Human neurotropic polyomavirus, JC virus, late coding region encodes a novel nuclear protein, ORF4, which targets the promyelocytic leukemia nuclear bodies (PML-NBs) and modulates their reorganization.

We previously reported the discovery and characterization of two novel proteins (ORF1 and ORF2) generated by the alternative splicing of the JC virus (JCV) late coding region. Here, we report the discovery and partial characterization of three additional novel ORFs from the same coding region, ORF3, ORF4 and ORF5, which potentially encode 70, 173 and 265 amino acid long proteins respectively. While ORF3 protein exhibits a uniform distribution pattern throughout the cells, we were unable to detect ORF5 expression. Surprisingly, ORF4 protein was determined to be the only JCV protein specifically targeting the promyelocytic leukemia nuclear bodies (PML-NBs) and inducing their reorganization in nucleus. Although ORF4 protein has a modest effect on JCV replication, it is implicated to play major roles during the JCV life cycle, perhaps by regulating the antiviral response of PML-NBs against JCV infections and thus facilitating the progression of the JCV-induced disease in infected individuals.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

A comprehensive proteomics analysis of JC virus Agnoprotein-interacting proteins: Agnoprotein primarily targets the host proteins with coiled-coil motifs.

JC virus (JCV) Agnoprotein (Agno) plays critical roles in successful completion of the viral replication cycle. Understanding its regulatory roles requires a complete map of JCV-host protein interactions. Here, we report the first Agno interactome with host cellular targets utilizing "Two-Strep-Tag" affinity purification system coupled with mass spectroscopy (AP/MS). Proteomics data revealed that Agno primarily targets 501 cellular proteins, most of which contain "coiled-coil" motifs. Agno-host interactions occur in several cellular networks including those involved in protein synthesis and degradation; and cellular transport; and in organelles, including mitochondria, nucleus and ER-Golgi network. Among the Agno interactions, Rab11B, Importin and Crm-1 were first validated biochemically and further characterization was done for Crm-1, using a HIV-1 Rev-M10-like Agno mutant (L33D + E34L), revealing the critical roles of L33 and E34 residues in Crm-1 interaction. This comprehensive proteomics data provides new foundations to unravel the critical regulatory roles of Agno during the JCV life cycle.

Expression of novel proteins by polyomaviruses and recent advances in the structural and functional features of agnoprotein of JC virus, BK virus, and simian virus 40.

Polyomavirus family consists of a highly diverse group of small DNA viruses. The founding family member (MPyV) was first discovered in the newborn mouse in the late 1950s, which induces solid tumors in a wide variety of tissue types that are the epithelial and mesenchymal origin. Later, other family members were also isolated from a number of mammalian, avian and fish species. Some of these viruses significantly contributed to our current understanding of the fundamentals of modern biology such as transcription, replication, splicing, RNA editing, and cell transformation. After the discovery of first two human polyomaviruses (JC virus [JCV] and BK virus [BKV]) in the early 1970s, there has been a rapid expansion in the number of human polyomaviruses in recent years due to the availability of the new technologies and brought the present number to 14. Some of the human polyomaviruses cause considerably serious human diseases, including progressive multifocal leukoencephalopathy, polyomavirus-associated nephropathy, Merkel cell carcinoma, and trichodysplasia spinulosa. Emerging evidence suggests that the expression of the polyomavirus genome is more complex than previously thought. In addition to encoding universally expressed regulatory and structural proteins (LT-Ag, Sm t-Ag, VP1, VP2, and VP3), some polyomaviruses express additional virus-specific regulatory proteins and microRNAs. This review summarizes the recent advances in polyomavirus genome expression with respect to the new viral proteins and microRNAs other than the universally expressed ones. In addition, a special emphasis is devoted to the recent structural and functional discoveries in the field of polyomavirus agnoprotein which is expressed only by JCV, BKV, and simian virus 40 genomes.

Structure-based release analysis of the JC virus agnoprotein regions: A role for the hydrophilic surface of the major alpha helix domain in release.

Agnoprotein (Agno) is an important regulatory protein of JC virus (JCV), BK virus (BKV) and simian virus 40 (SV40) and these viruses are unable to replicate efficiently in the absence of this protein. Recent 3D-NMR structural data revealed that Agno contains two alpha-helices (a minor and a major) while the rest of the protein adopts an unstructured conformation (Coric et al., 2017, J Cell Biochem). Previously, release of the JCV Agno from the Agno-positive cells was reported. Here, we have further mapped the regions of Agno responsible for its release by a structure-based systematic mutagenesis approach. Results revealed that amino acid residues (Lys22, Lys23, Phe31, Glu34, and Asp38) located either on or adjacent to the hydrophilic surface of the major alpha-helix domain of Agno play critical roles in release. Additionally, Agno was shown to strongly interact with unidentified components of the cell surface when cells are treated with Agno, suggesting additional novel roles for Agno during the viral infection cycle.

Discovery and characterization of novel trans-spliced products of human polyoma JC virus late transcripts from PML patients.

Although the human neurotropic polyomavirus, JC virus (JCV), was isolated almost a half century ago, understanding the molecular mechanisms governing its biology remains highly elusive. JCV infects oligodendrocytes and astrocytes in the central nervous system (CNS) and causes a rare fatal brain disease known as progressive multifocal leukoencephalopathy (PML) in immunocompromised individuals including AIDS. It has a small circular DNA genome (∼5 kb) and generates two primary transcripts from its early and late coding regions, producing several predicted alternatively spliced products mainly by cis-splicing. Here, we report the discovery and characterization of two novel open reading frames (ORF1 and ORF2) associated with JCV late transcripts, generated by an unusual splicing process called trans-splicing. These ORFs result from (i) the trans-splicing of two different lengths of the 5'-short coding region of VP1 between the coding regions of agnoprotein and VP2 after replacing the intron located between these two coding regions and (ii) frame-shifts occurring within the VP2 coding sequences terminated by a stop codon. ORF1 and ORF2 are capable of encoding 58 and 72 aa long proteins respectively and are expressed in infected cells and PML patients. Each ORF protein shares a common coding region with VP1 and has a unique coding sequence of their own. When the expression of the unique coding regions of ORFs is blocked by a stop codon insertion in the viral background, the mutant virus replicates less efficiently when compared to wild-type, suggesting that the newly discovered ORFs play critical roles in the JCV life cycle.

Nuclear Magnetic Resonance Structure of the Human Polyoma JC Virus Agnoprotein.

Agnoprotein is an important regulatory protein of the human polyoma JC virus (JCV) and plays critical roles during the viral replication cycle. It forms highly stable dimers and oligomers through its Leu/Ile/Phe-rich domain, which is important for the stability and function of the protein. We recently resolved the partial 3D structure of this protein by NMR using a synthetic peptide encompassing amino acids Thr17 to Gln52, where the Leu/Ile/Phe- rich region was found to adopt a major alpha-helix conformation spanning amino acids 23-39. Here, we report the resolution of the 3D structure of full-length JCV agnoprotein by NMR, which not only confirmed the existence of the previously reported major α-helix domain at the same position but also revealed the presence of an additional minor α-helix region spanning amino acid residues Leu6 to lys13. The remaining regions of the protein adopt an intrinsically unstructured conformation. J. Cell. Biochem. 118: 3268-3280, 2017. © 2017 Wiley Periodicals, Inc.

Emerging From the Unknown: Structural and Functional Features of Agnoprotein of Polyomaviruses.

Agnoprotein is an important regulatory protein of polyomaviruses, including JCV, BKV, and SV40. In the absence of its expression, these viruses are unable to sustain their productive life cycle. It is a highly basic phosphoprotein that localizes mostly to the perinuclear area of infected cells, although a small amount of the protein is also found in nucleus. Much has been learned about the structure and function of this important regulatory protein in recent years. It forms highly stable dimers/oligomers in vitro and in vivo through its Leu/Ile/Phe-rich domain. Structural NMR studies revealed that this domain adopts an alpha-helix conformation and plays a critical role in the stability of the protein. It associates with cellular proteins, including YB-1, p53, Ku70, FEZ1, HP1α, PP2A, AP-3, PCNA, and α-SNAP; and viral proteins, including small t antigen, large T antigen, HIV-1 Tat, and JCV VP1; and significantly contributes the viral transcription and replication. This review summarizes the recent advances in the structural and functional properties of this important regulatory protein. J. Cell. Physiol. 231: 2115-2127, 2016. © 2016 Wiley Periodicals, Inc.

Dysregulation of autophagy by HIV-1 Nef in human astrocytes.

Viruses often exploit autophagy, a common cellular process of degradation of damaged proteins, organelles, and pathogens, to avoid destruction. HIV-1 dysregulates this process in several cell types by means of Nef protein. Nef is a small HIV-1 protein which is expressed abundantly in astrocytes of HIV-1-infected brains and has been suggested to have a role in the pathogenesis of HIV-Associated Neurocognitive Disorders (HAND). In order to explore its effect in the CNS with respect to autophagy, HIV-1 Nef was expressed in primary human fetal astrocytes (PHFA) using an adenovirus vector (Ad-Nef). We observed that Nef expression triggered the accumulation of autophagy markers, ATG8/LC3 and p62 (SQSMT1). Similar results were obtained with Bafilomycin A1, an autophagy inhibitor which blocks the fusion of autophagosome to lysosome. Furthermore co-expression of tandem LC3 vector (mRFP-EGFP-LC3) and Ad-Nef in these cells produced mainly yellow puncta (mRFP+, EGFP+) strongly suggesting that autophagosome fusion to lysosome is blocked in PHFA cells in the presence of Nef. Together these data indicate that HIV-1 Nef mimics Bafilomycin A1 and blocks the last step of autophagy thereby helping HIV-1 virus to avoid autophagic degradation in human astrocytes.

WW domain of BAG3 is required for the induction of autophagy in glioma cells.

Autophagy is an evolutionarily conserved, selective degradation pathway of cellular components that is important for cell homeostasis under healthy and pathologic conditions. Here we demonstrate that an increase in the level of BAG3 results in stimulation of autophagy in glioblastoma cells. BAG3 is a member of a co-chaperone family of proteins that associates with Hsp70 through a conserved BAG domain positioned near the C-terminus of the protein. Expression of BAG3 is induced by a variety of environmental changes that cause stress to cells. Our results show that BAG3 overexpression induces autophagy in glioma cells. Interestingly, inhibition of the proteasome caused an increase in BAG3 levels and induced autophagy. Further analysis using specific siRNA against BAG3 suggests that autophagic activation due to proteosomal inhibition is mediated by BAG3. Analyses of BAG3 domain mutants suggest that the WW domain of BAG3 is crucial for the induction of autophagy. BAG3 overexpression also increased the interaction between Bcl2 and Beclin-1, instead of disrupting them, suggesting that BAG3 induced autophagy is Beclin-1 independent. These observations reveal a novel role for the WW domain of BAG3 in the regulation of autophagy.

Nuclear magnetic resonance structure revealed that the human polyomavirus JC virus agnoprotein contains an α-helix encompassing the Leu/Ile/Phe-rich domain.

UNLABELLED: Agnoprotein is a small multifunctional regulatory protein required for sustaining the productive replication of JC virus (JCV). It is a mostly cytoplasmic protein localizing in the perinuclear area and forms highly stable dimers/oligomers through a Leu/Ile/Phe-rich domain. There have been no three-dimensional structural data available for agnoprotein due to difficulties associated with the dynamic conversion from monomers to oligomers. Here, we report the first nuclear magnetic resonance (NMR) structure of a synthetic agnoprotein peptide spanning amino acids Thr17 to Glu55 where Lys23 to Phe39 encompassing the Leu/Ile/Phe-rich domain forms an amphipathic α-helix. On the basis of these structural data, a number of Ala substitution mutations were made to investigate the role of the α-helix in the structure and function of agnoprotein. Single L29A and L36A mutations exhibited a significant negative effect on both protein stability and viral replication, whereas the L32A mutation did not. In addition, the L29A mutant displayed a highly nuclear localization pattern, in contrast to the pattern for the wild type (WT). Interestingly, a triple mutant, the L29A+L32A+L36A mutant, yielded no detectable agnoprotein expression, and the replication of this JCV mutant was significantly reduced, suggesting that Leu29 and Leu36 are located at the dimer interface, contributing to the structure and stability of agnoprotein. Two other single mutations, L33A and E34A, did not perturb agnoprotein stability as drastically as that observed with the L29A and L36A mutations, but they negatively affected viral replication, suggesting that the role of these residues is functional rather than structural. Thus, the agnoprotein dimerization domain can be targeted for the development of novel drugs active against JCV infection. IMPORTANCE: Agnoprotein is a small regulatory protein of JC virus (JCV) and is required for the successful completion of the viral replication cycle. It forms highly stable dimers and oligomers through its hydrophobic (Leu/Ile/Phe-rich) domain, which has been shown to play essential roles in the stability and function of the protein. In this work, the Leu/Ile/Phe-rich domain has been further characterized by NMR studies using an agnoprotein peptide spanning amino acids T17 to Q54. Those studies revealed that the dimerization domain of the protein forms an amphipathic α-helix. Subsequent NMR structure-based mutational analysis of the region highlighted the critical importance of certain amino acids within the α-helix for the stability and function of agnoprotein. In conclusion, this study provides a solid foundation for developing effective therapeutic approaches against the dimerization domain of the protein to inhibit its critical roles in JCV infection.

Human polyoma JC virus minor capsid proteins, VP2 and VP3, enhance large T antigen binding to the origin of viral DNA replication: evidence for their involvement in regulation of the viral DNA replication.

JC virus (JCV) lytically infects the oligodendrocytes in the central nervous system in a subset of immunocompromized patients and causes the demyelinating disease, progressive multifocal leukoencephalopathy. JCV replicates and assembles into infectious virions in the nucleus. However, understanding the molecular mechanisms of its virion biogenesis remains elusive. In this report, we have attempted to shed more light on this process by investigating molecular interactions between large T antigen (LT-Ag), Hsp70 and minor capsid proteins, VP2/VP3. We demonstrated that Hsp70 interacts with VP2/VP3 and LT-Ag; and accumulates heavily in the nucleus of the infected cells. We also showed that VP2/VP3 associates with LT-Ag through their DNA binding domains resulting in enhancement in LT-Ag DNA binding to Ori and induction in viral DNA replication. Altogether, our results suggest that VP2/VP3 and Hsp70 actively participate in JCV DNA replication and may play critical roles in coupling of viral DNA replication to virion encapsidation.

JC virus agnoprotein enhances large T antigen binding to the origin of viral DNA replication: evidence for its involvement in viral DNA replication.

Agnoprotein is required for the successful completion of the JC virus (JCV) life cycle and was previously shown to interact with JCV large T-antigen (LT-Ag). Here, we further characterized agnoprotein's involvement in viral DNA replication. Agnoprotein enhances the DNA binding activity of LT-Ag to the viral origin (Ori) without directly interacting with DNA. The predicted amphipathic α-helix of agnoprotein plays a major role in this enhancement. All three phenylalanine (Phe) residues of agnoprotein localize to this α-helix and Phe residues in general are known to play critical roles in protein-protein interaction, protein folding and stability. The functional relevance of all Phe residues was investigated by mutagenesis. When all were mutated to alanine (Ala), the mutant virus (F31AF35AF39A) replicated significantly less efficiently than each individual Phe mutant virus alone, indicating the importance of Phe residues for agnoprotein function. Collectively, these studies indicate a close involvement of agnoprotein in viral DNA replication.

Human polyomavirus JC small regulatory agnoprotein forms highly stable dimers and oligomers: implications for their roles in agnoprotein function.

JC virus (JCV) encodes a small basic phosphoprotein from the late coding region called agnoprotein, which has been shown to play important regulatory roles in the viral replication cycle. In this study, we report that agnoprotein forms highly stable dimers and higher order oligomer complexes. This was confirmed by immunoblotting and mass spectrometry studies. These complexes are extremely resistant to strong denaturing agents, including urea and SDS. Central portion of the protein, amino acids spanning from 17 to 42 is important for dimer/oligomer formation. Removal of 17 to 42 aa region from the viral background severely affected the efficiency of the JCV replication. Extracts prepared from JCV-infected cells showed a double banding pattern for agnoprotein in vivo. Collectively, these findings suggest that agnoprotein forms functionally active homodimer/oligomer complexes and these may be important for its function during viral propagation and thus for the progression of PML.

JC virus-induced Progressive Multifocal Leukoencephalopathy.

Progressive multifocal encephalopathy (PML) is a fatal demyelinating disease of the central nervous system (CNS), caused by the lytic infection of oligodendrocytes by a human polyomavirus, JC virus (JCV). PML is rare disease but mostly develops in patients with underlying immunosuppressive conditions, including Hodgkin's lymphoma, lymphoproliferative diseases, in those undergoing antineoplastic therapy and AIDS. However, consistent with the occurrence of PML under immunocompromised conditions, this disease seems to be also steadily increasing among autoimmune disease patients (multiple sclerosis and Crohn's disease), who are treated with antibody-based regimens (natalizumab, efalizumab and rituximab). This unexpected occurrence of the disease among such a patient population reconfirms the existence of a strong link between the underlying immunosuppressive conditions and development of PML. These recent observations have generated a new interest among investigators to further examine the unique biology of JCV.

Refolding of human beta-1-2 GlcNAc transferase (GnT1) and the role of its unpaired Cys 121.

Human beta1-2N-acetylglucosaminyltransferase (hGnT1) lacking the first 103 amino acids was expressed as a maltose binding protein (MBP) fusion protein in inclusion bodies (IBs) in Escherichia coli and refolded using an oxido-shuffling method. GnT1 mutants were prepared by replacing a predicted unpaired cysteine (C121) with alanine (C121A), serine (C121S), threonine (C121T) or aspartic acid (C121D). A double mutant R120A/C121H, was generated to mimic Gly14, the Caenorhabditis elegans GnT1 counterpart to hGNT1. Each mutant hGnT1 was constructed as an MBP fusion protein and resultant IBs were isolated and refolded. Wild type hGnT1 and mutants C121A, C121S and R120A/C121H transferred UDP-GlcNAc to the glycoprotein acceptor Man(5)-RNAse B, whereas mutants C121T and C121D were inactive. These findings indicated that cysteine 121 has a structural role in maintaining active site geometry of hGnT1, rather than a catalytic role, and illustrates for the first time the potential utility of E. coli as an expression system for hGnT1.

Production of N-sulfated polysaccharides using yeast-expressed N-deacetylase/N-sulfotransferase-1 (NDST-1).

Heparan sulfate/heparin N-deacetylase/N-sulfotransferase-1 (NDST-1) is a critical enzyme involved in heparan sulfate/heparin biosynthesis. This dual-function enzyme modifies the GlcNAc-GlcA disaccharide repeating sugar backbone to make N-sulfated heparosan. N-sulfation is an absolute requirement for the subsequent epimerization and O-sulfation steps in heparan sulfate/heparin biosynthesis. We have expressed rat liver (r) NDST-1 in Saccharomyces cerevisiae as a soluble protein. The yeast-expressed enzyme has both N-deacetylase and N-sulfotransferase activities. N-acetyl heparosan, isolated from Escherichia coli K5 polysaccharide, de-N-sulfated heparin (DNSH) and completely desulfated N-acetylated heparan sulfate (CDSNAcHS) are all good substrates for the rNDST-1. However, N-desulfated, N-acetylated heparin (NDSNAcH) is a poor substrate. The rNDST-1 was partially purified on heparin Sepharose CL-6B. Purified rNDST-1 requires Mn(2+) for its enzymatic activity, can utilize PAPS regenerated in vitro by the PAPS cycle (PAP plus para-nitrophenylsulfate in the presence of arylsulfotransferase IV), and with the addition of exogenous PAPS is capable of producing 60-65% N-sulfated heparosan from E. coli K5 polysaccharide or Pasteurella multocida polysaccharide.

Preparation and characterization of a 5'-deazaFAD T491V NADPH-cytochrome P450 reductase.

NADPH-cytochrome P450 reductase is a flavoprotein which contains both an FAD and FMN cofactor. Since the distribution of electrons is governed solely by the redox potentials of the cofactors, there are nine different ways the electrons can be distributed and hence nine possible unique forms of the protein. More than one species of reductase will exist at a given level of oxidation except when the protein is either totally reduced or oxidized. In an attempt to unambiguously characterize the redox properties of the physiologically relevant FMNH(2) form of the reductase, the T491V mutant of NADPH-cytochrome P450 reductase has been reconstituted with 5'-deazaFAD which binds to the FAD-binding site of the reductase with a K(d) of 94 nM. The 5'-deazaFAD cofactor does not undergo oxidation or reduction under our experimental conditions. The molar ratio of FMN to 5'-deazaFAD in the reconstituted reductase was 1.1. Residual FAD accounted for less than 5% of the total flavins. Addition of 2 electron equivalents to the 5'-deazaFAD T491V reductase from dithionite generated a stoichiometric amount of the FMN hydroquinone form of the protein. The 5'-deazaFAD moiety remained oxidized under these conditions due to its low redox potential (-650 mV). The 2-electron-reduced 5'-deazaFAD reductase was capable of transferring only a single electron from its FMN domain to its redox partners, ferric cytochrome c and cytochrome b(5). Reduction of the cytochromes and oxidation of the reductase occurred simultaneously. The FMNH(2) in the 5'-deazaFAD reductase autoxidizes with a first-order rate constant of 0.007 s(-)(1). Availability of a stable NADPH-cytochrome P450 reductase capable of donating only a single electron to its redox partners provides a unique tool for investigating the electron-transfer properties of an intact reductase molecule.