Analyzing Joshimath's sinking: causes, consequences, and future prospects with remote sensing techniques.

The Himalayas are highly susceptible to various natural disasters, such as the tectonically induced land deformation, earthquakes, landslides, and extreme climatic events. Recently, the Joshimath town witnessed a significantly large land subsidence activity. The phenomenon resulted in the development of large cracks in roads and in over 868 civil structures, posing a significant risk to inhabitants and infrastructure of the area. This study uses a time-series synthetic aperture radar (SAR) interferometry-based PSInSAR approach to monitor land deformation utilizing multi-temporal Sentinel-1 datasets. The line of sight (LOS) land deformation velocity for the Joshimath region, calculated for the year 2022-2023 using a PSInSAR-based approach, varies from - 89.326 to + 94.46 mm/year. The + ve sign indicates the LOS velocity/displacement away from the SAR sensor, whereas - ve sign signifies the earth's movement towards the SAR sensor in the direction of LOS. In addition, the study investigates feature tracking land displacement analysis using multi-temporal high-resolution Planet datasets. The result of this analysis is consistent with the PSInSAR results. The study also estimated the land deformation for the periods 2016-2017, 2018-2019, and 2020-2021 separately. Our results show that the Joshimath region experienced the highest land deformation during the year 2022-2023. During this period, the maximum land subsidence was observed in the north-western part of the town. The maximum LOS land deformation velocity + 60.45 mm/year to + 94.46 mm/year (2022-2023), occurred around Singhdwar, whereas the north and central region of the Joshimath town experienced moderate to high subsidence of the order of + 10.45 mm/year to + 60.45 mm/year (2022-2023), whereas the south-west part experienced an expansion of the order of 84.65 mm/year to - 13.13 mm/year (2022-2023). Towards the south-east, the town experienced rapid land subsidence, - 13.13 mm/year to - 5 mm/year (2022-2023). The study analyzes the causative factors of the observed land deformation in the region. Furthermore, this work assesses the ground conditions of the Joshimath region using UAV datasets acquired in the most critically affected areas such as Singhdhaar, Hotel Mountain View, Malhari Hotel, and Manoharbagh. Finally, the study provides recommendations and future prospects for the development policies that need to be adopted in the critical Himalayan regions susceptible to land deformation. The study suggests that land deformation in the region is primarily attributed to uncontrolled anthropogenic activities, infrastructural development, along with inadequate drainage systems.

Aerosol source apportionment uncertainty linked to the choice of input chemical components.

For a Positive Matrix Factorization (PMF) aerosol source apportionment (SA) studies there is no standard procedure to select the most appropriate chemical components to be included in the input dataset for a given site typology, nor specific recommendations in this direction. However, these choices are crucial for the final SA outputs not only in terms of number of sources identified but also, and consequently, in the source contributions estimates. In fact, PMF tends to reproduce most of PM mass measured independently and introduced as a total variable in the input data, regardless of the percentage of PM mass which has been chemically characterized, so that the lack of some specific source tracers (e.g. levoglucosan) can potentially affect the results of the whole source apportionment study. The present study elaborates further on the same concept, evaluating quantitatively the impact of lacking specific sources' tracers on the whole source apportionment, both in terms of identified sources and source contributions. This work aims to provide first recommendations on the most suitable and critical components to be included in PMF analyses in order to reduce PMF output uncertainty as much as possible, and better represent the most commons PM sources observed in many sites in Western countries. To this aim, we performed three sensitivity analyses on three different datasets across EU, including extended sets of organic tracers, in order to cover different types of urban conditions (Mediterranean, Continental, and Alpine), source types, and PM fractions. Our findings reveal that the vehicle exhaust source resulted to be less sensitive to the choice of analytes, although source contributions estimates can deviate significantly up to 44 %. On the other hand, for the detection of the non-exhaust one is clearly necessary to analyze specific inorganic elements. The choice of not analysing non-polar organics likely causes the loss of separation of exhaust and non-exhaust factors, thus obtaining a unique road traffic source, which provokes a significant bias of total contribution. Levoglucosan was, in most cases, crucial to identify biomass burning contributions in Milan and in Barcelona, in spite of the presence of PAHs in Barcelona, while for the case of Grenoble, even discarding levoglucosan, the presence of PAHs allowed identifying the BB factor. Modifying the rest of analytes provoke a systematic underestimation of biomass burning source contributions. SIA factors resulted to be generally overestimated with respect to the base case analysis, also in the case that ions were not included in the PMF analysis. Trace elements were crucial to identify shipping emissions (V and Ni) and industrial sources (Pb, Ni, Br, Zn, Mn, Cd and As). When changing the rest of input variables, the uncertainty was narrow for shipping but large for industrial processes. Major and trace elements were also crucial to identify the mineral/soil factor at all cities. Biogenic SOA and Anthropogenic SOA factors were sensitive to the presence of their molecular tracers, since the availability of OC alone is unable to separate a SOA factor. Arabitol and sorbitol were crucial to detecting fungal spores while odd number of higher alkanes (C27 to C31) for plant debris.

Validation of satisfaction questionnaire for services provided in the labour rooms of government health facilities.

INTRODUCTION AND OBJECTIVES: Using the assessment of satisfaction of patients of labour room services, the caregiver or policymakers can identify the gaps in the implemented programmes and health policies. This study was aimed to design a valid and reliable satisfaction questionnaire that will help in identifying the aspects of gaps that need improvement. METHODS: A facility and community-based observational cross-sectional study was conducted in the district of western Uttar Pradesh (India) between January 2019 and August 2020. Validation of the structured questionnaire with 34 dichotomous questions categorized under five subscales was performed by evaluating its validity and reliability. A total of 380 beneficiaries were selected from 48 government health facilities. RESULTS: The calculated Content validity index was calculated to be 9.5 which was adequate as per the guidelines. The reliability analysis of the questionnaire showed that the internal consistency was high with an overall Cronbach's alpha of 0.710. The variation in Cronbach's alpha on the elimination of any question from the questionnaire ranged from 0.676 to 0.767. The mean patient satisfaction score in the total surveyed population was 24.39±4.684 (total score=34) and there was a greater variation in the satisfaction score of infrastructure when compared with other subscales. CONCLUSION: The findings from this study support the reliability and validity of the patient satisfaction questionnaire as it is capable of evaluating the satisfaction in terms of delivery services provided in labour rooms as a whole.

Health-related quality of life of multidrug-resistant tuberculosis patients: A study of eastern Uttar Pradesh, India.

INTRODUCTION: Much attention has been given to the microbiological aspect, drug treatment, and clinical indicators of MDR-TB, but patients' QOL has remained a neglected area. In this study, we aimed to find the quality of MDRTB on various quality of life domains during the initiation of the MDR Treatment regimen. MATERIALS & METHODS: A cross-sectional study was conducted over a period of 6 months at the Drug-Resistance Tuberculosis Management Centre (DR-TB Centre), of a tertiary care centre in the eastern Uttar pradesh, India. Patients with age >18 years diagnosed with MDR-TB (Multidrug resistance TB) were included in the study. The WHO QOL-BREF scale was used to assess the health-related quality of life of patients. Data were analyzed using SPSS version 21. The institutional ethical review committee approved the study, and consent was taken before the participation of patients. RESULTS: A total of 157 patients were included in the study & 45.85% were dissatisfied with their condition. Social domain of WHO QOL-BREF is having the lowest mean score (28.51 ± 15.4) while psychological has high mean values (39.92 ± 6.91). There was a significant difference in the physical health domain with respect to age (p-value 0.001). Similar differences have been seen in the psychological domain regarding patient sex (p-value 0.001), smoking and alcohol within the social domain, and loss of income in the environmental domain. CONCLUSION: The mean value of different domains of WHO QOL-BREF is low in MDR-TB patients, with social relation domain being the most affected.

Online Platform to Assess Complex Social Relationships and Patient-Reported Outcomes Among Adolescent and Young Adult Cancer Survivors.

PURPOSE: Social integration and relationship issues have been understudied among adolescent and young adult (AYA) cancer survivors. This study compared social relationships (social networks, support, and isolation) between AYA cancer survivors and noncancer controls, and identified social integration mechanisms through which the cancer experience influences patient-reported outcomes (PROs). MATERIALS AND METHODS: One hundred two AYA cancer survivors and 102 age, sex, and race-matched noncancer controls from a national Internet panel completed an online survey to identify up to 25 of closest friends and relatives whom they have contacted within the past 2 years. Participants' interpersonal connections were used to create a social network index. The Duke-UNC Functional Social Support Questionnaire, UCLA Loneliness Scale, and PROMIS-29 Profile were used to measure social support, perceived isolation or loneliness, and PROs (physical functioning, pain interference, fatigue, anxiety, and depression domains), respectively. Path analysis tested effects of cancer experience on PROs using serial social relationship variables as mediators. RESULTS: Compared with controls, survivors of lymphoma, leukemia, and solid tumor had better social networks; however, survivors of solid tumor and central nervous system malignancies had higher perceived loneliness (all P values < .05). Cancer experience was directly associated with poor PROs (P values < .05 for all domains except fatigue) and indirectly associated through the social network-support-loneliness pathway (all P values < .05). Survivors with higher loneliness had lower physical functioning and higher pain interference, fatigue, anxiety, and depression versus controls with lower loneliness (all P values < .05). CONCLUSION: Compared with controls, survivors were more socially connected but experienced greater loneliness, which was associated with poorer PROs. Screening social integration issues during follow-up care and providing appropriate interventions are warranted.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Probiotic characterization of bacterial strains from fermented South Indian tomato pickle and country chicken intestine having antioxidative and antiproliferative activities.

AIM: The present study aims to evaluate the potential antioxidant and antiproliferative properties of probiotic bacterial isolates Weissella cibaria p3B, Bacillus subtilis CS, and Bacillus tequilensis CL, isolated from South Indian fermented tomato pickle (homemade) and gut content of indigenous country chicken. METHODS AND RESULTS: The bacterial isolates exhibited antimicrobial activity against food-borne, human pathogenic bacteria, along with better survival under different bile and acidic conditions, hydrophobicity towards several hydrocarbons, and adherence to intestinal epithelial cells (INT-407 cells). Also, the intact cell (IC) mixture of the three species showed better DPPH, ABTS, and Fe2+ chelating activity as compared to the individual IC or cell extract (CE) activity. Among the three bacterial species, W. cibaria p3B revealed maximum antiproliferative activity against HeLa and Caco-2 cancer cells, all of which were nontoxic to INT-407 cells. Apart from being non-hemolytic, the bacterial isolates did not display any necrotic inhibition in HeLa and Caco-2 cells. The cell free supernatant (CFS) of the three bacterial isolates were tested for the production of antimicrobial peptides or bacteriocins. It found that the CFS of bacterial isolates was stable at various temperature, pH and sensitive to proteolytic enzymes confirms protenoius in nature of the antimicrobil peptides or bacteriocins. CONCLUSION: The bacterial isolates showed promising antimicrobial, antioxidant as well as antiproliferative activities with better survival ability at different pH and bile concentrations. The three bacterial isolates were able to produce potential antimicrobial peptides or bacteriocins. SIGNIFICANCE AND IMPACT OF THE STUDY: These results indicate better compatibility of our bacterial isolates against synthetic drugs to avoid adverse side effects and can be processed as dietary supplements against food and human pathogens. They can also provide antioxidative and antiproliferative benefits to humans and animals.

The use of intravenous lidocaine for postoperative pain and recovery: international consensus statement on efficacy and safety.

Intravenous lidocaine is used widely for its effect on postoperative pain and recovery but it can be, and has been, fatal when used inappropriately and incorrectly. The risk-benefit ratio of i.v. lidocaine varies with type of surgery and with patient factors such as comorbidity (including pre-existing chronic pain). This consensus statement aims to address three questions. First, does i.v. lidocaine effectively reduce postoperative pain and facilitate recovery? Second, is i.v. lidocaine safe? Third, does the fact that i.v. lidocaine is not licensed for this indication affect its use? We suggest that i.v. lidocaine should be regarded as a 'high-risk' medicine. Individual anaesthetists may feel that, in selected patients, i.v. lidocaine may be beneficial as part of a multimodal peri-operative pain management strategy. This approach should be approved by hospital medication governance systems, and the individual clinical decision should be made with properly informed consent from the patient concerned. If i.v. lidocaine is used, we recommend an initial dose of no more than 1.5 mg.kg-1 , calculated using the patient's ideal body weight and given as an infusion over 10 min. Thereafter, an infusion of no more than 1.5 mg.kg-1 .h-1 for no longer than 24 h is recommended, subject to review and re-assessment. Intravenous lidocaine should not be used at the same time as, or within the period of action of, other local anaesthetic interventions. This includes not starting i.v. lidocaine within 4 h after any nerve block, and not performing any nerve block until 4 h after discontinuing an i.v. lidocaine infusion.

Comparison of five methodologies to apportion organic aerosol sources during a PM pollution event.

This study presents a comparison of five methodologies to apportion primary (POA) and secondary organic aerosol (SOA) sources from measurements performed in the Paris region (France) during a highly processed PM pollution event. POA fractions, estimated from EC-tracer method and positive matrix factorization (PMF) analyses, conducted on measurements from PM10 filters, aerosol chemical speciation monitor (ACSM) and offline aerosol mass spectrometry (AMS), were all comparable (2.2-3.7 µg m-3 as primary organic carbon (POC)). Associated relative uncertainties (measurement + model) on POC estimations ranged from 8 to 50%. The best apportionment of primary traffic OA was achieved using key markers (EC and 1-nitropyrene) in the chemical speciation-based PMF showing more pronounced rush-hour peaks and greater correlation with NOx than other traffic related POC factors. All biomass burning-related factors were in good agreement, with a typical diel profile and a night-time increase linked to residential heating. If PMF applied to ACSM data showed good agreement with other PMF outputs corrected from dust-related factors (coarse PM), discrepancies were observed between individual POA factors (traffic, biomass burning) and directly comparable SOA factors and highly oxidized OA. Similar secondary organic carbon (SOC) concentrations (3.3 ± 0.1 µg m-3) were obtained from all approaches, except the SOA-tracer method (1.8 µg m-3). Associated uncertainties ranged from 14 to 52% with larger uncertainties obtained for PMF-chemical data, EC- and SOA-tracer methods. This latter significantly underestimated total SOA loadings, even including biomass burning SOA, due to missing SOA classes and precursors. None of the approaches was able to identify the formation mechanisms and/or precursors responsible for the highly oxidized SOA fraction associated with nitrate- and/or sulfate-rich aerosols (35% of OA). We recommend the use of a combination of different methodologies to apportion the POC/SOC concentrations/contributions to get the highest level of confidence in the estimates obtained.

One-year measurements of secondary organic aerosol (SOA) markers in the Paris region (France): Concentrations, gas/particle partitioning and SOA source apportionment.

Twenty-five biogenic and anthropogenic secondary organic aerosol (SOA) markers have been measured over a one-year period in both gaseous and PM10 phases in the Paris region (France). Seasonal and chemical patterns were similar to those previously observed in Europe, but significantly different from the ones observed in America and Asia due to dissimilarities in source precursor emissions. Nitroaromatic compounds showed higher concentrations in winter due to larger emissions of their precursors originating from biomass combustion used for residential heating purposes. Among the biogenic markers, only isoprene SOA marker concentrations increased in summer while pinene SOA markers did not display any clear seasonal trend. The measured SOA markers, usually considered as semi-volatiles, were mainly associated to the particulate phase, except for the nitrophenols and nitroguaiacols, and their gas/particle partitioning (GPP) showed a low temperature and OM concentrations dependency. An evaluation of their GPP with thermodynamic model predictions suggested that apart from equilibrium partitioning between organic phase and air, the GPP of the markers is affected by processes suppressing volatility from a mixed organic and inorganic phase, such as enhanced dissolution in aerosol aqueous phase and non-equilibrium conditions. SOA marker concentrations were used to apportion secondary organic carbon (SOC) sources applying both, an improved version of the SOA-tracer method and positive matrix factorization (PMF) Total SOC estimations agreed very well between both models, except in summer and during a highly processed Springtime PM pollution event in which systematic underestimation by the SOA tracer method was evidenced. As a first approach, the SOA-tracer method could provide a reliable estimation of the average SOC concentrations, but it is limited due to the lack of markers for aged SOA together with missing SOA/SOC conversion fractions for several sources.

TBX1 Regulates Chondrocyte Maturation in the Spheno-occipital Synchondrosis.

The synchondrosis in the cranial base is an important growth center for the craniofacial region. Abnormalities in the synchondroses affect the development of adjacent regions, including the craniofacial skeleton. Here, we report that the transcription factor TBX1, the candidate gene for DiGeorge syndrome, is expressed in mesoderm-derived chondrocytes and plays an essential and specific role in spheno-occipital synchondrosis development by inhibiting the expression of genes involved in chondrocyte hypertrophy and osteogenesis. In Tbx1-deficient mice, the spheno-occipital synchondrosis was completely mineralized at birth. TBX1 interacts with RUNX2, a master molecule of osteoblastogenesis and a regulator of chondrocyte maturation, and suppresses its transcriptional activity. Indeed, deleting Tbx1 triggers accelerated mineralization due to accelerated chondrocyte differentiation, which is associated with ectopic expression of downstream targets of RUNX2 in the spheno-occipital synchondrosis. These findings reveal that TBX1 acts as a regulator of chondrocyte maturation and osteogenesis during the spheno-occipital synchondrosis development. Thus, the tight regulation of endochondral ossification by TBX1 is crucial for the normal progression of chondrocyte differentiation in the spheno-occipital synchondrosis.

Patient-reported outcomes in survivors of childhood hematologic malignancies with hematopoietic stem cell transplant.

Patient-reported outcomes among survivors of pediatric hematopoietic stem cell transplant (HSCT) are understudied. We compared symptom prevalence, health-related quality of life (HRQOL), and risk factors in adult survivors of childhood hematologic malignancies treated with HSCT to those treated with conventional therapy and noncancer controls. Survivors of childhood hematologic malignancies (HSCT N = 112 [70% allogeneic, 30% autologous]; conventionally treated N = 1106) and noncancer controls (N = 242) from the St. Jude Lifetime Cohort Study completed surveys assessing 10 symptom domains and SF-36 HRQOL summary scores. Chronic health conditions (CHCs) were validated by clinical assessment. Multivariable logistic regression reveals that compared with noncancer controls, HSCT survivors endorsed a significantly higher symptom prevalence in sensation (OR = 4.7, 95% confidence interval [CI], 2.6-8.4), motor/movement (OR = 4.3, 95% CI, 1.6-11.0), pulmonary (OR = 4.6, 95% CI, 1.8-11.8), and memory domains (OR = 4.8, 95% CI, 2.5-9.2), and poorer physical HRQOL (OR = 6.9, 95% CI, 2.8-17.0). HSCT and conventionally treated survivors had a similar prevalence of all symptom domains and HRQOL (all P > .05); however, HSCT survivors had a significantly higher cumulative prevalence for specific symptoms: double vision (P = .04), very dry eyes (P < .0001), and trouble seeing when wearing glasses (P < .0001). Occurrence of organ-specific CHCs, instead of transplant receipt, was significantly associated with a higher prevalence of all symptom domains (all P < .05) in adult survivors of childhood cancer, except for pain and anxiety domains. This study found that patient-reported outcomes were equally impaired between HSCT and conventionally treated survivors, but poorer in both groups compared with noncancer controls. Poor patient-reported outcomes in all survivors of childhood hematologic malignancies correlated with the presence of CHCs, whether treated with conventional therapy or HSCT.

Change in Pain Status and Subsequent Opioid and Marijuana Use Among Long-Term Adult Survivors of Childhood Cancer.

We evaluated pain status change and associations with subsequent opioid/marijuana use among 1208 adult survivors of childhood cancer. Pain status and opioid/marijuana were self-reported at baseline and follow-up evaluation (mean interval = 4.2 years). Over time, 18.7% of survivors endorsed persistent/increasing significant pain; 4.8% and 9.0% reported having used opioids and marijuana at follow-up. Persistent/increased (vs none/decreased) pain, persistent/increased (vs none/decreased) anxiety, and lack of health insurance increased odds of subsequent opioid use by 7.69-fold (95% confidence interval [CI] = 3.71 to 15.95), 2.55-fold (95% CI = 1.04 to 6.24), and 2.50-fold (95% CI = 1.07 to 5.82), respectively. Persistent/increased (vs none/decreased) depression increased odds of subsequent marijuana use by 2.64-fold (95% CI = 1.10 to 6.33).

Expression of cry1Aa gene in cabbage imparts resistance against diamondback moth (Plutella xylostella).

Brassica oleracea cv. Pride of India is one of the most promising vegetable cultivars commercially grown as cash crop in Himachal Pradesh, India. However, its overall production is severely hampered by diamondback moth (Plutella xylostella), a notorious pest. To avoid yield losses caused by this pest, cryIAa gene was introduced into cabbage cv. Pride of India using Agrobacterium-mediated transformation method. In an attempt to maximize the transformation frequency, critical determinant factors such as explant type, pre-incubation and co-cultivation period, and acetosyringone effect were successfully optimized. The highest transformation frequency (4.67% and 14.50%) in cotyledon and hypocotyl explant was achieved with a pre-incubation period of 72 h and co-cultivation period of 48 h. Furthermore, transformation frequency was enhanced in cotyledon (18.66%) and hypocotyl (32.00%) explants, when selective regeneration medium was fortified with 100 µM acetosyringone, respectively. The transgene (cryIAa) integration and copy number were confirmed using PCR and Southern blotting. Reverse transcriptase PCR and quantitative real-time PCR analyses were performed that proved transcriptional expression of cryIAa gene in PCR-positive transgenic events. Transgenic cabbage-fed diamondback moth larvae showed significantly higher mortality, thereby proving transgene effectiveness against insect pest control.

Speciation of organic fractions does matter for aerosol source apportionment. Part 3: Combining off-line and on-line measurements.

The present study proposes an advanced methodology to refine the source apportionment of organic aerosol (OA). This methodology is based on the combination of offline and online datasets in a single Positive Matrix Factorization (PMF) analysis using the multilinear engine (ME-2) algorithm and a customized time synchronization procedure. It has been applied to data from measurements conducted in the Paris region (France) during a PM pollution event in March 2015. Measurements included OA ACSM (Aerosol Chemical Speciation Monitor) mass spectra and specific primary and secondary organic molecular markers from PM10 filters on their original time resolution (30 min for ACSM and 4 h for PM10 filters). Comparison with the conventional PMF analysis of the ACSM OA dataset (PMF-ACSM) showed very good agreement for the discrimination between primary and secondary OA fractions with about 75% of the OA mass of secondary origin. Furthermore, the use of the combined datasets allowed the deconvolution of 3 primary OA (POA) factors and 7 secondary OA (SOA) factors. A clear identification of the source/origin of 54% of the total SOA mass could be achieved thanks to specific molecular markers. Specifically, 28% of that fraction was linked to combustion sources (biomass burning and traffic emissions). A clear identification of primary traffic OA was also obtained using the PMF-combined analysis while PMF-ACSM only gave a proxy for this OA source in the form of total hydrocarbon-like OA (HOA) mass concentrations. In addition, the primary biomass burning-related OA source was explained by two OA factors, BBOA and OPOA-like BBOA. This new approach has showed undeniable advantages over the conventional approaches by providing valuable insights into the processes involved in SOA formation and their sources. However, the origins of highly oxidized SOA could not be fully identified due to the lack of specific molecular markers for such aged SOA.

Rice pest management with reduced risk pesticides in India.

Sitapur district in the Uttar Pradesh (U.P.) state of northern India has been observed to consume large amounts of WHO classified "extremely" and "highly hazardous" pesticides, in rice crop, posing significant health and environmental threats. Keeping in view this problem, integrated pest management (IPM) modules were synthesized for rice crop and then compared with non-IPM/farmer's practice (NIPM). This study assisted in identifying pesticides with reduced risk to the environment. To measure and compare risks, environmental impact quotient (EIQ) has been used as a pesticide risk indicator model, between IPM and NIPM programs. Using this model, the field EIQ values (EIQ field use rating or EIQ-FUR), for 32 commonly used pesticides in the region, were evaluated based on dosage, frequency, and percent active ingredients present in the pesticide formulations. The results conclude that copper oxychloride (CuOCl2) (50 WP at 1.25 kg/ha) and mancozeb (75 WP at 1.25 kg/ha) were the most detrimental to arthropod parasitoids and were the highest contributors to environmental risk (13-16%), in rice crop. This is based on the comparison of total dosage and active ingredients of pesticides applied under IPM and NIPM, with the total field EIQ values. The IPM modules were observed to have least impact on natural enemies with 30-40% increase in population, while keeping the weed population below 10%. NIPM, on the other hand, had resulted in 20% reduction in crop yields, 50% reduction in biodiversity, and about 150% increase in weed population, relative to the control (untreated) rice fields. Moreover, NIPM practices had been observed to pose 56% greater risk as per the total field EIQ values (62 for IPM and 141 for NIPM). The observations concluded that the EIQ model is a useful tool and can be easily used by the pesticide managers for assessing the risk against NIPM.

qSOFA score not predictive of in-hospital mortality in emergency patients with decompensated liver cirrhosis.

BACKGROUND: Quick sequential organ failure assessement (qSOFA) has been validated for patients with presumed sepsis and the general emergency department (ED) population. However, it has not been validated in specific subgroups of ED patients with a high mortality. We aimed to investigate the prognostic performance of qSOFA with respect to in-hospital mortality, intensive care unit (ICU) admission, and length of hospitalisation in patients with decompensated liver cirrhosis. Furthermore, we compared qSOFA to systemic inflammatory response syndrome (SIRS), model of end stage liver disease score (MELD), and Child-Pugh criteria and evaluated whether addition of sodium (Na+) levels to qSOFA increases its prognostic performance. METHODS: This observational study included patients admitted with the diagnosis of decompensated liver cirrhosis. All patients with a complete set of vital parameters were included in this study. RESULTS: A total of 186 patients were included. A positive qSOFA score was not associated with in-hospital mortality, ICU admission, or length of hospitalisation (all p > 0.15). MELD scores reliably predicted need for ICU admission and in-hospital mortality (both p < 0.01), but not the length of hospitalisation. qSOFA-Na+ only moderately increased the diagnostic performance of qSOFA with regard to need for ICU admission (AUCICU[qSOFA] = 0.504 vs. AUCICU[qSOFA-Na+] = 0.609, p = 0.03), but not for in-hospital mortality (AUCdeath[qSOFA] = 0.513 vs. AUCdeath[qSOFA-Na+] = 0.592, p = 0.054). CONCLUSION: qSOFA does not predict in-hospital mortality, ICU admission or length of hospitalisation in patients with decompensated liver cirrhosis. Extension of qSOFA with a disease-specific component, the qSOFA-Na+, moderately increased the diagnostic ability of qSOFA.

The Impact of Persistent Leukoencephalopathy on Brain White Matter Microstructure in Long-Term Survivors of Acute Lymphoblastic Leukemia Treated with Chemotherapy Only.

BACKGROUND AND PURPOSE: Survivors of acute lymphoblastic leukemia are at risk for neurocognitive deficits and leukoencephalopathy. We performed a longitudinal assessment of leukoencephalopathy and its associations with long-term brain microstructural white matter integrity and neurocognitive outcomes in survivors of childhood acute lymphoblastic leukemia treated on a modern chemotherapy-only protocol. MATERIALS AND METHODS: One hundred seventy-three survivors of acute lymphoblastic leukemia (49% female), treated on a chemotherapy-only protocol, underwent brain MR imaging during active therapy and repeat imaging and neurocognitive testing at follow-up (median, 13.5 years of age; interquartile range, 10.7-17.6 years; median time since diagnosis, 7.5 years; interquartile range, 6.3-9.1 years). Persistence of leukoencephalopathy was examined in relation to demographic and treatment data and to brain DTI in major fiber tracts and neurocognitive testing at follow-up. RESULTS: Leukoencephalopathy was found in 52 of 173 long-term survivors (30.0%) and persisted in 41 of 52 (78.8%) who developed it during therapy. DTI parameters were associated with leukoencephalopathy in multiple brain regions, including the corona radiata (fractional anisotropy, P = .001; mean diffusivity, P < .001), superior longitudinal fasciculi (fractional anisotropy, P = .02; mean diffusivity, P < .001), and superior fronto-occipital fasciculi (fractional anisotropy, P = .006; mean diffusivity, P < .001). Mean diffusivity was associated with neurocognitive impairment including in the genu of the corpus callosum (P = .04), corona radiata (P = .02), and superior fronto-occipital fasciculi (P = .02). CONCLUSIONS: Leukoencephalopathy during active therapy and neurocognitive impairment at long-term follow-up are associated with microstructural white matter integrity. DTI may be more sensitive than standard MR imaging for detection of clinically consequential white matter abnormalities in childhood acute lymphoblastic leukemia survivors treated with chemotherapy and in children undergoing treatment.

Epidemiological profile of multidrug-resistant tuberculosis patients in Gorakhpur Division, Uttar Pradesh, India.

INTRODUCTION: Multidrug-resistant tuberculosis (MDR-TB) poses a major threat to control of TB worldwide. Adequate information on socioepidemiological factors and their interaction is required for its control. The aim was to study the social and epidemiological profile of MDR-TB patient in Gorakhpur division. METHODOLOGY: A cross-sectional study of 157 MDR-TB patients from Gorakhpur division admitted at DR-TB Center of a tertiary care center were interviewed during initiation of MDR-TB treatment using structured questionnaire and collected data were described using descriptive statistics. RESULTS: More than 2/3rd of patients were male and the mean age was 32.15 ± 13.19 years. Overcrowding was present in 82.8% of households and ventilation of living room was inadequate in 72.7% of households. About 21.7% had history of contact with TB cases. Two-third of the patients practice unhygienic sputum disposal practices at home and at public places it was more than 90%. More than 60% of patients have the history of irregular treatment in intensive phase and 80% in continuation phase. Nearly 68.8% of patients were resistance to isoniazid (H) and rifampicin (R) and 18.5% were resistance to H, R, and S (streptomycin) followed by H, R and E (Ethambutol). Nearly 3.8% of patients were HIV positive and 7% had history of diabetes. 64.3% were under severe thinness category according to the WHO classification. CONCLUSION: Study point out need of nutritional counseling and support throughout the treatment. Use of incentives, enhancing contact tracing and increasing awareness regarding sputum disposal practices are recommended for effective control.

Real-time tracking of single-molecule collagenase on native collagen and partially structured collagen-mimic substrates.

The dynamic interactions of an individual matrix metalloproteinase-1 were imaged and monitored in the presence of either triple-helical or non-triple-helical, partially structured collagen-mimic substrates. The enzyme exhibited ten-fold increased catalytic turnover rates with the structurally modified substrate by skipping the triple-helix unwinding step during the catalytic pathway.