RESUMO
A promising growth vector of food protein production in the context of the Russian Federation's food sovereignty security is the use of microbial synthesis. Taking into consideration the proven promising use of biotechnological processes in the production of alternative protein sources, modern scientific research is focused, among other issues, on improving the technology of obtaining food microbial protein using a variety of substrates and strains-producers, as well as evaluating the consumer properties, food, biological value and safety of such products. The purpose of the research was to study and comparatively evaluate protein concentrate (PC) from bacteria Methylococcus capsulatus and basic food of animal and plant origin within the development of the technology of optimal in nutritional and biological value PC production. Material and methods. Analysis of the nutritional and biological value of PC obtained from denucleinized and purified from cell walls biomass of methanoxidizing bacteria Methylococcus capsulatus (strain GSB-15) was carried out on 46 indicators, including estimation of protein content and amino acid composition, fat content and fatty acid composition, ash and moisture. Biological studies based on measuring of net protein ratio / net protein utilization were performed on 28 growing (between 25-50 days of life) male Wistar rats. Rats in the control group (n=14) received a semi-synthetic casein diet with a protein content of ~12% in calories, the test group (n=14) received a diet including an equivalent amount of PC protein. Body weight, feed intake, and fecal and urine nitrogen losses were measured during the experiment. The biological value and digestibility of protein were judged by coefficients of protein efficiency ratio, net protein ratio, true protein digestibility, true protein biological value, true net protein utilization. Results. The nutritional value study of PC showed high protein content - 69.0%, the share of fat, moisture and ash, accounted for 0.17, 9.5 and 14.4%, respectively. The carbohydrate content was 7.0% (of which mono- and disaccharides were <0.1%). The results of a comparative assessment of Methylococcus capsulatus protein amino acid profile and basic food of animal and plant origin showed a balanced content of the most amino acids, the level of which is comparable with the protein of chicken egg, which is traditionally a standard of quality of complete protein. At the same time, the content of the essential amino acid tryptophan in PC was an order of magnitude lower than in chicken egg protein; the content of this amino acid in PC is comparable with incomplete plant proteins (sunflower, flax, rapeseed). The results of the biological value evaluation of the Methylococcus capsulatus protein in the experiment on rats indicate a relatively low biological value of the microbial synthesis protein, that is caused, most likely, by tryptophan deficiency. Rats of the test group had a significant decrease in body weight gain, feed/protein intake, coefficient of protein efficiency ratio, coefficient of net protein ratio, true protein biological value, true net protein utilization. Conclusion. The results of a comparative evaluation of PC from methanotrophic bacteria Methylococcus capsulatus denucleinized biomass and basic food of animal and plant origin indicate its relatively high nutritional value. However, the characteristics of this PC sample were not optimal in regard of protein biological value by reason of tryptophan deficiency. A single amino acid deficiency is not a valid argument for not using microbially synthesized protein in human nutrition, considering the capabilities of the modern food industry, including ways to enrich foodstuffs with missing components. In addition, there is every cause to believe that adjusting the hydrolysis technology used in the production of PC will allow to eliminate the essential amino acid loss, thereby increasing the biological value of this product.
Assuntos
Methylococcus capsulatus , Humanos , Animais , Ratos , Ratos Wistar , Triptofano , Aminoácidos , Aminoácidos Essenciais , Bactérias , Peso Corporal , GalinhasRESUMO
Forwarding development of identification methods for novel foods, derived from edible insects, is necessary to ensure control over their marketing within the framework of the current legislation's requirements. The purpose of the research was the development and validation of a monoplex TaqMan-PCR assay protocol (a real-time polymerase chain reaction with TaqMan technology) for the insect Hermetia Illucens' taxon-specific DNA detection and identification in food raw materials and foods. Material and methods. Studies were performed using samples containing the target DNA sequence (dried whole larvae of H. Illucens as well as H. Illucens in oilcake meal and powdered capsule forms) and inherently not containing the target DNA sequence (other insect species, mammals, plants, microorganisms as well as multicomponent food: meat, dairy and plant food). DNA extraction and purification were performed by CTAB methods [commercial kits "Sorb-GMO-B" (Syntol, Russia) and "DNeasy mericon Food Kit" (QIAGEN, Germany)]. For amplification of the target sequence, which was a fragment of the cytochrome c oxidase subunit I mitochondrial gene, we used primers and the probe: Hei-COI-F (CCTGAGCTGGTATAGTGGGAAC); Hei-COI-R (AATTTGGTCATCTCCAATTAAGC); Hei-COI-P (FAM-CGAGCCGAATTAGGTCATCCAGG-BHQ-1). PCR conditions were optimized using CFX96TM Real-Time PCR System (Bio-Rad, USA) and Rotor-Gene Q (QIAGEN, Germany) amplifiers by empirical selection of primer and probe concentrations and amplification of the time/temperature profile. Specificity and limit of detection were evaluated as part of method validation. Results and discussion. The optimized reaction mixture included 2.5-fold of Master Mix B [KCl, TrisCl (pH 8.8), 6.25 mM MgCl2], SynTaq DNA-polymerase, dNTP, glycerol, Tween 20, of each primers - 550 nM, probe - 100 nM. The time/temperature profile of the reaction: 95 °C - 180 s (95 °C - 15 s, 57 °C - 60 s), 40 cycles. The detection limit of the method was 0.19 ng of H. illucens DNA per reaction. The specificity of primer system and probe were experimentally confirmed in studies with DNA of other insects, animals, plants and microorganisms. Conclusion. A protocol of a monoplex TaqMan-PCR assay for the taxon-specific DNA of insect Hermetia Illucens' detection and identification in food raw materials and foods has been developed. Validity of the method has been confirmed by laboratory tests which allows to recommend it for use in surveillance of Hermetia Illucens-derived raw materials.
Assuntos
Dípteros , Insetos , Animais , Carne , Glicerol , Reação em Cadeia da Polimerase em Tempo Real , MamíferosRESUMO
Liver morphology, intensity of apoptosis, and activity of xenobiotic metabolism enzymes were studied in a chronic model experiment in rats receiving a mixture of 6 pesticides against the background of life-long diets with adequate and insufficient supply of water-soluble vitamins. The dose of each pesticide in the mixture did not exceed the acceptable daily intake (1 ADI). It was found that chronic exposure to low doses of anthropogenic toxicants in combination with permanent vitamin deficiency provokes a number of liver changes, such as increased apoptosis activity, cytochrome P450 system depletion, steatosis, and inflammatory infiltration, which is a potential health risk factor.
Assuntos
Deficiência de Vitaminas , Fígado , Ratos , Animais , Fígado/metabolismo , Deficiência de Vitaminas/metabolismo , Vitaminas , Sistema Enzimático do Citocromo P-450/metabolismo , Biomarcadores/metabolismoRESUMO
A high protein content in the insect biomass allows to classify this product as a very promising source of protein, comparable in nutritional and biological value with proteins of animal origin. Despite a long history of safe use, in some countries insects are considered a new type of food which safety must be proven before entering the food market. The long-term Russian experience in novel food's research allows to identify the crucial stages, among which, along with toxicological and allergological tests, the protein's biological value determination takes an important place. The conclusion about the biological value of protein is formed on the basis of integrated use of chemical and biological methods, which gist comes down to the study of the nitrogen balance in the growing organism (biological method) and the calculation of the amino acid score (chemical method). The aim of the research was the comprehensive assessment of Black soldier fly (Hermetia illucens) larvae protein's biological value using chemical and biological methods. Material and methods. Biological studies based on measuring of net protein ratio/net protein utilization were performed on 28 growing (between 25-50 days of life) male Wistar rats, with an initial body weight of ~65.5±1.2 g. Rats in the control group (n=14) received a semi-synthetic casein diet with a protein content of ~12% in calories, the test group (n=14) received a diet including an equivalent amount of H. illucens protein. The diet's ingredients were replaced with the consideration of the proteins, fats, and carbohydrates content in the included product following the principle of isocaloricity and isonitrogenicity (by mass fraction of total nitrogen). H. illucens biomass and casein in the test and control groups, respectively, were the main significant sources of nitrogen in the diet. Body weight, feed intake, and fecal and urine nitrogen losses were measured during the experiment. The biological value and digestibility of protein were judged by coefficients of protein efficiency ratio, net protein ratio, true protein digestibility, true protein biological value, true net protein utilization. Chemical studies included studies of the amino acid composition of H. illucens biomass protein and calculation of the digestible indispensable amino acid score (DIAAS). Results. The general condition of animals of the both groups during the whole experiment was satisfactory, the weekly body weight increase corresponded to the level of growth typical for Wistar rats, intergroup differences were not detected. Despite the fact that in a number of indicators the test group animals differed from the control [there were noted a decrease of the net protein ratio (by 5%, p>0.05), true protein digestibility (by 11%, p<0.05), net protein utilization (by 13%, p<0.05), caused by increased excretion of nitrogen with urine (by 8%, p>0.05) and feces (by 186%, p<0.05), with the same amount of nitrogen intake], the test rats' growth rate and the nitrogen's retention degree indicate a relatively high biological value of insect protein. According to the DIAAS, H. illucens protein is characterized by high content of histidine, threonine, valine, isoleucine and leucine (DIAAS=100 and more), and is also a source of sulfur-containing amino acids - methionine and cysteine (DIAAS=86) and lysine (DIAAS=97). Conclusion. The comprehensive studies of Hermetia illucens larvae protein's biological value demonstrated a high protein content, its balanced amino acid composition and high biological value, which allows to consider Hermetia illucens as a potential source of complete dietary protein.
Assuntos
Ração Animal , Dípteros , Ração Animal/análise , Animais , Dieta , Larva/química , Masculino , Ratos , Ratos WistarRESUMO
Recent years a worldwide interest in the use of alternative sources of protein, in particular, protein from insects, has increased. Edible insects for thousands of years have been a part of the human diet in Asian-Pacific region and South America, while in the European Union, the USA and Canada the use of insects for food purposes is a modern trend that is determined by the care of the environment, global warming combating, etc. Thus, the legal rules governing the food use of insects have significant differences among countries. In the Eurasian Economic Union requirements to food are regulated by the Customs Union Technical Regulations. Since none of the Technical Regulations contains the name of such food as "products obtained with the use of insects", these products may be classified as "food products of novel type" which are subjected to state registration. Fundamental and applied research should be conducted as a part of this novel food safety assessment system, that include the determination of nutritional and biological value of food raw materials derived from insects, and toxicological, reprotoxicological, allergological experiments in vivo on several generations of laboratory animals. The aim of the research was studying and comparing the nutritional and biological values of Hermetia illucens larvae dry biomass and basic foodstuffs of animal and plant origin. Material and methods. Nutritional and biological value analysis of H. illucens minced dry larvae biomass, dried at 110-120 °C, was carried out on 83 indicators, which included determination of protein content and amino acid composition, determination of fat level and fatty acid composition, determination of the content of carbohydrates, vitamins, minerals and trace elements, ash and moisture. Results. A study of the nutritional value of dry larvae biomass showed high levels of protein and fat (39 and 38%, respectively), while ash, dietary fiber and carbohydrate accounted for less than 20%. The amino acid profile had a balanced content of essential amino acids and was comparable to the protein of a hen's egg, as well as other animal products. The fatty acid composition of the biomass was characterized by a relatively high content of lauric acid (39.9% of the total fatty acid content), also found in some fruits and seeds of tropical plants; the ratio of other acids was more consistent with the fatty acid profile of fish oil. The dry larvae biomass contained carotenoids (0.23 mg/100 g), tocopherol (3.1 mg/100 g) and thiamine (53 µg/100 g) in amounts significantly lower to those of foods, which traditionally are sources of these vitamins. Based on the analysis of the mineral composition, the H. illucens biomass can be attributed to the sources of calcium, iron, copper and chromium. In terms of the content of the above elements, as well as magnesium and zinc, dry biomass significantly exceed the main food products of animal origin (beef, eggs, fish and seafood), and in terms of the content of potassium and phosphorus, it was comparable to them. Conclusion. The results of dry larvae biomass comparative evaluation with the basic foodstuffs of animal and plant origin evidence to its high nutritional and biological value, allowing to consider H. illucens as a promising source of complete protein, lauric acid, minerals and trace elements.
Assuntos
Galinhas , Dípteros , Animais , Biomassa , Bovinos , Dieta , Feminino , Humanos , LarvaRESUMO
The modern strategy of humanity food providing is aimed at finding the exit from the food crisis in the shortest possible time, by the end of XXI century food and feed production should increase by at least 70%. These tasks solution implies not only the use of science-oriented technologies, but also the expansion of the food base by means of novel food sources, which don't have a history of safe use. In the Russian Federation the formation of novel food's safety assessment approaches is regulated at the state level and is the most important requirement for the possibility of usage. Russian experience of the second half of the XX century in the area of novel food sources' biomedical research unites two stages. The first of them dates back to the middle of the 1960s', when the Soviet scientists, in particular, the workforce of the Institute of Nutrition of the USSR Academy of Medical Sciences, under the leadership of Academician A.A. Pokrovskii, have developed the evaluation approaches of the biological value and safety of microbial synthesized protein. The second stage of the safety assessment research development was the work with the genetically modified organisms of plant origin (GMO), that begun in the middle of the 1990s'. Since the moment of formation in 1995-1996, 9 methodical guidelines that regulate methods of safety assessment and control over GMO have been developed. Comprehensively formed by 2020, safety assessment system has been used in the framework of 27 GMO lines state registration that passed a whole cycle of medical and biological research and were allowed for use in nutrition of the population of the Eurasian Economic Union. Within the framework of these research a considerable amount of factual material has been accumulated, a regulatory and methodological basis has been built, and a substantial background for further fundamental and applied scientific research in the field of development and safety assessment of novel food has been created.
Assuntos
Inocuidade dos Alimentos , Alimentos Geneticamente Modificados , Legislação sobre Alimentos , Alimentos Geneticamente Modificados/história , Alimentos Geneticamente Modificados/normas , História do Século XX , História do Século XXI , Humanos , Legislação sobre Alimentos/história , Legislação sobre Alimentos/tendências , Medição de Risco , Federação RussaRESUMO
Activity of apoptosis in the thymus, liver, and kidneys on days 20, 22, 35, 50, 80, 110, and 140 of ontogeny was studied in the experiments on rats using the alkaline gel electrophoresis and flow cytofluorometry. Changes in apoptosis intensity depended on animal age. The maximum level of this parameter was observed on day 20 of ontogeny with the following reduction in this parameter to the minimum value on days 35-50. Then it gradually increased up to relatively high levels on day 110 and significantly reduced by day 140.
Assuntos
Envelhecimento/fisiologia , Apoptose/fisiologia , Células Eucarióticas/fisiologia , Rim/fisiologia , Fígado/fisiologia , Timo/fisiologia , Animais , Animais Recém-Nascidos , Peso Corporal , Células Eucarióticas/citologia , Feminino , Feto , Rim/citologia , Cinética , Fígado/citologia , Masculino , Gravidez , Ratos , Ratos Wistar , Fatores Sexuais , Maturidade Sexual/fisiologia , Timo/citologiaRESUMO
The article presents the results of the study aimed at confirmation of the effectiveness of the rats' adaptive potential reduction under conditions of cadmium salt toxic effects. The 65-days experiment was conducted in male and female Wistar rats. Animals were divided into 6 groups of 3 control and 3 experimental, 30 males and females in each. In total 360 rats were used in the experiment (180 females and 180 males). Rats of the 1st control group received a diet with optimal (75% of the standard semisyntethic diet content) dosage of vitamins B1, B2, B3, B6 and mineral substances, Fe3+ and Mg2+, the rats of the 2nd and the 3rd control group - diets with marginal (30% for males and 28% for females) and submarginal (19% for males and 18% for females) doses of essential micronutrients. Animals of the 1-3th experimental groups received Cd2+ on the background of optimal, marginal and submarginal providing of essential micronutrients. The hematological, biochemical and morphological parameters and the antioxidant status of rats have been studied. The obtained results allowed to identify patterns of cadmium toxic effect strengthen on the background of essential nutrients reducing (in the row from optimal to submarginal). These changes showed erythrocyte and platelet blood profiles, and a set of indicators of the antioxidant defense system and lipid peroxidation of blood and liver. Thus, the activity of erythrocyte antioxidant enzymes - glutathione reductase, glutathione peroxidase, catalase and superoxide dismutase in rats of the 1st experimental group were on average by 23% higher than in animals of the 1st control group, the rats of the 2nd and the 3rd experimental groups by 62 and 67% higher, respectively. The content of lipid peroxidation products in blood and liver of male and female rats showed a similar trend: an increase by 5% in the 1st experimental group by 9 and 25% in the 2nd and 3rd experimental groups respectively. Thus, the modification of the diets' vitamin-mineral composition may be used as a model of adaptive potential reduction in rats in the toxicological research of objects with unknown toxicity, in particular novel food products.
Assuntos
Antioxidantes/metabolismo , Intoxicação por Cádmio/sangue , Minerais/sangue , Caracteres Sexuais , Deficiência de Vitaminas do Complexo B/sangue , Animais , Modelos Animais de Doenças , Feminino , Ferro/sangue , Magnésio/sangue , Masculino , Oxirredutases/sangue , Ratos , Ratos Wistar , Complexo Vitamínico B/sangueRESUMO
This publication presents the results of research that was aimed at elaboration of adaptive potential reducing model, intended for toxicological experiments. Two series of research (with a duration of 70 days each) were conducted on Wistar rats. In the 1st series five groups of animals received diets with 100, 75,50,25 and 0% of vitamins B1, B2, B3, B6 and minerals(Fe3+ and Mg2+); in the 2nd series four groups of animals received diets with 21.37, 9.94, 4.62, 2.15% of this vitamins and minerals. In the 1st series of studies the intervals of maximum, medium and minimum content of essential nutrients in the diet was established; in the 2nd series the range of the lowest possible concentrations of these elements that provided the lowest level of adaptive potential and not causing the pathology development was determined. The certain set of hematological, biochemical, immunological and other indicators were investigated, this article analyzes the results of zoometric studies, mortality of animals, as well as the results of antioxidant status (activity of superoxide dismutase, catalase, glutathione peroxidase, glutathione reductase and malondialdehyde content in red blood cells) studies. Based on the evaluation of the data which were obtained in the 1st series, it follows that a dose reduction of relevant essential nutrients to 25% didn't significantly affect the values of the studied indicators, and the complete elimination of these substances resulted in massive death of animals. In the 2nd series a significant differences between the groups were observed from the range of increased mortality (groups with 2.15 and 4.62% content of essential nutrients) to the range of deviations from central tendency of some parameters (group with 21.37% content). The data allowed to trace the dependence of these differences on the levels of vitamins and minerals in the diet. The results were used to determine threshold values of vitamins and minerals that provided the necessary reduction of the adaptive potential level in male and female rats. Taking into account the risk of pathology development, three dosages of essential substances have been established - optimal, marginal and submarginal, which provide consistent decline of adaptive potential of laboratory animals: 75, 30 and 19% for males and 75, 28 and 18% for females, respectively. The modification of vitamin and mineral composition of the diet can be used as a model of adaptive potential reduce in toxicological research.