First report of Globisporangium uncinulatum (syn. Pythium uncinulatum) causing Pythium wilt of lettuce in Arizona.

In 2021 and 2022, wilt symptoms were observed in lettuce (Lactuca sativa L.) fields in Yuma County, Arizona (AZ). Incidence was < 1% at all locations. Symptoms included stunting, yellowing and wilting of outer leaves. As disease progressed, outer leaves wilted and turned necrotic. In advanced stages, tap roots turned brown-gray, with few feeder roots. The crown remained intact until the plant collapsed. Symptomatic romaine and iceberg plants were collected from two sites. Necrotic roots were washed and then plated on amended corn meal agar (PARP) (Kannwischer et al. 1978). After 2-3 days, slow growing, coenocytic, submerged mycelia grew from these pieces. In culture, profuse oogonia formed with diameters of 30-39 (avg. = 33.7) µm and spiny protuberances (5-8 [avg. = 6.4] µm long) with thickened bases. Oospores were spherical and aplerotic, with diameters of 25-32 (avg. = 27.8) µm. Lettuce with identical symptoms from the Salinas Valley, California (CA) were also tested and similar isolates were recovered. Pathogenicity was tested using six AZ and one CA isolates. Inoculum was grown on barley seeds moistened with sterile distilled water, autoclaved three times (at 24 h intervals), then inoculated with colonized agar plugs and incubated at 20°C. Inoculum was used after two weeks. For each isolate, 12 3-week-old iceberg (cv. Speedway) and romaine (cv. Del Sol) plants were inoculated by placing 3-4 colonized barley seed next to the roots of the potted plants. Plants were maintained in a greenhouse at 24-26°C (daytime high) with ambient light. After eight days, all inoculated plants exhibited chlorotic lower leaves that later wilted. Both feeder roots and taproots showed brown-gray discoloration and were necrotic. Microscopy showed the presence of spiny oogonia in inoculated roots. Symptoms caused by the AZ and CA isolates were indistinguishable from each other. Isolations from necrotic tissue resulted in colonies morphologically identical to the original isolates. Twelve control plants inoculated with uncolonized barley seed developed no symptoms. DNA was extracted from all seven AZ and CA isolates pre-inoculation, and AZ isolate 2 recovered from both lettuce types post-inoculation for molecular characterization. The internal transcribed spacer (ITS) and cytochrome C oxidase subunit 2 (COX II) were amplified for the above isolates using primer sets ITS1/ITS4 (White et al. 1990) and FM66/FM58 (Villa et al. 2006), then sequenced. ITS of pre- and post-inoculated isolates for AZ (OQ054806 and OQ054807) and CA (OQ564388) matched 1078/1078 bases of Globisporangium uncinulatum (syn. Pythium uncinulatum; AY598712.2) with 99.8% identity. There were two SNPs in COX II for AZ isolate 1 (OR069239); all other isolates pre- and post- inoculation for AZ (OR069240 and OR069242) and CA (OR069241) uniformly matched 533/535 bases of G. uncinulatum (KJ595385.1) with 99.4% identity. Based on these molecular and morphological data, the isolates were identified as G. uncinulatum (Blok and Van Der Plaats-Niterink 1978; Van Der Plaats-Niterink 1981). To our knowledge, this is the first report of G. uncinulatum on lettuce in AZ. Designated as Pythium wilt, this disease is reported on lettuce in The Netherlands (Blok and Van Der Plaats-Niterink 1978), Japan (Matsuura, et al. 2010), and CA (Davis, et al. 1995). Arizona is an important lettuce growing region; if this disease becomes more prevalent, lettuce production in this region could be negatively impacted.

Variant-specific SARS-CoV-2 shedding rates in wastewater.

Previous studies show that SARS-CoV-2 waste shedding rates vary by community and are influenced by multiple factors; however, differences in shedding rates across multiple variants have yet to be evaluated. The purpose of this work is to build on previous research that evaluated waste shedding rates for early SARS-CoV-2 and the Delta variant, and update population level waste shedding rates for the more-recent Omicron variant in six communities. Mean SARS-CoV-2 waste shedding rates were found to increase with the predominance of the Delta variant and subsequently decrease with Omicron infections. Interestingly, the Delta stage had the highest mean shedding rates and was associated with the most severe disease symptoms reported in other clinical studies, while Omicron, exhibiting reduced symptoms, had the lowest mean shedding rates. Additionally, shedding rates were most consistent across communities during the Omicron stage. This is the first paper to identify waste shedding rates specific to the Omicron variant and fills a knowledge gap critical to disease prevalence modeling.

Wastewater-Based Epidemiology Mitigates COVID-19 Outbreaks at a Food Processing Facility near the Mexico-U.S. Border-November 2020-March 2022.

Background: Wastewater-based epidemiology (WBE) has the potential to inform activities to contain infectious disease outbreaks in both the public and private sectors. Although WBE for SARS-CoV-2 has shown promise over short time intervals, no other groups have evaluated how a public-private partnership could influence disease spread through public health action over time. The aim of this study was to characterize and assess the application of WBE to inform public health response and contain COVID-19 infections in a food processing facility. Methods: Over the period November 2020-March 2022, wastewater in an Arizona food processing facility was monitored for the presence of SARS-CoV-2 using Real-Time Quantitative PCR. Upon positive detection, partners discussed public health intervention strategies, including infection control reinforcement, antigen testing, and vaccination. Results: SARS-CoV-2 RNA was detected on 18 of 205 days in which wastewater was sampled and analyzed (8.8%): seven during Wild-type predominance and 11 during Omicron-variant predominance. All detections triggered the reinforcement of infection control guidelines. In five of the 18 events, active antigen testing identified asymptomatic workers. Conclusions: These steps heightened awareness to refine infection control protocols and averted possible transmission events during periods where detection occurred. This public-private partnership has potentially decreased human illness and economic loss during the COVID-19 pandemic.

Population level SARS-CoV-2 fecal shedding rates determined via wastewater-based epidemiology.

Wastewater-based epidemiology (WBE) has been utilized as an early warning tool to anticipate disease outbreaks, especially during the COVID-19 pandemic. However, COVID-19 disease models built from wastewater-collected data have been limited by the complexities involved in estimating SARS-CoV-2 fecal shedding rates. In this study, wastewater from six municipalities in Arizona and Florida with distinct demographics were monitored for SARS-CoV-2 RNA between September 2020 and December 2021. Virus concentrations with corresponding clinical case counts were utilized to estimate community-wide fecal shedding rates that encompassed all infected individuals. Analyses suggest that average SARS-CoV-2 RNA fecal shedding rates typically occurred within a consistent range (7.53-9.29 log10 gc/g-feces); and yet, were unique to each community and influenced by population demographics. Age, ethnicity, and socio-economic factors may have influenced shedding rates. Interestingly, populations with median age between 30 and 39 had the greatest fecal shedding rates. Additionally, rates remained relatively constant throughout the pandemic provided conditions related to vaccination and variants were unchanged. Rates significantly increased in some communities when the Delta variant became predominant. Findings in this study suggest that community-specific shedding rates may be appropriate in model development relating wastewater virus concentrations to clinical case counts.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

IMA Genome-F 3: Draft genomes of Amanita jacksonii, Ceratocystis albifundus, Fusarium circinatum, Huntiella omanensis, Leptographium procerum, Rutstroemia sydowiana, and Sclerotinia echinophila.

The genomes of fungi provide an important resource to resolve issues pertaining to their taxonomy, biology, and evolution. The genomes of Amanita jacksonii, Ceratocystis albifundus, a Fusarium circinatum variant, Huntiella omanensis, Leptographium procerum, Sclerotinia echinophila, and Rutstroemia sydowiana are presented in this genome announcement. These seven genomes are from a number of fungal pathogens and economically important species. The genome sizes range from 27 Mb in the case of Ceratocystis albifundus to 51.9 Mb for Rutstroemia sydowiana. The latter also encodes for a predicted 17 350 genes, more than double that of Ceratocystis albifundus. These genomes will add to the growing body of knowledge of these fungi and provide a value resource to researchers studying these fungi.