RESUMO
Magnetic van der Waals (vdW) materials have opened new frontiers for realizing novel many-body phenomena. Recently NiPS3 has received intense interest since it hosts an excitonic quasiparticle whose properties appear to be intimately linked to the magnetic state of the lattice. Despite extensive studies, the electronic character, mobility, and magnetic interactions of the exciton remain unresolved. Here we address these issues by measuring NiPS3 with ultra-high energy resolution resonant inelastic x-ray scattering (RIXS). We find that Hund's exchange interactions are primarily responsible for the energy of formation of the exciton. Measuring the dispersion of the Hund's exciton reveals that it propagates in a way that is analogous to a double-magnon. We trace this unique behavior to fundamental similarities between the NiPS3 exciton hopping and spin exchange processes, underlining the unique magnetic characteristics of this novel quasiparticle.
RESUMO
The effect of realistic atmospheric conditions on mid-IR (λ = 3.9â µm) and long-wave-IR (λ = 10â µm) laser-induced avalanche breakdown for the remote detection of radioactive material is examined experimentally and with propagation simulations. Our short-range in-lab mid-IR laser experiments show a correlation between increasing turbulence level and a reduced number of breakdown sites associated with a reduction in the portion of the focal volume above the breakdown threshold. Simulations of propagation through turbulence are in excellent agreement with these measurements and provide code validation. We then simulate propagation through realistic atmospheric turbulence over a long range (0.1-1â km) in the long-wave-IR regime (λ = 10â µm). The avalanche threshold focal volume is found to be robust even in the presence of strong turbulence, only dropping by â¼50% over a propagation length of â¼0.6â km. We also experimentally assess the impact of aerosols on avalanche-based detection, finding that, while background counts increase, a useful signal is extractable even at aerosol concentrations 105 times greater than what is typically observed in atmospheric conditions. Our results show promise for the long-range detection of radioactive sources under realistic atmospheric conditions.
RESUMO
Spinons are well known as the elementary excitations of one-dimensional antiferromagnetic chains, but means to realize spinons in higher dimensions is the subject of intense research. Here, we use resonant x-ray scattering to study the layered trimer iridate Ba_{4}Ir_{3}O_{10}, which shows no magnetic order down to 0.2 K. An emergent one-dimensional spinon continuum is observed that can be well described by XXZ spin-1/2 chains with a magnetic exchange of â¼55 meV and a small Ising-like anisotropy. With 2% isovalent Sr doping, magnetic order appears below T_{N}=130 K along with sharper excitations in (Ba_{1-x}Sr_{x})_{4}Ir_{3}O_{10}. Combining our data with exact diagonalization calculations, we find that the frustrated intratrimer interactions effectively reduce the system into decoupled spin chains, the subtle balance of which can be easily tipped by perturbations such as chemical doping. Our results put Ba_{4}Ir_{3}O_{10} between the one-dimensional chain and two-dimensional quantum spin liquid scenarios, illustrating a new way to suppress magnetic order and realize fractional spinons.
RESUMO
Excitonic insulators are usually considered to form via the condensation of a soft charge mode of bound electron-hole pairs. This, however, presumes that the soft exciton is of spin-singlet character. Early theoretical considerations have also predicted a very distinct scenario, in which the condensation of magnetic excitons results in an antiferromagnetic excitonic insulator state. Here we report resonant inelastic x-ray scattering (RIXS) measurements of Sr3Ir2O7. By isolating the longitudinal component of the spectra, we identify a magnetic mode that is well-defined at the magnetic and structural Brillouin zone centers, but which merges with the electronic continuum in between these high symmetry points and which decays upon heating concurrent with a decrease in the material's resistivity. We show that a bilayer Hubbard model, in which electron-hole pairs are bound by exchange interactions, consistently explains all the electronic and magnetic properties of Sr3Ir2O7 indicating that this material is a realization of the long-predicted antiferromagnetic excitonic insulator phase.
RESUMO
INTRODUCTION: Opioid use disorder (OUD) is common among people in jail and is effectively treated with medications for OUD (MOUD). People with OUD may have an incomplete or inaccurate understanding of OUD and MOUD, and of how to access care. We evaluated an OUD treatment decision making (TDM) intervention to determine whether the intervention increased MOUD initiation post-release. METHODS: We conducted an observational retrospective cohort study of the TDM intervention on initiation of MOUD, individuals with records data indicating confirmed or suspected OUD incarcerated in four eligible jails were eligible to receive the intervention. Time-to-event analyses of the TDM intervention were conducted using Cox proportional hazard modeling with MOUD as the outcome. RESULTS: Cox proportional hazard modeling, with the intervention modeled as having a time-varying effect due to violation of the proportionality assumption, indicated that those receiving the TDM intervention (nâ¯=â¯568) were significantly more likely to initiate MOUD during the first month after release from jail (adjusted hazard ratio 6.27, 95 % C.I. 4.20-9.37), but not in subsequent months (AHR 1.33 95 % C.I. 0.94-1.89), adjusting for demographics, prior MOUD, or felony or gross misdemeanor arrest in the prior year compared to those not receiving the intervention (nâ¯=â¯3174). CONCLUSION: The TDM intervention was associated with a significantly higher relative hazard of starting MOUD, specifically during the first month after incarceration. However, a minority of all eligible people received any MOUD. Future research should examine ways to increase initiation on MOUD immediately after (or ideally during) incarceration.
Assuntos
Terapia Comportamental/métodos , Tratamento de Substituição de Opiáceos/estatística & dados numéricos , Transtornos Relacionados ao Uso de Opioides/psicologia , Educação de Pacientes como Assunto/métodos , Prisioneiros/psicologia , Adolescente , Adulto , Buprenorfina/uso terapêutico , Tomada de Decisões , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Naltrexona/uso terapêutico , Tratamento de Substituição de Opiáceos/psicologia , Transtornos Relacionados ao Uso de Opioides/tratamento farmacológico , Aceitação pelo Paciente de Cuidados de Saúde/psicologia , Aceitação pelo Paciente de Cuidados de Saúde/estatística & dados numéricos , Prisões , Modelos de Riscos Proporcionais , Estudos Retrospectivos , Adulto JovemRESUMO
Ruthenium compounds serve as a platform for fundamental concepts such as spin-triplet superconductivity1, Kitaev spin liquids2-5 and solid-state analogues of the Higgs mode in particle physics6,7. However, basic questions about the electronic structure of ruthenates remain unanswered, because several key parameters (including Hund's coupling, spin-orbit coupling and exchange interactions) are comparable in magnitude and their interplay is poorly understood, partly due to difficulties in synthesizing large single crystals for spectroscopic experiments. Here we introduce a resonant inelastic X-ray scattering (RIXS)8,9 technique capable of probing collective modes in microcrystals of 4d electron materials. We observe spin waves and spin-state transitions in the honeycomb antiferromagnet SrRu2O6 (ref. 10) and use the extracted exchange interactions and measured magnon gap to explain its high Néel temperature11-16. We expect that the RIXS method presented here will enable momentum-resolved spectroscopy of a large class of 4d transition-metal compounds.
RESUMO
BACKGROUND: The association between saturation of peripheral oxygenation (SpO2) fluctuation and severity of retinopathy of prematurity (ROP) is well elucidated in extremely low birth weight (ELBW) infants. Time spent in the Target range of SpO2 is also associated with the severity of ROP. METHODS: In a prospective observational study, the SpO2 of all ELBW infants admitted to our unit were monitored for the first four weeks of life, and averaged every minute for analysis. The percent time spent at SpO2â<90%, 90-95%, andâ>95% and weekly SpO2 fluctuations [as SpO2 coefficient of variation (CoV)] were calculated. RESULTS: During the study period 21 infants had moderate to severe ROP and 35 infants served as controls. Infants with moderate to severe ROP were smaller and younger than their controls [676±124 grams vs. 796±148 grams (pâ<â0.001); and 24.0±1.0 weeks vs. 25.0±1.7 weeks (pâ<â0.001) respectively]. There were no significant differences in time spent in the 90-95% range between groups (pâ=â0.66). However there was a significant increase in weekly SpO2 CoV in infants with moderate to severe ROP vs. controls (pâ=â0.007). CONCLUSION: In ELBW infants, there was an association between SpO2 fluctuation during the first four weeks of life and severity of ROP, although, no association was established with time spent in the target range of SpO2.
Assuntos
Recém-Nascido de Peso Extremamente Baixo ao Nascer/sangue , Oximetria/métodos , Oxigenoterapia/efeitos adversos , Oxigênio/sangue , Retinopatia da Prematuridade/fisiopatologia , Feminino , Humanos , Lactente , Recém-Nascido , Recém-Nascido Prematuro , Unidades de Terapia Intensiva Neonatal , Masculino , Estudos Prospectivos , Retinopatia da Prematuridade/sangue , Retinopatia da Prematuridade/terapia , Fatores de Risco , Resultado do TratamentoRESUMO
We show experimentally for the first time that two mutually attracting flux ropes may bounce back instead of merging together, leading to a variety of dynamics not expected from a two-dimensional model. Attraction forces due to flux rope currents compete with repulsion from field line bending of in-plane and out-of-plane magnetic fields and elastic plasma compression. Bouncing dynamics occurs if the line-bending force due to an out-of-plane field dominates. Otherwise, the ropes merge. Further reduction in the field line-bending force results in violently erratic magnetic states.
RESUMO
Spinach (Spinacia oleracea) plants exhibiting severe stunting and leaves that showed interveinal yellowing, thickening, and deformation were found in an experimental trial adjacent to an artichoke field in Monterey County, CA in October of 2008. Percent incidence of symptomatic plants ranged from 20 to 39% in cvs. Bordeaux, Lazio, and Tigercat. Symptomatic plants were positive for Impatiens necrotic spot virus (INSV; family Bunyaviridae, genus Tospovirus) and were negative for Tomato spotted wilt virus, Cucumber mosaic virus, and Tobacco mosaic virus when tested with immunostrips (Agdia Inc., Elkhart, IN). The INSV-positive spinach was used for mechanical transmission to Nicotiana benthamiana, Chenopodium quinoa, and spinach. All inoculated plants were positive for INSV with immunostrips. To further confirm the presence of INSV, reverse transcription (RT)-PCR was conducted. Total RNA was extracted from the symptomatic spinach plants using a RNeasy Plant Kit (Qiagen Inc., Valencia, CA) and used as a template in RT-PCR using forward (5'-GGATGTAAGCCCTTCTTTGTAGTGG-3') and reverse (5'-CCTTCCAAGTCACCCTCTGATTG-3') primers specific to the INSV nucleoprotein (N) gene (GenBank Accession No. DQ425096). Amplicons of the expected size (approximately 364 bp) were obtained from both field-infected and mechanically inoculated spinach plants. Four amplicons were sequenced and compared with INSV N gene sequence in GenBank to confirm the identity of the products. Sequences obtained had 99% nucleotide identity with INSV sequences available under the GenBank Accession Nos. L20885, DQ523597, DQ523598, X66872, L20886, D00914, AB109100, and DQ425096. INSV can be one of the most serious viral pathogens of ornamental plants in North America and Europe. The host range of INSV is expanding and recent reports of INSV infection of vegetables include lettuce, peppers, peanut, and potato (1-4). To our knowledge, this is the first report of natural occurrence of INSV in spinach in California. Since INSV is vectored by thrips, its expanding natural host could make it an economically important problem in California and the United States. References: (1) S. T. Koike et al. Plant Dis. 92:1248, 2008. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) S. S Pappu et al. Plant Dis. 83:966, 1999. (4) K. L. Perry et al. Plant Dis. 89:340, 2005.
RESUMO
BACKGROUND: Duplication of the pituitary stalk, morning glory disc anomaly and moya moya are rare malformations. The combination of these findings may be syndromic and may have an underlying genetic etiology. METHODS: Case report and review of the literature of neurological, ophthalmological, and neuroradiological findings including ophthalmic examination, MRI and MRA. CASE REPORT: A 2 year-old girl presented with reduced visual acuity and roving eye movements since birth. Ophthalmological workup revealed bilateral morning glory disc anomaly. MRI showed duplication of the pituitary stalk and caudal displacement of the floor of the third ventricle. MRA showed narrowing of the supraclinoid internal carotid arteries with focal narrowing of the proximal middle cerebral arteries consistent with early moya moya disease. CONCLUSIONS: Review of the literature of pituitary gland duplication and of the combination of morning glory disc anomaly and moya moya disease revealed only one previously reported case. However, the spectrum of this possibly syndromic presentation may be much broader and include various types of anterior midline defects and may have a common underlying genetic cause.
Assuntos
Artérias Cerebrais/patologia , Doença de Moyamoya/complicações , Malformações do Sistema Nervoso/complicações , Disco Óptico/anormalidades , Hipófise/anormalidades , Retina/anormalidades , Artéria Carótida Interna/patologia , Artéria Carótida Interna/fisiopatologia , Artérias Cerebrais/fisiopatologia , Pré-Escolar , Progressão da Doença , Feminino , Humanos , Angiografia por Ressonância Magnética , Imageamento por Ressonância Magnética , Artéria Cerebral Média/patologia , Artéria Cerebral Média/fisiopatologia , Doença de Moyamoya/fisiopatologia , Malformações do Sistema Nervoso/fisiopatologia , Artéria Retiniana/anormalidades , Terceiro Ventrículo/anormalidadesRESUMO
PURPOSE: To raise awareness of potential significant ocular damage and visual loss secondary to paintballs in those not wearing ocular protection and to report high incidence of chorioretinitis sclopetaria from paintball contusion. METHODS: We reviewed cases of eye injury presenting to a single institution from 2000 to 2005. Those cases in which the injury was attributed to paintballs were identified and evaluated to determine ocular findings and visual prognosis. RESULTS: Ocular paintball injuries occurred in eight male subjects and one female subject (nine eyes) with an average age of 16 years (range, 11-26). None had ocular protection at the time of ocular injury. On initial examination, vitreous haemorrhage was present in six eyes (67%), maculopathy, hyphema, cataract, and commotio retinae were each present in four eyes (44%). Two eyes suffered retinal detachment and one eye an optic nerve avulsion. Chorioretinitis sclopetaria occurred in four eyes (44%). The final visual acuity was > or =20/40 in three eyes, 20/50 to 20/150 in two eyes, and < or =20/200 in four eyes. CONCLUSION: Injuries owing to paintballs can result in severe ocular damage and visual loss. Increased awareness and need for proper ocular protection should be emphasized by ophthalmologists. Chorioretinitis sclopetaria occurs with a high frequency and its presence should be recognized, as its management is different from retinal tear or detachment.
Assuntos
Traumatismos em Atletas/etiologia , Traumatismos Oculares/etiologia , Jogos e Brinquedos/lesões , Adolescente , Adulto , Traumatismos em Atletas/prevenção & controle , Catarata/etiologia , Criança , Coriorretinite/etiologia , Traumatismos Oculares/prevenção & controle , Dispositivos de Proteção dos Olhos , Feminino , Humanos , Hifema/etiologia , Masculino , Doenças Retinianas , Estudos Retrospectivos , Transtornos da Visão/etiologia , Acuidade Visual , Hemorragia Vítrea/etiologia , Adulto JovemRESUMO
Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5' TGGCTGGCTTTTTCCGAACG 3' and R1-R: 5' CCTAATCTGTTGGTCCGAACTGTC 3'), RNA2 (R2-F: 5' GCGTGCGTATCATCAGAAATGG 3' and R2-R: 5' ATCGGGAGCAG AGAAACACCTTCC 3'), and RNA3 (R3-F: 5' CTCACCAACTGAAT GCTCTGGAC 3' and R3-R: 5' TGGATGCGTCTTTCCGAACC 3') for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.
RESUMO
PURPOSE: To describe clinical, ultrasound biomicroscopy (UBM), and histopathologic characteristics of benign melanocytic tumors of the ciliary body. DESIGN: Consecutive case series. METHODS: Six patients with a pigmented ciliary body tumour underwent complete ophthalmic examination and UBM, with histopathologic examination carried out on three cases. RESULTS: Six patients presented with a pigmented iridociliary mass, with central displacement of iris root. UBM revealed a stromal mass arising in pars plicata and/or pars plana in all six with a cyst in three cases (intrinsic=1 and extrinsic=2). Iridocyclectomy was performed because of documented growth in three cases, and all three cases proved to be ciliary body spindle-cell naevus. The other three patients have remained stable. CONCLUSIONS: On clinical basis and with available ancillary studies, ciliary body naevi cannot be reliably differentiated from ciliary body melanocytoma and ciliary body melanoma. Even with clinically documented growth, the lesions may prove to be ciliary body naevi.
Assuntos
Corpo Ciliar , Nevo Pigmentado/diagnóstico , Neoplasias Uveais/diagnóstico , Diagnóstico Diferencial , Feminino , Humanos , Melanoma/diagnóstico , Microscopia Acústica , Pessoa de Meia-Idade , Nevo Pigmentado/patologia , Nevo Pigmentado/cirurgia , Neoplasias Uveais/patologia , Neoplasias Uveais/cirurgiaRESUMO
BACKGROUND/AIMS: Recent studies on the treatment of acute subretinal macular haemorrhage have shown that the volume of the clot and the time to evacuation have strong prognostic factors for visual outcome. A novel technique for surgical evacuation of these lesions involves direct injection of tissue plasminogen activator (t-PA) into the haematoma using pars plana vitrectomy. The aim of this study was to evaluate the clinical outcomes of this recently described procedure. METHODS: 17 consecutive patients with subretinal macular haemorrhages caused by age related macular degeneration were enrolled. Patient demographics, acuities, and fluorescein angiograms were obtained for all evaluations. All patients underwent complete three port pars plana vitrectomy to enable direct cannulation of the subretinal space and injection of 48 mug of t-PA, partial fluid-air exchange, 1 hour face up supine positioning postoperatively, followed by upright positioning overnight. RESULTS: 88% of patients within the study had stabilisation or improvement of visual acuity. Nine patients had total clearing of the macular haemorrhage and eight patients had subtotal clearing. Two patients had recurrence of the haemorrhage after the procedure and one patient underwent repair for retinal detachment. Occult lesions demonstrated similar outcomes to classic or predominately classic lesions. Nine patients required no therapy after the study to treat subfoveal neovascularisation. CONCLUSIONS: This study represents one of the largest case series to date showing that direct injection of subretinal t-PA with air-fluid exchange only and no intraoperative clot lysis period can have favourable results.
Assuntos
Fibrinolíticos/administração & dosagem , Hemorragia Retiniana/tratamento farmacológico , Ativador de Plasminogênio Tecidual/administração & dosagem , Doença Aguda , Idoso , Idoso de 80 Anos ou mais , Neovascularização de Coroide/complicações , Feminino , Fibrinolíticos/uso terapêutico , Humanos , Injeções Intralesionais , Degeneração Macular/complicações , Masculino , Pessoa de Meia-Idade , Cuidados Pós-Operatórios/métodos , Postura , Hemorragia Retiniana/etiologia , Hemorragia Retiniana/fisiopatologia , Ativador de Plasminogênio Tecidual/uso terapêutico , Resultado do Tratamento , Acuidade Visual/efeitos dos fármacos , VitrectomiaRESUMO
Rhizomania is an important virus disease of sugar beet and is caused by Beet necrotic yellow vein virus (BNYVV). During 2002-03, several sugar beet fields with cultivars partially resistant to BNYVV grown in the Imperial Valley of California were observed with severe rhizomania symptoms, suggesting that resistance conditioned by Rz1 had been compromised. Soil testing with sugar beet baiting plants followed by enzyme-linked immunosorbent assay (ELISA) was used to diagnose virus infection. Resistant varieties grown in BNYVV-infested soil from Salinas, CA, were ELISA-negative. In contrast, when grown in BNYVV-infested soil collected from the Imperial Valley, CA, all resistant varieties became infected and tested positive by ELISA. Based on host reaction, eight distinct BNYVV isolates have been identified from Imperial Valley soil (IV-BNYVV) by single local lesion isolation. Reverse transcription-polymerase chain reaction (RT-PCR) assays showed that the eight IV-BNYVV isolates did not contain RNA-5. Singlestrand conformation polymorphism banding patterns for the IV-BNYVV isolates were identical to A-type and different from P-type. Sequence alignments of PCR products from BNYVV RNA-1 near the 3' end of IV-BNYVV isolates revealed that both IV-BNYVV and Salinas BNYVV isolates were similar to A-type and different from B-type. Our results suggest that the resistancebreaking BNYVV isolates from Imperial Valley likely evolved from existing A-type isolates.
RESUMO
AIM: To evaluate efficacy of verteporfin ocular photodynamic therapy (PDT) in treatment of 10 patients with a symptomatic circumscribed choroidal haemangioma. DESIGN: Prospective non-randomised, interventional case series and critical review of previously published studies. METHODS: 10 consecutive patients (seven primary, two failed transpupillary thermotherapy (TTT), and one failed external beam radiotherapy) with symptomatic circumscribed choroidal haemangioma were treated using verteporfin 6 mg/m2 given as an intravenous infusion over 10 minutes. Diode laser (690 nm) with an intensity of 600 mW/cm2 for 83 seconds (50 J/cm2) was applied 5 minutes after completion of infusion. Single or multiple partially overlapping spots were applied based on the tumour basal dimensions. Periodic follow up with ophthalmoscopy, ultrasonography, and angiographic studies was performed. RESULTS: All 10 patients showed evidence of regression with flattening of tumour, resolution of subretinal fluid, and reduction of choroidal vasculature on angiograms. The visual acuity either improved or remained stable in eight (80%) patients. Visual loss due to delayed choroidal atrophy was seen in two patients. CONCLUSIONS: Although verteporfin PDT is an effective treatment for management of symptomatic circumscribed choroidal haemangioma, delayed treatment related effects can lead to visual loss.
Assuntos
Neoplasias da Coroide/tratamento farmacológico , Hemangioma/tratamento farmacológico , Fotoquimioterapia/métodos , Fármacos Fotossensibilizantes/uso terapêutico , Porfirinas/uso terapêutico , Adulto , Idoso , Neoplasias da Coroide/patologia , Feminino , Angiofluoresceinografia , Hemangioma/patologia , Humanos , Masculino , Pessoa de Meia-Idade , Estudos Prospectivos , Resultado do Tratamento , VerteporfinaRESUMO
Lipid peroxidation has been implicated in many age-associated disorders including macular degeneration of the retina. We sought to elucidate the mechanism by which accumulation of oxidized LDL (oxLDL) reduces the ability of retinal pigment epithelium (RPE) to process photoreceptor outer segments (OS) as a model of peroxidation-induced disruption of phagocytosis. OxLDL did not reduce the lysosomal hydrolytic capacity of the RPE, but efficiently inhibited processing of various internalized proteins. OxLDL caused a delay in the acquisition of late lysosomal markers by newly formed phagosomes. At the same time, an excessive accumulation of markers of early phagosomal compartments was also observed. The activity of phosphatidylinositol 3-kinase (PI3K) was reduced in phagosomes of the RPE treated with oxLDL. These results suggest that accumulation of oxidized lipid-protein complexes in the RPE impedes phagosome maturation by blocking PI3K recruitment to the phagosomal membrane, leading to delayed processing of internalized OS.
Assuntos
Lipoproteínas LDL/metabolismo , Fagossomos/metabolismo , Epitélio Pigmentado Ocular/metabolismo , Células Cultivadas , Endopeptidases/metabolismo , Humanos , Látex/metabolismo , Peroxidação de Lipídeos , Fagossomos/enzimologia , Fosfatidilinositol 3-Quinases/metabolismo , Células Fotorreceptoras de Vertebrados/metabolismo , Epitélio Pigmentado Ocular/citologia , Ligação Proteica , Processamento de Proteína Pós-TraducionalRESUMO
BACKGROUND: Arteriovenous (AV) sheathotomy, a potential treatment for branch retinal vein occlusion (BVO), surgically separates retinal vessels at an AV crossing. Relief of the aetiological obstruction, with resolution of cystoid macular oedema (CMO), may result in improved visual acuity. METHODS: A retrospective review of consecutive cases of AV sheathotomy for BVO was undertaken. Eyes were categorised as having resolution (group 1), reduction (group 2), or persistence (group 3) of CMO. Intergroup comparisons were made with regard to preoperative, intraoperative, and postoperative parameters. Preoperative and postoperative visual acuities were compared within each group. RESULTS: Of the 27 eyes identified, eight (29.6%) had resolution, 14 (51.8%) had reduction, and five (18.6%) had persistence of CMO. Median preoperative visual acuity was similar in all groups (1.0, 1.0, 1.3, respectively; p = 0.29). Overall median follow up was 12.0 months (Q1 = 12.0, Q2 = 22.5). Eyes in group 1 had significantly better median postoperative visual acuity than eyes in groups 2 and 3 (0.6, 1.0, 2.0 respectively; p = 0.01). A significantly higher proportion of eyes in group 1 had visual acuity improvement compared with eyes in the other groups (87.5% v 35.7% and 20.0%; p = 0.03). Median postoperative visual acuity was significantly better than median preoperative visual acuity in group 1 eyes only (p = 0.02). A higher percentage of group 1 eyes had evidence of postoperative retinal perfusion (83.0% v 21.43% and 40.0%; p = 0.16). Postoperative retinal detachment occurred in three eyes (11.1%). CONCLUSION: Complete resolution of CMO after AV sheathotomy occurred in one third of patients, and postoperative vision improved significantly in this group. However, in the majority of cases, despite an improvement in CMO, there was no improvement in vision after AV sheathotomy.
Assuntos
Edema Macular/cirurgia , Oclusão da Veia Retiniana/cirurgia , Vasos Retinianos/cirurgia , Idoso , Feminino , Humanos , Edema Macular/etiologia , Edema Macular/fisiopatologia , Masculino , Pessoa de Meia-Idade , Oclusão da Veia Retiniana/complicações , Oclusão da Veia Retiniana/fisiopatologia , Estudos Retrospectivos , Estatísticas não Paramétricas , Resultado do Tratamento , Acuidade VisualRESUMO
Calibrachoa mottle virus (CbMV), a tentative carmovirus, was first isolated and reported by Liu et al. (1) from infected Calibrachoa plants. During the spring of 2003, petunia samples from Florida and California sent to testing services at Agdia, Inc (Elkhart IN) tested positive for CbMV by enzyme-linked immunosorbent assay (ELISA) and lateral flow immunoassay (ImmunoStrips). These samples also tested positive by carmovirus group-specific polymerase chain reaction (PCR) primers and by immunocapture PCR (2). RNA extracted from these samples with the RNeasy Plant Kit (Qiagen Inc., Valencia, CA) hybridized with a digoxigenin labeled probe derived from purified CbMV viral RNA. All plant samples that tested positive for CbMV were symptomless except one symptomatic sample that also tested positive for Tobacco mosaic virus. From samples that tested positive for CbMV only, mechanical inoculations were made to Chenopodium quinoa at a USDA-ARS greenhouse in Salinas, CA. Representative single, local lesions were used to inoculate additional C. quinoa plants. The resulting local lesions from these inoculations were freeze-dried and further used as virus inoculum (CbMV petunia). Similar inoculum was made with CbMV isolated from Calibrachoa plants (CbMV calibrachoa). Virus-free Petunia hybrida cultivars Surfinia 'Baby Pink' and Surfinia 'Violet' (Jackson and Perkins Inc., Somis, CA) were mechanically inoculated with CbMV petunia and CbMV calibrachoa. Four weeks postinoculation, all plants were tested using ELISA for the presence of CbMV. In greenhouse conditions, 14.3% of 'Baby Pink' plants were positive for CbMV petunia, whereas none were positive for CbMV calibrachoa. 'Violet' plants were 64.3 and 33.3% positive for CbMV petunia and CbMV calibrachoa, respectively. None of the positive plants expressed virus-like symptoms. Virus particles resembling those of CbMV were observed from infected petunia plants with transmission electron microscopy in leaf-dip preparations. To our knowledge, this is the first report of CbMV infecting petunia. Commercial reproduction of petunia plants and maintenance of genetic mother stock are usually by vegetative propagation. CbMV can be transmitted mechanically and is readily propagated along with its host. To produce healthy petunia plants, virus-free mother stock should be used, which requires regular screening of mother stock for CbMV. Reference: (1) H.-Y. Liu et al. Plant Dis. 87:167, 2003. (2) A. M. Harness et al. (Abstr.) Phytopathology 92:S34, 2002.