, the median pain score was 0 (IQR 0-3) (p < 0.001). At 3 months, 60% of patients were able to complete a full training and match. The median intensity of sport was 50% (IQR 20-70) preoperatively, 95% (IQR 70-100) 3 months postoperatively (p < 0.001), and 100% (IQR 90-100) at long-term follow-up (p < 0.001). The median frequency of sport was 4 (IQR 3-5) times per week before development of symptoms and 3 (IQR 3-4) times per week 3 months postoperatively (p = 0.025). Three months postoperatively, improvement was shown on all physical functioning subscales. CONCLUSIONS: Athletes with inguinal disruption, selected through a multidisciplinary, systematic work-up, benefit from TEP repair.

Routine versus on demand removal of the syndesmotic screw; a protocol for an international randomised controlled trial (RODEO-trial).

BACKGROUND: Syndesmotic injuries are common and their incidence is rising. In case of surgical fixation of the syndesmosis a metal syndesmotic screw is used most often. It is however unclear whether this screw needs to be removed routinely after the syndesmosis has healed. Traditionally the screw is removed after six to 12 weeks as it is thought to hamper ankle functional and to be a source of pain. Some studies however suggest this is only the case in a minority of patients. We therefore aim to investigate the effect of retaining the syndesmotic screw on functional outcome. DESIGN: This is a pragmatic international multicentre randomised controlled trial in patients with an acute syndesmotic injury for which a metallic syndesmotic screw was placed. Patients will be randomised to either routine removal of the syndesmotic screw or removal on demand. Primary outcome is functional recovery at 12 months measured with the Olerud-Molander Score. Secondary outcomes are quality of life, pain and costs. In total 194 patients will be needed to demonstrate non-inferiority between the two interventions at 80% power and a significance level of 0.025 including 15% loss to follow-up. DISCUSSION: If removal on demand of the syndesmotic screw is non-inferior to routine removal in terms of functional outcome, this will offer a strong argument to adopt this as standard practice of care. This means that patients will not have to undergo a secondary procedure, leading to less complications and subsequent lower costs. TRIAL REGISTRATION: This study was registered at the Netherlands Trial Register (NTR5965), Clinicaltrials.gov ( NCT02896998 ) on July 15th 2016.

[A painful right knee after a motorcycle accident]. / Een man met een pijnlijke knie na een motorongeval.

A 48-year-old male presented with a painful right knee after a motorcycle accident. Peripheral pulsations in the lower right leg were absent. X-ray indicated a dislocation of the knee. Additional CT-scan revealed a dissection of the popliteal artery. Surgical exploration revealed extensive vascular, neurological and ligamentar damage.

One versus two years of elastic compression stockings for prevention of post-thrombotic syndrome (OCTAVIA study): randomised controlled trial.

OBJECTIVE:  To study whether stopping elastic compression stockings (ECS) after 12 months is non-inferior to continuing them for 24 months after proximal deep venous thrombosis. DESIGN:  Multicentre single blind non-inferiority randomised controlled trial. SETTING:  Outpatient clinics in eight teaching hospitals in the Netherlands, including one university medical centre. PARTICIPANTS:  Patients compliant with compression therapy for 12 months after symptomatic, ultrasound proven proximal deep venous thrombosis of the leg. INTERVENTIONS:  Continuation or cessation of ECS 12 months after deep venous thrombosis. MAIN OUTCOME MEASURES:  The primary outcome was the incidence of post-thrombotic syndrome 24 months after diagnosis of deep venous thrombosis, as assessed by the standardised Villalta scale in an intention to treat analysis. The predefined non-inferiority margin was 10%. The main secondary outcome was quality of life (VEINES-QOL/Sym). RESULTS:  518 patients compliant with ECS and free of post-thrombotic syndrome were randomised one year after diagnosis of deep venous thrombosis to stop or continue ECS therapy for another year. In the stop-ECS group, 51 of 256 patients developed post-thrombotic syndrome, with an incidence of 19.9% (95% confidence interval 16% to 24%). In the continue-ECS group, 34 of 262 patients developed post-thrombotic syndrome (incidence 13.0%, 9.9% to 17%), of whom 85% used ECS six or seven days a week during the study period, for an absolute difference of 6.9% (95% confidence interval upper limit 12.3%). Because the upper limit of the 95% confidence interval exceeds the predefined margin of 10%, non-inferiority was not reached. The number needed to treat to prevent one case of post-thrombotic syndrome by continuing ECS was 14 (95% confidence interval lower limit 8). Quality of life did not differ between the two groups. CONCLUSION:  Stopping ECS after one year in compliant patients with proximal deep venous thrombosis seemed not to be non-inferior to continuing ECS therapy for two years in this non-inferiority trial. TRIAL REGISTRATION:  Netherlands Trial Register NTR1442.

Endoscopic totally extraperitoneal (TEP) hernia repair for inguinal disruption (Sportsman's hernia): rationale and design of a prospective observational cohort study (TEP-ID-study).

INTRODUCTION: Chronic inguinal pain is a frequently occurring problem in athletes. A diagnosis of inguinal disruption is performed by exclusion of other conditions causing groin pain. Up to now, conservative medical management is considered to be the primary treatment for this condition. Relevant large and prospective clinical studies regarding the treatment of inguinal disruption are limited; however, recent studies have shown the benefits of the totally extraperitoneal patch (TEP) technique.This study provides a complete assessment of the inguinal area in athletes with chronic inguinal pain before and after treatment with the TEP hernia repair technique. METHODS AND ANALYSIS: We describe the rationale and design of an observational cohort study for surgical treatment with the endoscopic TEP hernia repair technique in athletes with a painful groin (inguinal disruption).The study is being conducted in a high-volume, single centre hospital with specialty in TEP hernia repair. Patients over 18 years, suffering from inguinal pain for at least 3 months during or after playing sports, and whom have not undergone previous inguinal surgery and have received no benefit from physiotherapy are eligible for inclusion. Patients with any another cause of inguinal pain, proven by physical examination, inguinal ultrasound, X-pelvis/hip or MRI are excluded.Primary outcome is reduction in pain after 3 months. Secondary outcomes are pain reduction, physical functioning, and resumption of sport (in frequency and intensity). ETHICS AND DISSEMINATION: An unrestricted research grant for general study purposes was assigned to the Hernia Centre. This study itself is not directly subject to the above mentioned research grant or any other financial sponsorship. We intend to publish the outcome of the study, regardless of the findings. All authors will give final approval of the manuscript version to be published.

Chronic pain after TEP inguinal hernia repair, does MRI reveal a cause?

PURPOSE: Persistent pain is a known side effect after TEP inguinal repair disabling 2-5% of patients. A standardized diagnostic work-up so far is not available. MRI is a diagnostic tool in the work-up of inguinal hernias. In the present study the yield of MRI in evaluating chronic pain after TEP hernia repair is addressed. METHODS: In our database patients receiving an MRI scan for groin pain lasting more than 3 months after TEP inguinal hernia repair were identified. A checklist with potential pathologic findings was filled out for each groin by two blinded observers. Findings in painful, pain-free and unoperated groins were compared and statistical analysis done based upon their relative incidences. Cohen's kappa coefficients were calculated to determine interobserver agreement. RESULTS: Imaging studies of 53 patients revealed information regarding 106 groins. Fifty-five groins were painful after the initial operation, 12 were pain-free postoperatively and 39 groins were not operated. None of the predefined disorders was observed statistically more often in the patients with painful groins. Only fibrosis appeared more prevalent in patients with chronic pain (P = 0.11). Interobserver agreement was excellent for identifying the mesh (κ = 0.88) and observing bulging or a hernia (κ = 0.74) and was substantial for detecting fibrosis (κ = 0.63). In 40% of the patients, MRI showed a correct mesh position and observed nothing else than minor fibrosis. A wait and see policy resolved complaints in the majority of the patients. In 15 % of the patients, MRI revealed treatable findings explanatory for persisting groin pain. CONCLUSION: For patients with post-TEP hernia groin pain, MRI is useful to confirm a correct flat mesh position and to identify possible not operation-related causes of groin pain. It is of little help to identify a specific cause of groin repair-related pain.

First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States.

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5'AGGCCCTGGAAGGTGCCCTGGA3') and RST3 (5'ATCGCACTGCGTACCGCGCGCGA3') in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

[Frontotemporal dementia and schizophrenia in later life: a comparison of executive and general cognitive functioning]. / Frontotemporale dementie en schizofrenie op oudere leeftijd: een verkenning van executief en globaal cognitief functioneren.

BACKGROUND: Frontotemporal dementia (FTD) is characterised clinically by progressive changes in behaviour and personality; these changes are followed by cognitive disorder. FTD needs to be differentiated from other forms of dementia and from psychiatric conditions such as schizophrenia. Both FTD and schizophrenia lead to cognitive disorders and particularly to executive impairments. AIM: To compare executive and general cognitive functioning in patients with FTD and in patients with schizophrenia in later life. METHOD: As cognitive screening instruments we used the 'Frontal Assessment Battery' (FAB) and the 'Mini-Mental State Examination' (MMSE). The FAB en MMSE test results (retrieved from the database of the Alzheimer centre of the VU medical centre) for 25 outpatients diagnosed as having FTD were compared with the test results (retrieved from the 'SOUL' study database) for 31 elderly schizophrenia patients. RESULTS: In both the fab and the MMSE tests the scores for the patients with FTD were significantly lower than the scores for the patients with schizophrenia. CONCLUSION: Our study suggests that, despite the clinical similarities, there are differences between patients with FTD and elderly patients with schizophrenia with regard to executive and general cognitive functioning. Further studies are needed in order to differentiate between the two illnesses.

First Report of Pantoea agglomerans Causing a Leaf Blight and Bulb Rot of Onions in Georgia.

In April 2006, sweet onions (Allium cepa) that were grown in Wayne County, GA displayed symptoms typical of either center rot caused by Pantoea ananatis or a foliar blight caused by Iris yellow spot virus (IYSV). After samples tested negative for IYSV by enzyme-linked immunosorbent assay and polymerase chain reaction, isolations were made from basal areas of leaves of infected plants where healthy and diseased tissues converged. All samples yielded yellow colonies on trypticase soy broth agar (TSBA) that were nonfluorescent when transferred to King's medium B. Four strains were characterized and tentatively identified as a Pantoea sp. by yellow pigmentation of colonies, oxidative and fermentative use of glucose, and lack of oxidase. However, the inability to produce indole from tryptophan, negative ice-nucleation activity, ability to reduce nitrate to nitrite, and the presence of phenylalanine deaminase were characteristics more typical of P. agglomerans than P. ananatis. Furthermore, all test strains utilized cellobiose, raffinose, lactose, gelatin, melibiose, and malonate. The identity of the bacterium was confirmed as P. agglomerans by BIOLOG (Hayward, CA). In addition, the 16S gene was amplified using universal primers (forward 5'-AGTTTGATCCTGGCTCAG-3' and reverse 5'-TACCTTGTTACGACTTCGTCCCA-3' (1) and sequenced. A BLAST search of the sequence against the NIH GenBank nucleotide library also confirmed the identity of the onion pathogen as P. agglomerans (97% identity) by having 8 of the top 10 bacteria providing significant alignments identified as P. agglomerans. The remaining two matches were uncultured bacteria from environmental samples. To confirm pathogenicity, two onion plants for each of the four test strains were inoculated with a turbid, aqueous bacterial suspension (~1 × 108 CFU ml-1) or sterile water in the lab (n = 8) and the field (n = 8). In addition, two plants each were inoculated with P. ananatis as a positive control and with a water blank and a nonpathogenic strain of P. agglomerans from peach (Png 86-2) as negative controls. All test strains of P. agglomerans produced severe blighting and withering of onion leaves in 4 days, while the water control and Png 86-2 were negative. Results were the same for both lab and field trials. Bacteria recovered from the plants infected with the test strains demonstrated the same characteristics of P. agglomerans as described above. Although P. agglomerans was originally reported as a pathogen of onion in South Africa (2), to the best of our knowledge, this is the first report of P. agglomerans causing a disease of onions in the United States. The long-term impact on the onion industry at this time is unknown. However, considering the close relationship of this organism with P. ananatis and the similarity of disease symptoms with those caused by center rot, there is potential that this bacterium could become established in the onion-growing area of Georgia and become part of a center rot 'complex'. References: (1) T. De Baere et al. J. Clin. Microbiol. 42:4393, 2004. (2) M. J. Hattingh and D. F. Walters. Plant Dis. 65:615, 1981.