[Stimulation of DNA molecules association with amphiphilic derivatives of 1,3-diazaadamantane containing hydrophobic side chanins].

Earlier, a new class of compounds--amphiphilic derivatives of 1,3-diazaadamantanes, capable of facilitating the strand exchange in the system of short oligonucleotides was revealed. Longer hydrophobic side chains of 1,3-diazaadamantanes promoted stronger acceleration of the reaction. In this study, interaction with DNA of two 1,3-diazaadamantane derivatives containing different side chains was investigated by use of optical methods. Concentration of the investigated 1,3-diazaadamantans micelles formation were determined by the means of monitoring fluorescence intensity enhancement of 1-anilinonaphtalene-8-sulphonate probe; as well as the ranges of concentrations where the compounds/water mixtures existed as true solutions. 1,3-diazaadamantanes affinity to DNA was determined with Fluorescent Intercalator Displacement (FID) approach. Significant increase in hydrodynamic volume of short DNA hairpins in the complexes with 1,3-diazaadamantanes was revealed by estimation of the fluorescence polarization of ethidium bromide probe bound to the hairpins. Intermolecular association of DNA hairpins upon binding with 1,3-diazaadamantans was confirmed by Förster resonance energy transfer in system of an equimolar mixture of fluorescently labeled with Cy-3 and Cy-5 hairpins. In this study, the number of positive charges at 1,3-diazaadamantane derivatives containing side chains of different lengths was demonstrated to affect their affinity to DNA, whereas longer length of the hydrophobic side chains ensured more efficient interaction between the DNA duplexes that may facilitate, in particular, DNA strand exchange.

[G-quadruplex ligands: mechanisms of anticancer action and target binding].

Since the discovery of potential therapeutic value of quadruplex secondary nucleic acids structures, many compounds that stabilize these targets were found. Such progress became possible due to understanding of the structural features of G-quadruplexes. Quadruplex ligands selectively suppress the growth of tumor cells by indirect inhibition of the telomerase activity and/or attenuation of oncogenes' overexpression. Therapeutic effect demonstrated in vivo supports the prospect of such compounds for the development of the targeted anticancer drugs. This review reveals the significance of G-quadruplexes as therapeutic targets and focuses on biochemical properties of the low molecular weight quadruplex ligands.

[Complexes of antiparallel telomeric G-quadruplex d(TTAGGG)4 with carboxymethyl tetracationic porphyrins].

Porphyrins comprise a chemical class widely used in drug design. Cationic porphyrins may bind to DNA guanine quadruplexes. We report the parameters of binding of 5,10,15,20-tetrakis(N-carboxymethyl-4-pyridinium)porphyrin (P1) and 5,10,15,20-tetrakis(N-etoxy-carbonylmethyl-4-pyridinium)porphyrin (P2) to antiparallel telomeric G-quadruplex formed by d(TTAGGG)4 sequence (TelQ). The binding constants (K(i)) and the number of binding sites (N(i)) were determined from absorption isotherms generated from absorption spectra of complexes of P1 and P2 with TelQ. Compound P1 demonstrated a high affinity to TelQ (K1 = (40 +/- 6) x 10(6) M(-1), N1 = 1; K2 = (5.4 +/- 0.4) x 10(6) M(-1), N = 2). In contrast, the binding constants of P2-TelQ complexes (K1 = (3.1 +/- 0.2) x 10(6) M(-1), N1 = 1; K2 = (1.2 +/- 0.2) x x 10(6) M(-1), N2 = 2) were one order of magnitude smaller than the respective values for P2-TelQ complexes. Measurements of quantum yield and fluorescence lifetime of drug-TelQ complexes revealed two types of binding sites for P1 and P2 on the quadruplex oligonucleotide. The 'strong' complexes can result from interaction of the porphyrinswith TTA loops whereas the weaker complexes are formed with G-quartets. The altered TelQ conformation detected by circular dichroism spectra of P1-TelQ complexes can be explained by a disruption of a G-quartet. We conclude that peripheral carboxy groups contribute tothe high affinity of P1 for the antiparallel telomeric G-quadruplex.

[5,10,15,20-Tetra-(N-methyl-3-pyridyl)porphyrin destabilizes the anti-parallel telomeric quadruplex d(TTAGGG)4].

We studied the parameters of binding of 5,10,15,20-tetra-(N-methyl-3-pyridyl)porphyrin (TMPyP3) to the anti-parallel human telomeric G-quadruplex d(TTAGGG)4, the oligonucleotide dTTAGGGTTAGAG(TTAGGG)2 that does not form a quadruplex structure, as well as to the double stranded d(AC)8 x d(GT) and single stranded d(AC)8 and d(GT)8 DNAs. The analysis of absorption revealed that the binding constants and the number of DNA binding sites for TMPyP3 were d(AC)8 < d(GT)8 < d(AC)8 x d(GT)8 = d(TTAGGG)4 < dTTAGGGTTAGAG(TTAGGG)2. We demonstrated for the first time that the binding constant of TMPyP3 with the non-quadruplex chain dTTAGGGTTAGAG(TTAGGG)2 (1.3 x 10(7) M(-1)) is approximately 3 times bigger than the binding constant with the quadruplex d(TTAGGG)4 (4.6 x 10(6) M(-1)). Binding of two TMPyP3 molecules to d(TTAGGG)4 led to a decrease of thermostability of the G-quadruplex (deltaT(m) = -8 degrees C). Circular dichroism spectra of TMPyP3:d(TTAGGG)4 complexes revealed a shift of DNA structure from the G-quadruplex to an irregular chain. We hypothesize that partial destabilization of the telomeric G-quadruplex by TMPyP3 might be a reason for relatively low potency of this ligand as a telomerase inhibitor, as well as its marginal cytotoxicity for cultured tumor cells.

[Intramolecular G-quadruplexes from microsatellite d(GT)12 sequence in the presence of K+].

Polymorphic d(GT)n microsatellite sequences are known to drastically affect genes expression. By use of CD spectroscopy, UV melting, fluorescence polarization of EtBr probe and FRET, we detected formation of a new fold with three G-quartets by d(GT)12 oligonucleotide in 0.01 M Na phosphate buffer, pH 8.0, in the presence 0.1 M KCl. Monomolecular type of the structure was verified with measurements of rotational relaxation time (p = 28 +/- 0.5 ns) of EtBr:d(GT)12 complex. CD spectra supported G-quartets formation. A distance between FITC, covalently attached to 5'-end of d(GT)12, and intercalated EtBr molecule was estimated using FRET (R < or =17 A). These data are in agreement with the proposed self folding of d(GT)12.

[Complexes of telomeric oligonucleotide d(TTAGGG)4 with the new recombinant protein PGEk--nucleic acid carrier into proliferating cells].

The complexation of the new protein vector PGEk--a carrier of nucleic acids into proliferating cells with phosphodiester d(TTAGGG)4 (TMO) and phosphorothioate Sd(TTAGGG)4 (TMS) telomerase inhibitor oligonucleotides was studied. PGEk molecule, consisting of 64 amino acids, is comprising the sequence of the human epidermal growth factor EGFh which is hydrophobic cell targeting moiety serving for receptor-mediated endocytosis and an NLS (nuclear localization signal) which is hydrophilic serving as a DNA-binding and selective nuclear import moiety. Experiments were carried out in 0.01 M Na-phosphate buffer contained 0.1 M NaCl, pH 7.8 at 37 degrees C. CD spectral analysis revealed that TMO molecules folded back into intramolecular antiparallel G-quadruplex while TMS molecules were represented as unstructured thread. The number of adsorbed PGEk molecules were estimated using PGEk intrinsic fluorescence decrease and fluorescence polarization increase of PGEk under oligonucleotide titration. Adsorption isotherms were plotted in Scatchard coordinates. We have shown that adsorption of the first two PGEk molecules on TMO and TMS occurs noncooperatively with the high association constants K1(TMO) = (7 +/- 1) x 10(7) M(-1) and K1(TMS) = (3 +/- 0.5) x 10(7) M(-1), respectively. Further adsorption up to 5-6 PGEk molecules on TMO occurrs cooperatively with still high association constant K2(TMO) = (4.0 +/- 1.5) x 10(6) M(-1). TMS oligonucleotide binds the third PGEk molecule rather weakly, K2(TMS) = (8 +/- 2) x 10(5) M(-1). CD spectral analysis revealed that G-quadruplex structure formed by TMO have undergone a partial unfolding by binding of PGEk molecules while single-stranded structure formed by TMS was not affected by binding PGEk. Thus, the tertiary structure of DNA and the number of adsorbed PGEk molecules formed biologically active compounds PGEk: TMO and PGEk: TMS were defined, which are able to penetrate through the membrane of proliferating cells and to suppress their growth.

[Parallel-stranded DNA with natural base sequences]. / Parallel'naia DNK s prirodnymi posledovatel'nostiami osnovanii.

Noncanonical parallel-stranded DNA double helices (ps-DNA) comprising natural nucleotide sequences are usually second in stability to antiparallel-stranded (aps) canonical DNA structures, which ensures reliable cell functioning. However, recent data indicate a possible role of ps-DNA in DNA loops or in trinucleotide repeats connected with neurodegenerative diseases. The review surveys recent studies on the effect of nucleotide sequence on preference of one or other type of DNA duplex. (1) Ps-DNA with mixed AT/GC composition was found to have conformational and thermodynamic properties drastically different from those of Watson-Crick double helix. Its stability depends strongly on the specific sequence in a manner peculiar to the ps double helix, because of the energy disadvantage of the AT/GC contacts. The AT/GC boundary facilitated flipping of A and T out of the ps double helix. Proton acceptor groups of bases are exposed into the both grooves of the ps-DNA and are accessible to solvent and ligands, including proteins. (2) DNA regions containing natural minor bases isoguanine and isomethylcytosine were shown to form ps-DNA with transAT-, trans isoGC, and trans iso5meCG pairs exceeding in stability a related aps duplex. (3) Nucleotide sequence dG(GT)4G from yeast telomeres and microsatellites was demonstrated to form novel ps-DNA with GG and TT base pairing. Unlike d(GT)n and d(GnTm) sequences able to form quadruplexes, the dG(GT)4G sequence formed no alternative double- or multistranded structures in a wide range of experimental conditions, thus suggesting that the nucleotide context governs the observed structural polymorphism of the d(GT)n sequence. The possible biological role of ps-DNA and the prospects of its study are discussed.

[Fluorescence of meso-tetrakis(4-(carboxy)phenyl)porphine covalently bound to oligonucleotides d(CG)5 and d(TA)5]. / Fluorestsentsiia mezo-tetrakis(4-(karboksi)fenyl)porfina, kovalentno sviazanogo s oligonukleotidami d(CG)5 i d(TA)5.

The amino-reactive derivative of tetraphenylporphine meso-tetrakis[4-(carboxy)phenyl]porphine (TCPP) was synthesized, which is characterized by a high molar absorption coefficient (epsilon 416 = 36,500 M-1.cm-1). TCPP was covalently attached to oligonucleotides d(CG)5 [d(CG)5-TCPP] and d(TA)5 [d(TA)5-TCPP]. The spectral characteristics of these complexes were studied in 0.01 M phosphate buffer, pH 7 at 23 degrees C. UV-visible absorption spectra of these complexes have a clearly pronounced Soret band at (414 +/- 1) nm for d(CG)5-TCPP and at (412 +/- 1) nm for d(TA)5-TCPP. The fluorescence spectra of these complexes have maxima at (648 +/- 2) nm for d(CG)5-TCPP and at (658 +/- 2) nm for d(TA)5-TCPP. In this study we also determined fluorescence quantum yields q and fluorescence lifetimes tau [q = 0.099 +/- 0.011, tau = (9.0 +/- 0.3) ns for d(CG)5-TCPP and q = 0.080 +/- 0.011, tau = (8.7 +/- 0.3) ns for d(TA)5-TCPP]. A temperature rise from 5 to 50 degrees C produced only slight (within 23%) emission changes in both samples studied. Taking into account: a) high fluorescence yields (q), b) weak dependence of q on temperature, c) weak q dependence of q on the oligonucleotide type, we conclude that TCPP may be used as a sensitive fluorescence label in DNA studies.

[Conformational polymorphism and extensibility of DNA quadruplexes formed from d(GT)n repeats]. / Konformatsionnyi polimorfizm i rastiazhimost' kvadrupleksov DNK, obrazovannykh iz d(GT)n povtorov.

We showed earlier that oligonucleotides 3'-d(GT)5-pO(CH2CH2O)3p-d(GT)5-3' form bimolecular quadruplexes with parallel orientation of their strands, which are held by guanine quartets alternating with unpaired thymines (GT quadruplex). This work deals with the conformational polymorphism and extensibility of G quadruplexes in complex with molecules of an intercalating agent ethidium bromide (EtBr). A cooperative mechanism of EtBr binding to the GT quadruplex was revealed. The binding constant K = (3.3 +/- 0.1) x 10(4) M-1, cooperativity coefficient omega = 2.5 +/- 0.2, and maximal amount of EtBr molecules intercalated in GT quadruplex (N = 8) were determined. It was proved experimentally by analysis of adsorption isotherms and theoretically by mathematical modeling that the GT quadruplex is capable of double extension, which is indicative of the high elasticity of this four-stranded helix. Two most stable conformations of GT quadruplexes with thymine residues intercalated and/or turned outside were found by mechanico-mathematical modeling. The equilibrium is shifted toward the conformation with the looped out thymine residues upon intercalation of EtBr molecules into the GT quadruplex.

[A triple-stranded "clip" from the oligonucleotide 3'-(dA)10-pO(Ch2Ch2O)3p-(dT)10-pO(CH2CH2O)3-p-(dT)10(-5)]. / Trekhtsepochechnaia "skrepka" iz oligonukleotida 3'-(dA)10-pO(CH2CH2O)3p-(dT)10-pO(CH2CH2O)3p-(dT)10(-5).

The temperature dependence of the UV- and CD-spectra of the oligonucleotides 3'-d(A)10-L-(T)10-5' [anti(AT)], 3'-d(A)10-L-d(T)10-3' [par(AT)] and 3'-d(A)10-L-(dT)10-L-(dT)10-5' [tripl(ATT)] (L = -PO(CH2CH2O) 3p-) in the phosphate buffer at pH 7 under different concentrations of NaCL and in the presence or absence of 0.01 M MgCl2 was studied. All registered structural changes are the result of intramolecular processes if the concentrations of the oligonucleotides is low (about 2.2.10(-5) M). Par(AT) and anti(AT) exist in the only two forms, transforming into each other: under low temperatures they exist as hairpins with the parallel or antiparallel orientation of chains accordingly which transform into unfolded chains when the temperature increased. In contrast trip(ATT) exists in the three different forms depending on the temperature and ion conditions. They are: the three- stranded clip, the two-stranded hairpin with a single stranded "tail" and completely unfolded chain. For the first time this work presents thermodynamic parameters of the triplex formation from deoxyoligonucleotides depending on NaCl concentration. We have registered the CD spectra to one-, two-, and three-stranded forms. Ethidium bromide binding to three-stranded "clip" was investigated, and it was established that molecules of the dye may intercalate into the "clip" with formation of stable complexes (the constant of association 10(6) M-1). It is maximum three molecules of ethidium bromid which may bound to one molecule of the three-stranded clip. It has been shown that the suggested synthetic model (three oligonucleotide blocks combined by hydroxyalkyl chains) is the most convenient for physico-chemical investigations of triplexes today.

[Conformational transition of parallel DNA in solutions with decreased water activity]. / Konformatsionnyi perekhod parallel'noi DNK v rastvorakh s ponizhennoi aktivnost'iu vody.

Conformations of parallel deoxyoligonucleotides 5'd(CTATAGGGAT)3'/5'd(GATATCCCTA)3' and 5'd(TGATTGATCGATTGTTTGCATGCACACGTTTTTGTGAGCG)3'/'5'd (ACTAACTAGCTAACAAACGTACGTGTGCAAAAACACTCGC)3' were studied in solution by CD method. A cooperative change in the CD spectra is observed in trifluoroethanol (TFE) solutions at decreased water activity (relative humidity). This distinctive change is supposed to stem from a cooperative conformational transition of parallel double helix from a B-like form with C2'endo sugar conformation to a A-like form designated as Ap. The free energy difference between Ap- and B-like conformations of the parallel decaduplex is close to that for antiparallel decaduplex with the nucleotide sequence studied. A-phility of a parallel helix is dependent on its sequence.

[Structure of d(GT)n repeating sequences with parallel and antiparallel chains]. / Struktura povtoriaiushchikhsia posledovatel'nostei d(GT)n s parallel'nymi i antiparallel'nymi tsepiami.

The ability of oligonucleotides 3'-d(GT)5pO(CH2)5Opd(GT)5-5' (anti[d(GT)]) and 3'-d(GT)5pO(CH2)6Opd(GT)5-3' (par[d(GT)]) to form hairpins and higher associates is studied. Optical methods of thermal denaturation and circular dichroism as well as the fluorescence of ethidium bromide and acridine orange bound to oligonucleotides were used. At room temperatures the formation of hairpin structure with parallel and antiparallel strands is possible. Thermodynamic parameters of par[d(GT)] and anti[d(GT)] are similar and equal to delta H = -15 kcal/mol, delta S = -50 cal/mol. deg. In the temperature range 3-10 degrees C par[d(GT)] and anti[d(GT)] form four-stranded structures with parallel chains, in which layers of four G-residues alternate with unpaired T-residues being bulged out easily. On comparison of occurrence of alternating (GT)n, (GC)n and (G)n sequences in genome it can be stated that (GT)n biological functions could be connected with conformational possibilities of the four-stranded parallel structures with unpaired T-residues.

[Parallel double DNA spiral. A conformational analysis of regular spirals of poly(dA).poly(dT) with different variations of joining bases]. / Parallel'nye dvoinye spirali DNK, konformatsionnyi analiz reguliarnykh spiralei poli(dA).poli(dT) s razlichnymi variantami sviazyvaniia osnovanii.

We have performed a conformational analysis of DNA double helices poly(dA).poly(dT) with parallel directed backbone strands in heteronomic model frames. All possible models of base pairs and various mutual orientation of base pair and sugarphosphate backbones were checked. By the potential energy optimization the dihedral angles and helices parameters of stable conformations of parallel double polynucleotides were calculated. The dependences of conformational energy on the base pair structure were studied.

[Four-stranded DNA. Conformational analysis of regular spirals of poly(dT).poly(dA).poly(dA).poly(dT) with different base binding variations]. / Chetyrekhtsepochechnye spirali DNK. Konformatsionnyi analiz reguliarnykh spiralei poli(dT).poli(dA).poli(dA).poli(dT) s razlichnymi variantami sviazyvaniia osnovanii.

Conformational analysis of four stranded DNA helices poly(dT).poly(dA).poly(dA).poly(dT) with parallel arrangement of the identical sugar-phosphate chains connected by twofold symmetry has been performed. All possible models of symmetrical base binding were checked. By the potential energy optimization the dihedral angles and helices parameters of stable conformations of four stranded polynucleotides were calculated. The dependences of conformational energy on the base complex structure and mutual orientation of the poly(dA).and poly(dT) chains were studied. Possible biological functions of four stranded helices are discussed.