Acute exercise and motor memory consolidation: Does exercise type play a role?

A single bout of high-intensity exercise can augment off-line gains in skills acquired during motor practice. It is currently unknown if the type of physical exercise influences the effect on motor skill consolidation. This study investigated the effect of three types of high-intensity exercise following visuomotor skill acquisition on the retention of motor memory in 40 young (25.3 ±3.6 years), able-bodied male participants randomly assigned to one of four groups either performing strength training (STR), circuit training (CT), indoor hockey (HOC) or rest (CON). Retention tests of the motor skill were performed 1 (R1h) and 24 h (R1d) post acquisition. For all exercise groups, mean motor performance scores decreased at R1h compared to post acquisition (POST) level; STR (P = 0.018), CT (P = 0.02), HOC (P = 0.014) and performance scores decreased for CT compared to CON (P = 0.049). Mean performance scores increased from POST to R1d for all exercise groups; STR (P = 0.010), CT (P = 0.020), HOC (P = 0.007) while performance scores for CON decreased (P = 0.043). Changes in motor performance were thus greater for STR (P = 0.006), CT (P < 0.001) and HOC (P < 0.001) compared to CON from POST to R1d. The results demonstrate that high-intensity, acute exercise can lead to a decrease in motor performance assessed shortly after motor skill practice (R1h), but enhances offline effects promoting long-term retention (R1d). Given that different exercise modalities produced similar positive off-line effects on motor memory, we conclude that exercise-induced effects beneficial to consolidation appear to depend primarily on the physiological stimulus rather than type of exercise and movements employed.

FYVE zinc-finger proteins in the plant model Arabidopsis thaliana: identification of PtdIns3P-binding residues by comparison of classic and variant FYVE domains.

Classic FYVE zinc-finger domains recognize the phosphoinositide signal PtdIns3P and share the basic (R/K)(1)(R/K)HHCR(6) (single-letter amino acid codes) consensus sequence. This domain is present in predicted PtdIns3P 5-kinases and lipases from Arabidopsis thaliana. Other Arabidopsis proteins, named PRAF, consist of a pleckstrin homology (PH) domain, a regulator of chromosome condensation (RCC1) guanine nucleotide exchange factor repeat domain, and a variant FYVE domain containing an Asn residue and a Tyr residue at positions corresponding to the PtdIns3P-interacting His(4) and Arg(6) of the basic motif. Dot-blot and liposome-binding assays were used in vitro to examine the phospholipid-binding ability of isolated PRAF domains. Whereas the PH domain preferentially bound PtdIns(4,5)P(2), the variant FYVE domain showed a weaker charge-dependent binding of phosphoinositides. In contrast, specificity for PtdIns3P was obtained by mutagenic conversion of the variant into a classic FYVE domain (Asn(4),Tyr(6)-->His(4),Arg(6)). Separate substitutions of the variant residues were not sufficient to impose preferential binding of PtdIns3P, suggesting a co-operative effect of these residues in binding. A biochemical function for PRAF was indicated by its ability to catalyse guanine nucleotide exchange on some of the small GTPases of the Rab family, permitting a discussion of the biological roles of plant FYVE proteins and their regulation by phosphoinositides.

Promiscuous and specific phospholipid binding by domains in ZAC, a membrane-associated Arabidopsis protein with an ARF GAP zinc finger and a C2 domain.

Arabidopsis proteins were predicted which share an 80 residue zinc finger domain known from ADP-ribosylation factor GTPase-activating proteins (ARF GAPs). One of these is a 37 kDa protein, designated ZAC, which has a novel domain structure in which the N-terminal ARF GAP domain and a C-terminal C2 domain are separated by a region without homology to other known proteins. Zac promoter/beta-glucuronidase reporter assays revealed highest expression levels in flowering tissue, rosettes and roots. ZAC protein was immuno-detected mainly in association with membranes and fractionated with Golgi and plasma membrane marker proteins. ZAC membrane association was confirmed in assays by a fusion between ZAC and the green fluorescence protein and prompted an analysis of the in vitro phospholipid-binding ability of ZAC. Phospholipid dot-blot and liposome-binding assays indicated that fusion proteins containing the ZAC-C2 domain bind anionic phospholipids non-specifically, with some variance in Ca2+ and salt dependence. Similar assays demonstrated specific affinity of the ZAC N-terminal region (residues 1-174) for phosphatidylinositol 3-monophosphate (PI-3-P). Binding was dependent in part on an intact zinc finger motif, but proteins containing only the zinc finger domain (residues 1-105) did not bind PI-3-P. Recombinant ZAC possessed GTPase-activating activity on Arabidopsis ARF proteins. These data identify a novel PI-3-P-binding protein region and thereby provide evidence that this phosphoinositide is recognized as a signal in plants. A role for ZAC in the regulation of ARF-mediated vesicular transport in plants is discussed.

Widespread occurrence of a highly conserved RING-H2 zinc finger motif in the model plant Arabidopsis thaliana.

Several novel Arabidopsis thaliana proteins containing a RING-H2 zinc finger motif were predicted after database searches. Alignment of 29 RING-H2 finger sequences shows that the motif is strikingly conserved in otherwise unrelated proteins. Only short, non-conserved polar/charged sequences distinguish these domains. The RING-H2 domain is most often present in multi-domain structures, a number of which are likely to contain a membrane-spanning region or an additional zinc finger. However, there are several small (126-200 residues) proteins consisting of an N-terminal domain, rich in aliphatic residues, and a C-terminal RING-H2 domain. Reverse-transcription PCR suggests that the RING-H2 genes are widely expressed at low levels.

HRT, a novel zinc finger, transcriptional repressor from barley.

A barley gene encoding a novel DNA-binding protein (HRT) was identified by southwestern screening with baits containing a gibberellin phytohormone response element from an alpha-amylase promoter. The HRT gene contains two introns, the larger of which (5722 base pairs (bp)) contains a 3094-bp LINE-like element with homology to maize Colonist1. In vitro mutagenesis and zinc- and DNA-binding assays demonstrate that HRT contains three unusual zinc fingers with a CX8-9CX10CX2H consensus sequence. HRT is targeted to nuclei, and homologues are expressed in other plants. In vivo, functional tests in plant cells indicate that full-length HRT can repress expression from certain promoters including the Amy1/6-4 and Amy2/32 alpha-amylase promoters. In contrast, truncated forms of HRT containing DNA-binding domains can activate, or derepress, transcription from these promoters. Northern hybridizations indicate that HRT mRNA accumulates to low levels in various tissues. Roles for HRT in mediating developmental and phytohormone-responsive gene expression are discussed.

Heterologous expression and characterization of wild-type and mutant forms of a 26 kDa endochitinase from barley (Hordeum vulgare L.).

To investigate structure-function relationships in plant chitinases, we have developed a heterologous expression system for the 26 kDa endochitinase from Hordeum vulgare L. (barley). Escherichia coli cells harbouring the gene in a T7 RNA polymerase-based expression vector synthesized completely insoluble recombinant protein under standard induction conditions at 37 degrees C. However, a concentration of soluble recombinant protein of approx. 15 mg/l was achieved by inducing bacteria at low temperature (15 degrees C). Recombinant endochitinase was purified to homogeneity and shown to be structurally and functionally identical to the seed protein. An average of three disulphide bonds are present in the recombinant enzyme, consistent with the number found in the natural form. The seed and recombinant proteins showed the same specific activity towards a high-molecular-mass substrate and exhibited similar anti-fungal activity towards Tricoderma reesei. Site-directed mutagenesis was used to replace residues that are likely to be involved in the catalytic event, based on structural similarities with lysozyme and on sequence alignments with related chitinases. The Glu67-->Gln mutation resulted in a protein with undetectable activity, while the Glu89-->Gln mutation yielded an enzyme with 0. 25% of wild-type specific activity. This suggests that two acidic residues are essential for catalytic activity, similar to the situation with many other glycosyl hydrolases. Examination of conserved residues stretching into the proposed substrate binding cleft suggests that Asn124 also plays an important functional role.

Novel plant Ca(2+)-binding protein expressed in response to abscisic acid and osmotic stress.

A cDNA corresponding to an mRNA which accumulates in germinating rice seeds in response to the phytohormone abscisic acid was isolated by differential hybridization. Northern blotting indicated that the mRNA also accumulates in vegetative tissues in response to treatment with abscisic acid and to osmotic stress. Sequencing identified a major open reading frame encoding a novel protein of 27.4 kDa. The identity of the open reading frame was confirmed by comparing the translation products of cellular, hybrid-selected, and in vitro transcribed RNAs and by immunoprecipitation. Western blotting of cellular extracts indicated that the protein is associated with microsomal or membrane fractions. Data base searches indicated that it contains a conserved Ca(2+)-binding, EF-hand motif and that related proteins are similarly expressed in Arabidopsis thaliana. A fusion protein purified from Escherichia coli containing the putative EF-hand region was shown to bind Ca2+ in blot binding assays. These data identify a novel gene family encoding proteins involved in the response of plants to abscisic acid and osmotic stress.

The barley 60 kDa jasmonate-induced protein (JIP60) is a novel ribosome-inactivating protein.

The N-terminal region of a 60 kDa, jasmonate-induced protein of barley leaves (JIP60) is shown to be homologous to the catalytic domains of plant ribosome-inactivating proteins (RIP). Western blotting of leaf extracts and in vitro reconstitution experiments indicate that JIP60 is synthesized as a precursor which is processed in vivo. This is in keeping with in vitro translation experiments indicating that a deletion derivative of the N-terminal region, but not the putative precursor, strongly inhibits protein synthesis on reticulocyte ribosomes. The inhibition of ribosome function is associated with depurination of 26S rRNA, characteristic of plant RIPs. This indicates that JIP60 is a novel ribosome-inactivating protein requiring at least two processing events for full activation. JIP60 derivatives do not significantly inhibit in vitro protein synthesis on wheat germ ribosomes. These and other results suggest that JIP60 may be involved in plant defence.

Identification of an enhancer/silencer sequence directing the aleurone-specific expression of a barley chitinase gene.

Chitinases are expressed in various plant tissues where they are thought to play a role in defense against chitin-containing pathogens. Transient gene expression assays have been used in tissues of barley to delineate promoter sequences involved in the regulation of an aleurone-specific chitinase gene (Chi26), and of a vegetatively expressed chitinase gene (Chi33). The assays measured the activities of transcriptional fusions between chitinase 5' upstream sequences and GUS reporter genes after DNA delivery by particle bombardment. Analysis of Chi26 5' and 3' promoter deletions indicated that sequences between -200 and -140 confer developmental and aleurone-specific expression. Deletions/replacements covering this part of the promoter indicated that sequences between -179 and -147 (E-region) direct expression in aleurone cells. The ability of the 33bp E-region of the Chi26 promoter to activate transcription specifically in aleurone was confirmed by constructing and testing two types of chimeric promoters. The first type, which contained two copies of the E-region fused to the CaMV 35S TATA box, conferred aleurone-specific expression of a GUS reporter gene. The second type, which contained a single copy of the E-region inserted into a deleted, inactive Chi33 promoter derivative, was also capable of directing transcription in aleurone but not in leaves. The pattern of expression of this and other Chi26/Chi33 chimeric promoters suggest that the E-region contains cis-acting sequences which activate transcription in aleurone and silence transcription in leaves. DNA sequence motifs implicated in the regulation of Chi26 and Chi33 are described.

Structure and expression of the barley lipid transfer protein gene Ltp1.

We have characterized a gene (Ltp1) encoding a barley lipid transfer protein. Northern blot analysis showed that Ltp1 mRNA accumulates specifically in the aleurone layer of developing and germinating seeds. Southern blot analysis indicated that LTP1 protein is encoded by a single gene in barley. Sequence analysis of Ltp1 showed that it contains an open reading frame of 351 bp interrupted by a single intron of 133 bp. Transient expression assays indicated that 702 bp of the 5' upstream region of Ltp1 is sufficient to direct aleurone-specific expression during late seed development and early germination.

cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid.

We have used a transient expression assay in aleurone protoplasts of barley to delineate hormone response elements of the abscisic acid (ABA)-responsive rice gene Rab16A and of the gibberellin A3 (GA3)-responsive barley alpha-amylase gene Amy 1/6-4. Our approach used transcriptional fusions between their 5' upstream sequences and a bacterial chloramphenicol acetyltransferase reporter gene. A chimeric promoter containing six copies of the -181 to -171 region of Rab 16A fused to a minimal promoter conferred ABA-responsive expression on the reporter gene. Transcription from this ABA response element (GTACGTGGCGC) was unaffected by GA3. A chimeric promoter containing six copies of the -148 to -128 sequence of Amy 1/6-4 fused to the minimal promoter conferred GA3-responsive expression on the reporter gene. Transcription from this GA3 response element (GGCCGATAACAAACTCCGGCC) was repressed by ABA. The effect on transcription from both hormone response elements was orientation-independent, indicating that they function as inducible enhancers in their native genes.

Substrate properties of C1 inhibitor Ma (alanine 434----glutamic acid). Genetic and structural evidence suggesting that the P12-region contains critical determinants of serine protease inhibitor/substrate status.

The serine protease inhibitor (serpin) C1 inhibitor inactivates enzymes involved in the regulation of vascular permeability. A patient from the Ma family with the genetic disorder hereditary angioedema inherited a dysfunctional C1 inhibitor allele. Relative to normal plasma, the patients's plasma contained an additional C1 inhibitor immunoreactive band, which comigrated with normal C1 inhibitor cleaved by plasma kallikrein, C1s, or factor XIIa. C1 inhibitor Ma did not react with a monoclonal antibody to a neoepitope that is present in complexed and cleaved normal C1 inhibitor, suggesting conformational differences between cleaved normal C1- inhibitor and cleaved C1 inhibitor Ma. Molecular cloning and sequencing of exon 8 of the C1 inhibitor Ma allele revealed a single C to A mutation, changing alanine 434 to glutamic acid. Ala 434 of C1 inhibitor aligns with the P12 residue of the prototypical serpin alpha 1-antitrypsin. The P12 amino acid of all inhibitory serpins is alanine, and it is present in a highly conserved region on the amino-terminal side of the serpin-reactive center loop. Whereas normal C1 inhibitor expressed by transfected COS-1 cells formed complexes with and was cleaved by kallikrein, fXIIa, and C1s, COS-1-expressed Ala434---Glu C1 inhibitor was cleaved by these enzymes but did not form complexes with them. These results, together with evidence from other studies, suggest that serpin protease inhibitor activity is the result of protein conformational change that occurs when the P12 region of a serpin moves from a surface location, on the reactive site loop of the native molecule, to an internal location within sheet A of the complexed inhibitor.

CpG mutations in the reactive site of human C1 inhibitor.

C1 inhibitor plays an important role in the regulation of vascular permeability through its ability to inactivate enzymes which release polypeptide kinins. Dysfunctional C1 inhibitor molecules are present in the plasma of affected members of the Da and Ri hereditary angioneurotic edema kindreds. We constructed genomic libraries from Da and Ri patient DNAs which had been cleaved with BclI to generate a fragment containing 21 kilobases of the C1 inhibitor locus. C1 inhibitor gene-containing recombinants originating from mutant Da and Ri alleles were differentiated from those derived from normal alleles by linkage analysis using the intragenic HgiAI restriction fragment length polymorphism. Nucleotide sequencing of the complete protein-coding regions of the mutant alleles identified two different mutations in a CpG dinucleotide corresponding to the first two bases of arginine codon 444. These single base mutations changed the identity of the functionally critical P1 reactive site residue from arginine to cysteine (Da) or histidine (Ri). The additional cysteine residue in C1 inhibitor Da suggests how it is covalently bound to albumin in plasma. The presence of CpG dinucleotides in the codons specifying the P1 arginines of C1 inhibitor and antithrombin III explains the high incidence of histidine and cysteine substitutions observed among dysfunctional mutants of these serine protease inhibitors.

Human C1 inhibitor: primary structure, cDNA cloning, and chromosomal localization.

The primary structure of human C1 inhibitor was determined by peptide and DNA sequencing. The single-chain polypeptide moiety of the intact inhibitor is 478 residues (52,869 Da), accounting for only 51% of the apparent molecular mass of the circulating protein (104,000 Da). The positions of six glucosamine-based and five galactosamine-based oligosaccharides were determined. Another nine threonine residues are probably also glycosylated. Most of the carbohydrate prosthetic groups (probably 17) are located at the amino-terminal end (residues 1-120) of the protein and are particularly concentrated in a region where the tetrapeptide sequence Glx-Pro-Thr-Thr, and variants thereof, is repeated 7 times. No phosphate was detected in C1 inhibitor. Two disulfide bridges connect cysteine-101 to cysteine-406 and cysteine-108 to cysteine-183. Comparison of the amino acid and cDNA sequences indicates that secretion is mediated by a 22-residue signal peptide and that further proteolytic processing does not occur. C1 inhibitor is a member of the large serine protease inhibitor (serpin) gene family. The homology concerns residues 120 through the C-terminus. The sequence was compared with those of nine other serpins, and conserved and nonconserved regions correlated with elements in the tertiary structure of alpha 1-antitrypsin. The C1 inhibitor gene maps to chromosome 11, p11.2-q13. C1 inhibitor genes of patients from four hereditary angioneurotic edema kindreds do not have obvious deletions or rearrangements in the C1 inhibitor locus. A HgiAI DNA polymorphism, identified following the observation of sequence variants, will be useful as a linkage marker in studies of mutant C1 inhibitor genes.