Leaf photosynthesis: do endophytes have a say?

Endophytes, both bacterial and fungal, constitute an integral component of the leaf ecosystem. Here we argue that the respiratory metabolism of endophytes in the intercellular spaces of leaves could have a significant role in enhancing leaf photosynthesis by enriching the internal CO2 concentration, especially in C3 plants.

Sustainable production of camptothecin from an Alternaria sp. isolated from Nothapodytes nimmoniana.

Camptothecin the third most in demand alkaloid, is commercially extracted in India from the endangered plant, Nothapodytes nimmoniana. Endophytes, the microorganisms that reside within plants, are reported to have the ability to produce host-plant associated metabolites. Hence, our research aims to establish a sustainable and high camptothecin yielding endophyte, as an alternative source for commercial production of camptothecin. A total of 132 endophytic fungal strains were isolated from different plant parts (leaf, petiole, stem and bark) of N. nimmoniana, out of which 94 were found to produce camptothecin in suspension culture. Alternaria alstroemeriae (NCIM1408) and Alternaria burnsii (NCIM1409) demonstrated camptothecin yields up to 426.7 ± 33.6 µg/g DW and 403.3 ± 41.6 µg/g DW, respectively, the highest reported production to date. Unlike the reported product yield attenuation in endophytes with subculture in axenic state, Alternaria burnsii NCIM1409 could retain and sustain the production of camptothecin up to ~ 200 µg/g even after 12 continuous subculture cycles. The camptothecin biosynthesis in Alternaria burnsii NCIM1409 was confirmed using 13C carbon labelling (and cytotoxicity analysis on different cancer cell lines) and this strain can now be used to develop a sustainable bioprocess for in vitro production of camptothecin as an alternative to plant extraction.

Genome Sequence Resource of Bacillus velezensis EB14, a Native Endophytic Bacterial Strain with Biocontrol Potential Against the Poplar Stem Canker Causative Pathogen, Sphaerulina musiva.

Bacillus velezensis EB14, isolated from a leaf of Populus × jackii, possesses antagonistic activity against Sphaerulina musiva, a fungal pathogen of Populus sp. that causes leaf spots and stem cankers on poplars, limiting the utility of hybrid poplars as plantation trees. We sequenced the genome of B. velezensis EB14 to gain insights into the underlying basis of its antagonistic activity. Here, we report the complete genome sequence of B. velezensis EB14, a gram-positive bacterium of the family Bacillaceae. Through antiSMASH analysis, we predicted several gene clusters coding for the biosynthesis of antimicrobial compounds and several genes involved in plant bacterial interactions. These findings support the potential of developing B. velezensis EB14 as a biocontrol agent against S. musiva in poplar plantations. The genome of B. velezensis EB14 along with genome sequences of closely related B. velezensis species are invaluable for comparative genomic analyses to gain insights into bacterial, fungal, and host plant interactions.

Fungal Endophyte-Mediated Crop Improvement: The Way Ahead.

Endophytes are non-disease causing microbes (bacteria and fungi) surviving in living tissues of plants. Their intimate association and possible coevolution with their plant partners have resulted in them contributing to an array of plant growth benefits ranging from enhanced growth and biomass accumulation, tolerance to abiotic and biotic stresses and in nutrient acquisition. The last couple of decades have witnessed a burgeoning literature on the role of endophytes (Class 3 type) in regulating plant growth and development and their adaptation to abiotic and biotic stresses. Though the underlying mechanisms of plant-endophyte interactions are far from clear, several studies have raised the hope of their potential application in agriculture, especially in mitigating abiotic and biotic stresses. The use of endophytes is envisaged as a route to reduce the production cost and burden on the environment by lessening the dependence on breeding for crop improvement and agrochemicals. Unfortunately, save a few well documented examples of their use, a little of these insights has been translated into actual agricultural applications. Here, we reflect on this paucity and elaborate on some of the important bottlenecks that might stand in way of fully realizing the potential that endophytes hold for crop improvement. We stress the need to study various facets of the endophyte-plant association for their gainful application in agriculture.

Threshing Yards: Graveyard of Maternally Borne Seed Microbiome?

Plant domestication, at least in cereals, is associated with the loss of the shattering allele. In such species, grains are manually harvested and threshed, leaving behind naked seeds. This could have led to the loss of maternally borne seed microbiomes and their associated benefits in modern-day domesticated species.

Exploring DNA quantity and quality from raw materials to botanical extracts.

OBJECTIVES: The aim of this study was to explore the variability in DNA quality and quantity along a gradient of industrial processing of botanical ingredients from raw materials to extracts. METHODS: A data matrix was assembled for 1242 botanical ingredient samples along a gradient of industrial processing commonly used in the Natural Health Product (NHP) industry. Multivariate statistics was used to explore dependant variables for quality and quantity. The success of attaining a positive DNA test result along a gradient of industrial processing was compared among four biotechnologies: DNA barcoding, NGS, Sanger sequencing and qPCR. RESULTS: There was considerable variance in DNA quality and quantity among the samples, which could be interpreted along a gradient from raw materials with greater quantities (50-120 ng/µL) of DNA and longer DNA (400-500bp) sequences to extracts, which were characterized by lower quantities (0.1-10.0 ng/µL) and short fragments (50-150bp). CONCLUSIONS: Targeted molecular diagnostic tests for species identity can be used in the NHP industry for raw and processed samples. Non-targeted tests or the use of NGS for any identity test needs considerable research and development and must be validated before it can be used in commercial operations as these methods are subject to considerable risk of false negative and positive results. Proper use of these tools can be used to ensure ingredient authenticity, and to avert adulteration, and contamination with plants that are a health concern. Lastly these tools can be used to prevent the exploitation of rare herbal species and the harvesting of native biodiversity for commercial purposes.

Assessment of adulteration in raw herbal trade of important medicinal plants of India using DNA barcoding.

A number of studies have shown that there could be widespread substitution and/or adulteration (hereafter referred to as substitution) in raw herbal trade of medicinal plants. Substitution could potentially endanger the health and safety of the consumers. In this study, the extent of adulteration in raw herbal trade of 30 important medicinal plants in South India was analyzed. Biological reference material (BRM) consisting of taxonomically authenticated samples of each of the 30 species along with 14 other co-occurring and congeneric allied species that are likely to be used in adulteration was established. DNA barcode signatures of 124 BRM using two candidate regions, nr-ITS and psbA-trnH were identified. A total of 203 herbal trade samples representing the 30 medicinal plant species were collected from 34 locations in South India. Using the DNA barcode sequences of the BRM as reference, the analysis indicated that the substitution ranged from 20 to 100%. Overall, approximately 12% of the market samples were adulterated. Considering the potential health hazard that such adulteration can cause, the need for a national regulatory framework that can authenticate and regulate raw herbal trade in the country is discussed.

Transcriptome analysis of stem wood of Nothapodytes nimmoniana (Graham) Mabb. identifies genes associated with biosynthesis of camptothecin, an anti-carcinogenic molecule.

Camptothecin (CPT), a monoterpene indole alkaloid, is a potent inhibitor of DNA topoisomerase I and has applications in treating ovarian, small lung and refractory ovarian cancers. Stem wood tissue of Nothapodytes nimmoniana (Graham) Mabb. (family Icacinaceae) is one of the richest sources of CPT. Since there is no genomic or transcriptome data available for the species, the present work sequenced and analysed transcriptome of stem wood tissue on an Illumina platform. From a total of 77,55,978 reads, 9,187 transcripts were assembled with an average length of 255 bp. Functional annotation and categorization of these assembled transcripts unraveled the transcriptome architecture and also a total of 13 genes associated with CPT biosynthetic pathway were identified in the stem wood tissue. Four genes of the pathway were cloned to full length by RACE to validate the transcriptome data. Expression analysis of 13 genes associated with CPT biosynthetic pathway in 11 different tissues vis-a-vis CPT content analysis suggested an important role of NnPG10H, NnPSLS and NnPSTR genes in the biosynthesis of CPT. These results indicated that CPT might be synthesized in the leaves and then perhaps exported to stem wood tissue for storage.

Ecological Knowledge Among Communities, Managers and Scientists: Bridging Divergent Perspectives to Improve Forest Management Outcomes.

Multiple actors are typically involved in forest management, namely communities, managers and researchers. In such cases, suboptimal management outcomes may, in addition to other factors, be symptomatic of a divergence in perspectives among these actors driven by fundamental differences in ecological knowledge. We examine the degree of congruence between the understandings of actors surrounding key issues of management concern in three case studies from tropical, subtropical and boreal forests. We identify commonly encountered points of divergence in ecological knowledge relating to key management processes and issues. We use these to formulate seven hypotheses about differences in the bodies of knowledge that frequently underlie communication and learning failures in forest management contexts where multiple actors are involved and outcomes are judged to be suboptimal. Finally, we present a set of propositions to acknowledge and narrow these differences. A more complete recognition of the full triangulation between all actors involved, and of the influence that fundamental differences in ecological knowledge can exert, may help lead to a more fruitful integration between local knowledge and practice, manager knowledge and practice, and contemporary science in forest management.

Rohitukine, a chromone alkaloid and a precursor of flavopiridol, is produced by endophytic fungi isolated from Dysoxylum binectariferum Hook.f and Amoora rohituka (Roxb).Wight & Arn.

Rohitukine, a chromone alkaloid, has gained considerable international attention in recent years because of its novel semi-synthetic derivative, flavopiridol and P-276-00. Both these molecules are in advanced stages of clinical development and trial for cancer treatment. Recently, flavopiridol was approved as an orphan drug for treatment of chronic lymphocytic leukemia cancer. The natural occurrence of rohitukine is restricted to only four plant species, Amoora rohituka and Dysoxylum binectariferum (both from the Meliaceae family) and from Schumanniophyton magnificum and Schumanniophyton problematicum (both from the Rubiaceae family). Recently, an endophytic fungi isolated from D. binectariferum was reported to produce rohitukine in culture. In this study, we report the production of rohitukine and its subsequent attenuation by endophytic fungi, Fusarium oxysporum (MTCC-11383), Fusarium oxysporum (MTCC-11384) and Fusarium solani (MTCC-11385), all isolated from D. binectariferum and Gibberella fujikuroi (MTCC-11382) isolated from Amoora rohituka. The fungal rohitukine which was analyzed by HPLC, LC-MS and LC-MS/MS was identical to reference rohitukine and that produced by the plant. The rohitukine content in the mycelial samples ranged from 192.78µg to 359.55µg100g(-1) of dry weight of and in broth it ranged from 14.10 to 71.90µg100ml(-1). In all the fungal cultures, the production declined from first to fourth sub-culture. Studies are underway to unravel the mechanism by which the fungi produce the host metabolite in culture.

Indian monsoons shape dispersal phenology of plants.

The Indian monsoons are a major seasonal climatic event over the Indian subcontinent, heralding the arrival of the wet season. Many features of life, biological and cultural, are intimately synchronized to this seasonality. In this paper, we show that the Indian monsoons might have played an important role in shaping the fruiting time and hence dispersal phenology of plant species in the subcontinent.

New plant sources of the anti-cancer alkaloid, camptothecine from the Icacinaceae taxa, India.

In this study, the production of camptothecine and its derivatives, in thirteen species of the family Icacinaceae, namely, Apodytes dimidiata, Codiocarpus andamanicus, Gomphandra comosa, Gomphandra coriacea, Gomphandra polymorpha, Gomphandra tetrandra, Iodes cirrhosa, Iodes hookeriana, Miquelia dentata, Miquelia kleinii, Natsiatum herpeticum, Pyrenacantha volubilis and Sarcostigma kleinii is reported. Seeds of M. dentata were found to produce the highest content of camptothecine (1.0-1.4% by dry weight of seeds). Full scan LC-MS and ESI-MS/MS analysis of M. dentata revealed, besides camptothecine, a number of other derivatives, namely, 10-hydroxycamptothecine, 9-methoxycamptothecine, 20-deoxycamptothecine. Crude extract preparations of the seeds of M. dentata were effective against a breast cancer cell line (IC50=3.82 µg/ml for MDA MB273 cell lines) and two ovarian cancer cell lines (IC50=2.8 µg/ml for NCI/ADR-RES and 4.5 µg/ml for SKOV). These results are the first reports of camptothecine and its derivatives in these species and offer rich alternative plant sources for the anticancer compound, camptothecine.

Does long-distance pollen dispersal preclude inbreeding in tropical trees? Fragmentation genetics of Dysoxylum malabaricum in an agro-forest landscape.

Tropical trees often display long-distance pollen dispersal, even in highly fragmented landscapes. Understanding how patterns of spatial isolation influence pollen dispersal and interact with background patterns of fine-scale spatial genetic structure (FSGS) is critical for evaluating the genetic consequences of habitat fragmentation. In the endangered tropical timber tree Dysoxylum malabaricum (Meliaceae), we apply eleven microsatellite markers with paternity and parentage analysis to directly estimate historic gene flow and contemporary pollen dispersal across a large area (216 km(2)) in a highly fragmented agro-forest landscape. A comparison of genetic diversity and genetic structure in adult and juvenile life stages indicates an increase in differentiation and FSGS over time. Paternity analysis and parentage analysis demonstrate high genetic connectivity across the landscape by pollen dispersal. A comparison between mother trees in forest patches with low and high densities of adult trees shows that the frequency of short-distance mating increases, as does average kinship among mates in low-density stands. This indicates that there are potentially negative genetic consequences of low population density associated with forest fragmentation. Single isolated trees, in contrast, frequently receive heterogeneous pollen from distances exceeding 5 km. We discuss the processes leading to the observed patterns of pollen dispersal and the implications of this for conservation management of D. malabaricum and tropical trees more generally.

Hepatoprotective activity of Indian Phyllanthus.

CONTEXT: Phyllanthus (Euphorbiaceae) species are traditionally well-known for their medicinal properties including hepatoprotective activity. OBJECTIVE: The study assessed the hepatoprotective and antioxidant activities of 11 Phyllanthus species, P. amarus Schumach., P. urinaria L., P. debilis Klein ex Willd, P. tenellus Roxb., P. virgatus G. Forst., P. maderaspatensis L., P. reticulatus Poir., P. polyphyllus Willd., P. emblica L., P. indofischerii Bennet. and P. acidus (L.) Skeels. MATERIALS AND METHODS: The dried leaves and stems of each plant species were extracted in methanol and successively in water. The extracts were screened for hepatoprotective activity at a concentration of 50 µg/mL against tert-butyl hydroperoxide (t-BH) induced toxicity in HepG2 cells. Seven extracts from five species that showed hepatoprotective activity were assessed for their 50% effective concentration (EC50) values and their antioxidant activity using a DPPH assay. Phyllanthin and hypophyllanthin contents were also determined in these Phyllanthus species. RESULTS: The methanol extracts of P. polyphyllus, P. emblica and P. indofischeri showed high levels of hepatoprotective activity with EC50 values of 12, 19 and 28 µg/mL and IC50 of 3.77, 3.38 and 5.8 µg/mL for DPPH scavenging activity respectively against an IC50 of 3.69 µg/mL for ascorbic acid. None of these activities could be attributed to phyllanthin and hypophyllanthin. DISCUSSION AND CONCLUSION: The hepatoprotective and antioxidant activities of P. indofischeri are demonstrated for the first time in literature. The study also confirms the hepatoprotective and antioxidant activities of leaves of P. emblica and P. polyphyllus. The molecule(s) responsible for the activities is being investigated.

Stylish lengths: mate choice in flowers.

The styles of flowers may represent an arena for pollen competition in the race to fertilize ovules. Accordingly, selection should favour a longer 'race' to better discriminate among variable pollen by increasing style length. Sampling across a taxonomically diverse range of wild and outcrossed species, we found that the distribution of style lengths within plants were skewed towards longer styles, as predicted. In self-pollinated domesticated species, where discrimination among pollen is less important, we found no such pattern. We conclude that style length is under directional selection towards longer styles as a mechanism for mate choice among pollen of variable quality.

Sequestration of camptothecin, an anticancer alkaloid, by chrysomelid beetles.

Camptothecin (CPT), a monoterpene indole alkaloid, is a potent inhibitor of eukaryotic toposiomerase-I. Several derivatives of CPT are in clinical use against ovarian and lung cancers. CPT has been reported from several plant species belonging to the order Asterids, with the highest concentration in Nothapodytes nimmoniana (family Icacinaceae). In this paper, we report an intriguing observation of chrysomelid beetles (Kanarella unicolor Jacobby) feeding on the leaves of N. nimmoniana without any apparent adverse effect. LC-MS/MS analysis of the beetles indicated that 54.9% of the ingested CPT's was recovered from the wings, followed by lesser amounts in the head and abdomen. LC-HRMS analysis revealed that most of the CPT in the insect body was in the parental form available in the plants without any major metabolizable products, including sulfated and glucuronilated forms. The mechanism by which the beetles are able to tolerate substantially high levels of CPT in their body tissue is under investigation.

Assessing species admixtures in raw drug trade of Phyllanthus, a hepato-protective plant using molecular tools.

ETHNOPHARMACOLOGICAL RELEVANCE: Phyllanthus (Euphorbiaceae) species are well known for their hepato-protective activity and are used in several ethno-medicines in indigenous health care systems in India. AIM OF THE STUDY: To assess species admixtures in raw drug trade of Phyllanthus using morphological and DNA barcoding tools. MATERIALS AND METHODS: Samples of Phyllanthus used in raw drug trade were obtained from 25 shops in southern India. Species admixtures in the samples were assessed by identifying species using morpho-taxonomic keys. These identities were further validated by developing species specific DNA barcode signatures using the chloroplast DNA region, psbA-trnH. DNA from the market samples were extracted and amplified using the forward (psbAF - GTTATGCATGAACGTAATGCTC) and reverse primer (trnHR - CGCGCATGGTGGATTCACAAATC). The amplified products were sequenced at Chromous Biotech India, Bangalore. The sequences were manually edited using Chromas Lite. Species identities were established by constructing a neighbor-joining tree using MEGA V 4.0. RESULTS: Morphological analysis of market samples revealed six different species of Phyllanthus in the trade samples. Seventy-six percent of the market samples contained Phyllanthus amarus as the predominant species (>95%) and thus were devoid of admixtures. The remaining 24% of the shops had five different species of Phyllanthus namely Phyllanthus debilis, Phyllanthus fraternus, Phyllanthus urinaria, Phyllanthus maderaspatensis, and Phyllanthus kozhikodianus. All identities, except those for Phyllanthus fraternus, were further confirmed by the species specific DNA barcode using chloroplast region psbA-trnH. CONCLUSION: Our results show that market samples of Phyllanthus sold in southern India contain at least six different species, though among them, Phyllanthus amarus is predominant. DNA barcode, psbA-trnH region of the chloroplast can effectively discriminate Phyllanthus species and hence can be used to resolve species admixtures in the raw drug trade of Phyllanthus.