Nanopipette dynamic microscopy unveils nano coffee ring.

Liquid-phase electron microscopy (LP-EM) imaging has revolutionized our understanding of nanosynthesis and assembly. However, the current closed geometry limits its application for open systems. The ubiquitous physical process of the coffee-ring phenomenon that underpins materials and engineering science remains elusive at the nanoscale due to the lack of experimental tools. We introduce a quartz nanopipette liquid cell with a tunable dimension that requires only standard microscopes. Depending on the imaging condition, the open geometry of the nanopipette allows the imaging of evaporation-induced pattern formation, but it can also function as an ordinary closed-geometry liquid cell where evaporation is negligible despite the nano opening. The nano coffee-ring phenomenon was observed by tracking individual nanoparticles in an evaporating nanodroplet created from a thin liquid film by interfacial instability. Nanoflows drive the assembly and disruption of a ring pattern with the absence of particle-particle correlations. With surface effects, nanoflows override thermal fluctuations at tens of nanometers, in which nanoparticles displayed a "drunken man trajectory" and performed work at a value much smaller than kBT.

Drought stress-inducible synthetic promoters designed for poplar are functional in rice.

KEY MESSAGE: Water deficit-inducible synthetic promoters, SD9-2 and SD18-1, designed for use in the dicot poplar, are functional in the monocot crop, rice.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Synthetic Promoter Screening Using Poplar Mesophyll Protoplast Transformation.

Plant protoplasts are useful to study both transcriptional regulation and protein subcellular localization in rapid screens. Protoplast transformation can be used in automated platforms for design-build-test cycles of plant promoters, including synthetic promoters. A notable application of protoplasts comes from recent successes in dissecting synthetic promoter activity with poplar mesophyll protoplasts. For this purpose, we constructed plasmids with TurboGFP driven by a synthetic promoter together with TurboRFP constitutively controlled by a 35S promoter, to monitor transformation efficiency, allowing versatile screening of high numbers of cells by monitoring green fluorescent protein expression in transformed protoplasts. Herein, we introduce a protocol for poplar mesophyll protoplast isolation followed by protoplast transformation and image analysis for the selection of valuable synthetic promoters. Graphical overview.

Dual-Nanopipettes for the Detection of Single Nanoparticles and Small Molecules.

Nanopore sensing is blooming due to its label-free and high sensitivity features. As a novel nanopore, a droplet is formed at the orifice of a dual-nanopipette, which allows for the translocation of analytes through the two channels at a relatively low speed and the promotion of signal-to-noise ratio. However, nanopore sensing based on the principle of current blockage requires the pore size to be comparable to that of the single entity, which poses a huge challenge for the direct detection of small molecules. In this work, gold nanoparticles (Au NPs) modified with sulfhydryl poly(ethylene glycol) (PEG-SH) or aptamers were detected successfully. The size difference of Au NPs and the interaction between Au NPs and dual-nanopipettes could be distinguished sensitively. Furthermore, Au NPs modified with designed aptamers will produce different blocking current after capturing the corresponding small molecules (e.g., dopamine and serotonin). Even non-electroactive ions, such as potassium ions, can also be detected, which is difficult to sense based on redox reactions, and further illustrates that the change of surface properties of nanoparticles is responsible for the detection. This work expands the application of nanopipette sensing for Au NPs and provides a universal platform for the small-molecule detection, which has the potential application in biosensing.

Performance of abiotic stress-inducible synthetic promoters in genetically engineered hybrid poplar (Populus tremula × Populus alba).

Abiotic stresses can cause significant damage to plants. For sustainable bioenergy crop production, it is critical to generate resistant crops to such stress. Engineering promoters to control the precise expression of stress resistance genes is a very effective way to address the problem. Here we developed stably transformed Populus tremula × Populus alba hybrid poplar (INRA 717-1B4) containing one-of-six synthetic drought stress-inducible promoters (SDs; SD9-1, SD9-2, SD9-3, SD13-1, SD18-1, and SD18-3) identified previously by transient transformation assays. We screened green fluorescent protein (GFP) induction in poplar under osmotic stress conditions. Of six transgenic lines containing synthetic promoter, three lines (SD18-1, 9-2, and 9-3) had significant GFP expression in both salt and osmotic stress treatments. Each synthetic promoter employed heptamerized repeats of specific and short cis-regulatory elements (7 repeats of 7-8 bases). To verify whether the repeats of longer sequences can improve osmotic stress responsiveness, a transgenic poplar containing the synthetic promoter of the heptamerized entire SD9 motif (20 bases, containing all partial SD9 motifs) was generated and measured for GFP induction under osmotic stress. The heptamerized entire SD9 motif did not result in higher GFP expression than the shorter promoters consisting of heptamerized SD9-1, 9-2, and 9-3 (partial SD9) motifs. This result indicates that shorter synthetic promoters (~50 bp) can be used for versatile control of gene expression in transgenic poplar. These synthetic promoters will be useful tools to engineer stress-resilient bioenergy tree crops in the future.

Identifying Metal-Oxo/Peroxo Intermediates in Catalytic Water Oxidation by In Situ Electrochemical Mass Spectrometry.

Molecular catalysis of water oxidation has been intensively investigated, but its mechanism is still not yet fully understood. This study aims at capturing and identifying key short-lived intermediates directly during the water oxidation catalyzed by a cobalt-tetraamido macrocyclic ligand complex using a newly developed an in situ electrochemical mass spectrometry (EC-MS) method. Two key ligand-centered-oxidation intermediates, [(L2-)CoIIIOH] and [(L2-)CoIIIOOH], were directly observed for the first time, and further confirmed by 18O-labeling and collision-induced dissociation studies. These experimental results further confirmed the rationality of the water nucleophilic attack mechanism for the single-site water oxidation catalysis. This work also demonstrated that such an in situ EC-MS method is a promising analytical tool for redox catalytic processes, not only limited to water oxidation.

Electrostatic-Gated Kinetics of Rapid Ion Transfers at a Nano-liquid/Liquid Interface.

Charge (ion and electron)-transfer reactions at a liquid/liquid interface are critical processes in many important biological and chemical systems. An ion-transfer (IT) process is usually very fast, making it difficult to accurately measure its kinetic parameters. Nano-liquid/liquid interfaces supported at nanopipettes are advantageous approaches to study the kinetics of such ultrafast IT processes due to their high mass transport rate. However, correct measurements of IT kinetic parameters at nanointerfaces supported at nanopipettes are inhibited by a lack of knowledge of the nanometer-sized interface geometry, influence of the electric double layer, wall charge polarity, etc. Herein, we propose a new electrochemical characterization equation for nanopipettes and make a suggestion on the shape of a nano-water/1,2-dichloroethane (nano-W/DCE) interface based on the characterization and calculation results. A theoretical model based on the Poisson-Nernst-Planck equation was applied to systematically study how the electric double layer influences the IT process of cations (TMA+, TEA+, TPrA+, ACh+) and anions (ClO4-, SCN-, PF6-, BF4-) at the nano-W/DCE interface. The relationships between the wall charge conditions and distribution of concentration and potential inside the nanopipette revealed that the measured standard rate constant (k0) was enhanced when the polarity of the ionic species was opposite to the pipette wall charge and reduced when the same. This work lays the right foundation to obtain the kinetics at the nano-liquid/liquid interfaces.

Detection of Trace Water Based on Electro-oxidation of Molybdenum Disulfide Nanomaterials to Form Molybdenum Oxysulfide.

Molybdenum disulfide nanomaterials nowadays are very popular in electrocatalysis field due to their outstanding catalytic performance toward many electrochemical reactions. However, the electrochemical oxidation reaction of molybdenum disulfide nanomaterials in the range of positive potential has not been studied thoroughly. Herein, we have investigated electro-oxidation of molybdenum disulfide nanomaterials and put forward a new reaction mechanism: molybdenum disulfide nanomaterials are electro-oxidized with water to form molybdenum oxysulfide (MoOS2) and hydrogen ions, leading to the release of hydrogen on the counter electrode. Various characterization methods such as contact angle measurement, scanning electron microscope (SEM), transmission electron microscope (TEM) with energy dispersive X-ray spectroscopy (EDS), X-ray photoelectron spectroscopy (XPS), X-ray absorption near edge structure (XANES) spectroscopy, time-of-flight secondary ion mass spectrometry (ToF-SIMS), and gas chromatography (GC) were applied to attest the doping of oxygen and the generation of hydrogen. Based on this reaction, we constructed a novel ultrasensitive electrochemical sensor for detecting trace water with the minimum detectable content of 0.0010% (v/v) in various organic solvents and ionic liquids, which is comparable to the Karl Fischer titration, but with much simpler reagent.

Revealing the Sulfur Redox Paths in a Li-S Battery by an In Situ Hyphenated Technique of Electrochemistry and Mass Spectrometry.

The lithium-sulfur (Li-S) battery is one of the most promising next generation energy storage systems due to its high theoretical specific energy. However, the shuttle effect of soluble lithium polysulfides formed during cell operation is a crucial reason for the low cyclability suffered by current Li-S batteries. As a result, an in-depth mechanistic understanding of the sulfur cathode redox reactions is urgently required for further advancement of Li-S batteries. Herein, the direct observation of polysulfides in a Li-S battery is reported by an in situ hyphenated technique of electrochemistry and mass spectrometry. Several short-lived lithium polysulfide intermediates during sulfur redox have been identified. Furthermore, this method is applied to a mechanistic study of an electrocatalyst that has been observed to promote the polysulfides conversion in a Li-S cell. Through the abundance distributions of various polysulfides before and after adding the electrocatalyst, compelling experimental evidences of catalytic selectivity of cobalt phthalocyanine to those long-chain polysulfide intermediates are obtained. This work can provide guidance for the design of novel cathode to overcome the shuttle effect and facilitate the sulfur redox kinetics.

Etching-Engineered Low-Voltage Dielectrophoretic Nanotweezers for Trapping of Single Molecules.

Understanding the functions of biomolecules at the single-molecule level is crucial due to their important and diverse roles in cell regulation. Recently, nanotweezers made of dual carbon nanoelectrodes have been developed for single-cell biopsies by applying a high alternating voltage. However, high electric voltage can induce Joule heating, water electrolysis, and other side effects on cell activity, which may be unfavorable for cellular applications. Here, we report a low-voltage nanotweezer for trapping of single DNA molecules using etching-engineered nanoelectrodes which effectively reduce the minimum trapping voltage by six times. Meanwhile, the low-voltage nanotweezer displays an improved trapping stiffness. Based on the finite element method simulations, we attribute the mechanism for the low-voltage nanotweezers to the increase in spatial heterogeneity and nonuniformity of electric field by etching of quartz near the nanoelectrodes. This work opens a new dimension for noninvasive single-molecule manipulation in solution and potential applications in single-cell biopsies.

Identifying Mitochondrial-Related Genes NDUFA10 and NDUFV2 as Prognostic Markers for Prostate Cancer through Biclustering.

Prostate cancer is currently associated with higher morbidity and mortality in men in the United States and Western Europe, so it is important to identify genes that regulate prostate cancer. The high-dimension gene expression profile impedes the discovery of biclusters which are of great significance to the identification of the basic cellular processes controlled by multiple genes and the identification of large-scale unknown effects hidden in the data. We applied the biclustering method MCbiclust to explore large biclusters in the TCGA cohort through a large number of iterations. Two biclusters were found with the highest silhouette coefficient value. The expression patterns of one bicluster are highly similar to those found by the gene expression profile of the known androgen-regulated genes. Further gene set enrichment revealed that mitochondrial function-related genes were negatively correlated with AR regulation-related genes. Then, we performed differential analysis, AR binding site analysis, and survival analysis on the core genes with high phenotypic contribution. Among the core genes, NDUFA10 showed a low expression value in cancer patients across different expression profiles, while NDUFV2 showed a high expression value in cancer patients. Survival analysis of NDUFA10 and NDUFV2 demonstrated that both genes were unfavorable prognostic markers.

Electrochemiluminescence Based on a Dual Carbon Ultramicroelectrode with Confined Steady-State Annihilation.

Developing novel microelectronic devices for electrochemical measurements and electrochemiluminescence (ECL) study is of great importance. Herein, we fabricated a submicrometer-sized dual carbon electrode (DCE) and investigated its annihilation ECL behavior under steady-state conditions for the first time. The oxidation and reduction of the model luminophore, [Ru(bpy)3]2+, occurred separately at the two sides of the DCE, and the electrogenerated ions then diffused to the gap between the two electrodes to generate the excited-state intermediate [Ru(bpy)3]2+* and ECL emission. Compared with other types of two-electrode systems, the prepared DCE possesses a smaller total size and an ultrasmall interelectrode distance of 60 nm or less, which could result in a shorter diffusion time and an amplified ECL signal without the purification of the solvent and supporting electrolytes. On the basis of the constructed ECL microscopic platform, we successfully obtained a stable and confined ECL signal in the vicinity of the electrode tip. Furthermore, a two-dimensional finite element method simulation of this model system was performed to quantitively analyze the concentration profiles of the electrogenerated species around the tip of the DCE and predict the concentrations of [Ru(bpy)3]2+* with various gap distances. The simulation results also proved that the higher concentrations of [Ru(bpy)3]2+* could be achieved with a smaller distance with a possible amplification factor of 6 (compared with the concentration when the gap distance is greater than 300 nm). This work provides an experimental model for further improvement of ECL efficiency and broadens the availability for annihilation ECL applications in small confined spaces.

Rational design and testing of abiotic stress-inducible synthetic promoters from poplar cis-regulatory elements.

Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic-related and salt stress-inducible synthetic promoters for use in hybrid poplar. De novo motif-detecting algorithms yielded 30 water-deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water-deficit stress motifs (SD18, SD13 and SD9) found in 16 co-expressed gene promoters, and we discovered a well-conserved motif for salt response (SS16). We characterized several native poplar stress-inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five-to-eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18-1, SD9-2, SS16-1, SS16-2 and SS16-3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18-1 and SD9-2 were induced by water-deficit stress, whereas SS16-1, SS16-2 and SS16-3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

Investigation of Dendrimer Transfer Behaviors at the Micro-Water/1,2-Dichloroethane Interface Facilitated by Dibenzo-18-Crown-6.

Trans-interfacial behaviors of multiple ionic species at the interface between two immiscible electrolyte solutions (ITIES) are of importance to biomembrane mimicking, chemical and biosensing, and interfacial molecular catalysis. Utilizing host-guest interaction to facilitate ion transfer is an effective and commonly used method to decrease the Gibbs energy of transfer of a target molecule. Herein, we investigated a facilitated ion transfer (FIT) process of poly(amidoamine)dendrimer (PAMAM, G0-G2) by dibenzo-18-crown-6 (DB18C6) at the microinterfaces between water and 1,2-dichloroethane (µ-W/DCE). Because of the host-guest interaction between a dendrimer and a ligand, negative shifts of the transfer potentials were observed using cyclic voltammetry or Osteryoung square wave voltammetry. From the FIT behavior of the dendrimer, we revealed that each DB18C6 could selectively coordinate with one amino group. We first evaluated the protonated status of the intermediate state (1:2) exactly under the conditions the dendrimer (G1) transfers across the interface using the electrochemical mass spectrometry (EC-MS)-hyphenated technique, which is much smaller than the protonated status in the water phase (1:8 to 14). Using the same methodology, we also studied the facilitated transfer behaviors of G0 and G2. Based on these results, we put forward the mechanism of the FIT process, which might involve a deprotonating process at the interface for higher-generation dendrimers.

Electrochemiluminescent Detection of Proteins Based on Fullerenols Modified Gold Nanoparticles and Triple Amplification Approaches.

In this work, fullerenols were found to be able to enhance the ECL signals of the luminol and H2O2 system and were employed for the first time as a reducing, catalyzing, and stabilizing agent in the one-step fast synthesis of fullerenols@AuNPs in only 5 min. First, the prepared fullerenols@AuNPs were applied to fabricate a label-free immunosensor for the detection of human cardiopathy biomarker (cardiac troponin I, cTnI). Second, using the fullerenols@AuNPs as biolabels to establish a sandwich-type immunosensor and catalyzing in situ copper-stained reaction to generate Cu particles capped on the fullerenols@AuNPs, and then a novel electrochemical stripping chemiluminescent (ESCL) method was developed for detection of cTnI and IgG with about 20 times more sensitive than the former one. At the process of ESCL detection, Cu2+was stripped from Cu@fullerenols@AuNPs with significant increase of the ECL signals. This can be attributed to the fact that the fullerenols@AuNPs nanoparticles and the Cu2+ have excellent conductivity and could facilitate the decomposition of H2O2 to generate various reactive oxygen species (ROSs), thereby accelerating the ECL process. Both immunosensors show high sensitivity and selectivity to cTnI and IgG detection with a wide linear range from fg/mL to ng/mL and the low limits of detection down to fg/mL for cTnI and IgG, respectively.

Electrochemiluminescence detection of cardiac troponin I based on Au-Ag alloy nanourchins.

In this work, an Au-Ag alloy nanourchin (Au-Ag alloy NU) based electrochemiluminescent (ECL) sensor for the measurement of cardiac troponin I (cTnI) was developed. The as-prepared Au-Ag alloy NUs exhibited higher specific surface area and better conductivity owing to their unique urchin-like morphology, which resulted in excellent electrocatalytic activity towards H2O2 in the luminol-H2O2 ECL system. We have found that the Au-Ag alloy NUs could enhance the ECL signal in the luminol-H2O2 solution. Based on these facts, a facile and label-free ECL immunosensor has been constructed for the analysis of cTnI, a cardiac biomarker, with a wide linear range of 3.5 pg mL-1-350 µg mL-1. This novel ECL immunosensor has good stability and reproducibility, showing potential application in clinical diagnostics. In addition, a non-enzymatic electrochemical sensor for H2O2 was also fabricated, with a wide linear detection range of 100 nM-200 µM, a low limit of detection of 45 nM and a fast response time (less than 2 s).

Detection of Phosphate in Human Blood Based on a Catalytic Hydrogen Wave at a Molybdenum Phosphide Modified Electrode.

Detection of inorganic phosphate is very important in environmental and health care applications. In this work, we found that phenomenon similar to "catalytic hydrogen wave" occurred on a molybdenum phosphide (MoP) modified electrode in the presence of phosphate, that is, a new wave of catalytic hydrogen evolution appeared before the normal hydrogen evolution reaction. The catalytic hydrogen wave arose from a structure similar to phosphomolybdic acid (noted as MoPO), which was formed by the interaction between phosphate and molybdenum oxides on the surface of the MoP modified electrode, resulting in the altered surface structure and adjusted interface catalytic activity. A novel phosphate electrochemical sensor was constructed based on this phenomenon with a linear range from 0.10 to 20.0 mmol·L-1, an actually determined minimum concentration of 0.030 mmol·L-1, and recoveries of 94%-107%, and this sensor was successfully applied to the detection of phosphate in human blood. Furthermore, this work proposes a new sensing method based on catalytic hydrogen waves on the modified electrodes.

In Situ Growing Triethanolamine-Functionalized Metal-Organic Frameworks on Two-Dimensional Carbon Nanosheets for Electrochemiluminescent Immunoassay.

A facile strategy for in situ growing triethanolamine (TEOA)-functionalized metal-organic framework (TEOA@MOF) on the two-dimensional graphene oxide (GO) or g-C3N4 nanosheets via the self-assembly technique was introduced. In this method, Zn2+ was first attached on the carbon nanosheets by electrostatic interaction; then, trimesic acid (H3btc) acted as the complex agent and TEOA as a base for the deprotonation of H3btc and a template, which leads to in situ growing the MOF on the carbon nanosheets obtaining a sandwich-like structure. Different types of surface analysis techniques were employed to characterize the GO-TEOA@MOFs and g-C3N4-TEOA@MOFs nanomaterials fabricated. The GO-TEOA@MOFs or g-C3N4-TEOA@MOFs nanomaterial-modified electrode brings out obviously enhanced electrochemiluminescence (ECL) behaviors due to numerous TEOA in the framework structures. Specifically, both TEOA and GO can serve as the co-reactants for the ECL system of Ru(bpy)32+ and have the synergic effect of enhancing the signal. Based on the GO-TEOA@MOFs modified electrodes, we developed a sensitive and rapid label-free ECL immunoassay strategy for human copeptin, and the linear range was 5 pg mL-1 to 500 ng mL-1 as well as the limit of detection was 360 fg mL-1. This work exhibits excellent specificity and good stability of the prepared immunosensor in the practical sample determination, demonstrating it can serve as a very promising method for the clinical diagnostics of acute myocardial infarction disease.

Mechanistic Study of Oxygen Reduction at Liquid/Liquid Interfaces by Hybrid Ultramicroelectrodes and Mass Spectrometry.

Proton-coupled electron transfer (PCET) reactions at various interfaces (liquid/membrane, solid/electrolyte, liquid/liquid) lie at the heart of many processes in biology and chemistry. Mechanistic study can provide profound understanding of PCET and rational design of new systems. However, most mechanisms of PCET reactions at a liquid/liquid interface have been proposed based on electrochemical and spectroscopic data, which lack direct evidence for possible intermediates. Moreover, a liquid/liquid interface as one type of soft interface is dynamic, making the investigation of interfacial reactions very challenging. Herein a novel electrochemistry method coupled to mass spectrometry (EC-MS) was introduced for in situ study of the oxygen reduction reaction (ORR) by ferrocene (Fc) under catalysis from cobalt tetraphenylporphine (CoTPP) at liquid/liquid interfaces. The key units are two types of gel hybrid ultramicroelectrodes (agar-gel/organic hybrid ultramicroelectrodes and water/PVC-gel hybrid ultramicroelectrodes), which were made based on dual micro- or nanopipettes. A solidified liquid/liquid interface can be formed at the tip of these pipettes, and it serves as both an electrochemical cell and a nanospray emitter for mass spectrometry. We demonstrated that the solidified L/L interfaces were very similar to typical L/L interfaces. Key CoTPP intermediates of the ORR at the liquid/liquid interfaces were identified for the first time, and the four-electron oxygen reduction pathway predominated, which provides valuable insights into the mechanism of the ORR. Theoretical simulation has further supported the possibility of formation of intermediates. This type of platform is promising for in situ tracking and identifying intermediates to study complicated reactions at liquid/liquid interfaces or other soft interfaces.