Identification of a Divergent Isolate of Ryegrass Mosaic Virus in Ohio Wheat.

A divergent isolate of ryegrass mosaic virus (RGMV) has been identified that is associated with wheat samples collected in Ohio. The complete genome of the virus is 9,570 nucleotides, with a polyprotein open reading frame that shares 77.2% nucleotide sequence identity with the reference ryegrass mosaic virus sequence.

Occurrence and High-Throughput Sequencing of Viruses in Ohio Wheat.

Ohio is a leading producer of soft red winter wheat in the United States. Many viruses impact wheat production, but there is a lack of contemporary information on the distribution and potential impact of wheat viruses in Ohio. To address this knowledge gap, we created a comprehensive dataset of viruses identified by high-throughput sequencing (HTS) and their incidence in field sites sampled across the state. Samples were collected from 103 field sites in surveys conducted in 2012, 2016, and 2017 and subjected to RNA HTS, reverse transcription (RT) PCR, or enzyme-linked immunosorbent assay to assess virus sequence diversity, prevalence, and incidence within fields. Partial and complete virus sequences were assembled and detection validated by RT-PCR. Assembled sequences were compared with previously known virus sequences, and novel sequences were validated by Sanger sequencing. The viruses detected most often included barley yellow dwarf virus (BYDV), cereal yellow dwarf virus (CYDV), wheat streak mosaic virus (WSMV), and wheat spindle streak mosaic virus (WSSMV). These viruses were detected at 67, 69, 55, and 28% of the field sites sampled, with mean incidences of 18, 19, 20, and 49%, respectively, within fields where they were detected. Brome mosaic virus (BMV) and cocksfoot mottle virus (CfMV) were also viruses of potential importance detected in Ohio, found in 26 and 17% of the field sites sampled, respectively. Based on results from logistic regression analyses, the presence of BYDV, CYDV, WSMV, and WSSMV was associated with the presence of volunteer wheat, BYDV and CfMV with monocots as the previous crop, and BMV with the presence of nearby corn fields (P < 0.10). For six viruses, there was evidence of spatial clustering in at least one field site and the variance of mean incidence was higher at the county level than at the regional spatial level. This finding suggests that county- and site-specific factors influenced the incidence and spatial pattern of some viruses. The results of this study provide a snapshot of viruses present in Ohio wheat and insights into their biology, potential risks to wheat production, and possible management strategies.

Characterization of an Ohio Isolate of Brome Mosaic Virus and Its Impact on the Development and Yield of Soft Red Winter Wheat.

Brome mosaic virus (BMV) is generally thought to be of little economic importance to crops; consequently, there is little information about its impact on wheat production under field conditions. After repeated detection of BMV in Ohio wheat fields at incidences up to 25%, the virus was isolated, sequenced, characterized, and tested for its impact on soft red winter wheat (SRWW). The Ohio isolate of brome mosaic virus (BMV-OH) was found to be >99% identical to a BMV-Fescue isolate (accession no. DQ530423-25) and capable of systemically infecting multiple monocot and dicot species, including cowpea and soybean, in experimental inoculations. BMV-OH was used in field experiments during the 2016 and 2017 growing seasons to quantify its effect on SRWW grain yield and development when inoculated at Feekes 1, 5, 8, and 10 in two to four cultivars. Cultivar and timing of inoculation had statistically significant (P < 0.05) main and interaction effects on grain yield, wheat growth, and multiple components of yield. Compared with noninoculated controls, BMV-OH reduced grain yield by up to 61% when inoculated at Feekes 1 and by as much as 25, 36, and 31% for inoculations at Feekes 5, 8, and 10, respectively. The magnitude of the yield reduction varied among cultivars and was associated with reductions in grain size and weight or plant population. These findings suggest that BMV could impact wheat productivity in Ohio and will serve as the basis for more large-scale investigations of the effects of this virus in commercial fields.

Viruses in maize and Johnsongrass in southern Ohio.

The two major U.S. maize viruses, Maize dwarf mosaic virus (MDMV) and Maize chlorotic dwarf virus (MCDV), emerged in southern Ohio and surrounding regions in the 1960s and caused significant losses. Planting resistant varieties and changing cultural practices has dramatically reduced virus impact in subsequent decades. Current information on the distribution, diversity, and impact of known and potential U.S. maize disease-causing viruses is lacking. To assess the current reservoir of viruses present at the sites of past disease emergence, we used a combination of serological testing and next-generation RNA sequencing approaches. Here, we report enzyme-linked immunosorbent assay and RNA-Seq data from samples collected over 2 years to assess the presence of viruses in cultivated maize and an important weedy reservoir, Johnsongrass (Sorghum halepense). Results revealed a persistent reservoir of MDMV and two strains of MCDV in Ohio Johnsongrass. We identified sequences of several other grass-infecting viruses and confirmed the presence of Wheat mosaic virus in Ohio maize. Together, these results provide important data for managing virus disease in field corn and sweet corn maize crops, and identifying potential future virus threats.

Wheat mosaic virus (WMoV), the Causal Agent of High Plains Disease, is Present in Ohio Wheat Fields.

High Plains disease was first described in wheat (Triticum aestivum) in Nebraska, Idaho, Texas, and other High Plains states in 1993 to 1994 (1). The causal agent is a negative sense RNA virus in the genus Emaravirus with at least three genome segments, which is transmitted by the wheat curl mite (Aceria tosichella Keifer) (2). This virus is variously referred to as High Plains virus (HPV), Maize red stripe virus (MRSV/MRStV), or Wheat mosaic virus (WMoV) in the literature. We adopt the name WMoV based on the latest recommendation (3). The presence of WMoV in Ohio was revealed through a comprehensive survey conducted in early spring 2012. Specifically, wheat plants exhibiting virus-like symptoms including chlorosis, reddening, stunting, spotting, or striping were collected from 27 wheat fields in 14 counties throughout Ohio, between March 20 and April 15, 2012. Total RNA was extracted from individual leaf samples, then pooled prior to ribosomal RNA removal and high throughput RNA-sequencing (RNA-Seq) using the Illumina HiSeq2000 platform (University of Illinois Biotechnology Center, Champaign-Urbana, IL). The resulting sequences were assembled and analyzed using CLC Genomics Workbench 5.5 software (CLC Bio, Cambridge, MA). One 983-nt contig was 99% identical to the nucleocapsid protein (NP)-coding RNA segment of WMoV (GenBank Accession DQ324466). We used reverse transcription (RT)-PCR to determine the distribution of WMoV in individual samples using WMoV-specific primers: WMoV NPf1 (TGCTATGTCATTGTTCAGGTGGTC), and WMoV NPr1 (TTAGGCAGTCCTTGATTGTGCTG). WMoV was identified in one sample each from Miami, Auglaize, and Paulding Counties, which are all in western Ohio. The WMoV-positive plants were chlorotic, with varying degrees of stunting and leaf striping. The presence of WMoV in the three samples was confirmed using protein A sandwich (PAS)-ELISA with WMoV-specific antiserum. Vascular puncture inoculation (VPI) (4) was used to inoculate germinating maize seed (cv. Spirit) with the extracts from the WMoV-positive samples. WMoV was detected in two of 378 surviving inoculated plants by RT-PCR and PAS-ELISA. These two WMoV-positive maize plants developed flecking mosaic symptoms on upper uninoculated leaves, consistent with reported WMoV symptoms. The WMoV-positive sample from Auglaize County also contained Wheat streak mosaic virus (WSMV), and 60 of the 120 surviving plants inoculated with this sample were positive for WSMV. This result suggests that, even with VPI, mechanical transmission of WMoV remains a great challenge. To our knowledge, this is the first report of WMoV in Ohio, and demonstrates that WMoV is more widespread than previously thought, reaching at least the eastern edge of the Midwest wheat production region. The expanding distribution of this emerging virus is significant because of its potential to cause additional yield losses in wheat. References: (1) S. G. Jensen et al. Plant Dis. 80:1387, 1996. (2) N. Mielke-Ehred and H.-P. Muhlbach. Viruses 4:1515, 2012. (3) J. M. Skare et al. Virology 347:343, 2006. (4) R. Louie et al. J. Virol. Methods 135:214, 2006.

Complete sequence and development of a full-length infectious clone of an Ohio isolate of Maize dwarf mosaic virus (MDMV).

Maize dwarf mosaic virus (MDMV) is an important and widespread aphid-transmitted virus of maize. It is a member of the genus Potyvirus in the family Potyviridae with a monopartite (+) ssRNA genome. Here we report the complete genome sequence and construction and testing of infectious clones of an Ohio isolate of MDMV. Full-length MDMV cDNA was cloned into the vector pSPORT. Full-length cDNA PCR-amplified from the vector constructs were used as template for in vitro transcription, and transcripts were inoculated to maize seeds by vascular puncture inoculation. Plants inoculated by this procedure showed symptoms typical of MDMV infection, and infection was confirmed by RT-PCR and mechanical transmission to new plants.

Involvement of the 5-lipoxygenase pathway in the neurotoxicity of the prion peptide PrP106-126.

Transmissible spongiform encephalopathies are characterised by the transformation of the normal cellular prion protein (PrP(C)) into an abnormal isoform (PrP(TSE)). Previous studies have shown that N-methyl-D-aspartate (NMDA) receptor antagonists can inhibit glutathione depletion and neurotoxicity induced by PrP(TSE) and a toxic prion protein peptide, PrP106-126, in vitro. NMDA receptor activation is known to increase intracellular accumulation of Ca(2+), resulting in up-regulation of arachidonic acid (AA) metabolism. This can stimulate the lipoxygenase pathways that may generate a number of potentially neurotoxic metabolites. Because of the putative relationship between AA breakdown and PrP106-126 neurotoxicity, we investigated AA metabolism in primary cerebellar granule neuron cultures treated with PrP106-126. Our studies revealed that PrP106-126 exposure for 30 min significantly up-regulated AA release from cerebellar granule neurons. PrP106-126 neurotoxicity was mediated through the 5-lipoxygenase (5-LOX) pathway, as shown by abrogation of neuronal death with the 5-LOX inhibitors quinacrine, nordihydroguaiaretic acid, and caffeic acid. These inhibitors also prevented PrP106-126-induced caspase 3 activation and annexin V binding, indicating a central role for the 5-LOX pathway in PrP106-126-mediated proapoptosis. Interestingly, inhibitors of the 12-lipoxygenase pathway had no effect on PrP106-126 neurotoxicity or proapoptosis. These studies clearly demonstrate that AA metabolism through the 5-LOX pathway is an important early event in PrP106-126 neurotoxicity and consequently may have a critical role in PrP(TSE)-mediated cell loss in vivo. If this is so, therapeutic intervention with 5-LOX inhibitors may prove beneficial in the treatment of prion disorders.

Copper and zinc binding modulates the aggregation and neurotoxic properties of the prion peptide PrP106-126.

The abnormal form of the prion protein (PrP) is believed to be responsible for the transmissible spongiform encephalopathies. A peptide encompassing residues 106-126 of human PrP (PrP106-126) is neurotoxic in vitro due its adoption of an amyloidogenic fibril structure. The Alzheimer's disease amyloid beta peptide (Abeta) also undergoes fibrillogenesis to become neurotoxic. Abeta aggregation and toxicity is highly sensitive to copper, zinc, or iron ions. We show that PrP106-126 aggregation, as assessed by turbidometry, is abolished in Chelex-100-treated buffer. ICP-MS analysis showed that the Chelex-100 treatment had reduced Cu(2+) and Zn(2+) levels approximately 3-fold. Restoring Cu(2+) and Zn(2+) to their original levels restored aggregation. Circular dichroism showed that the Chelex-100 treatment reduced the aggregated beta-sheet content of the peptide. Electron paramagnetic resonance spectroscopy identified a 2N1S1O coordination to the Cu(2+) atom, suggesting histidine 111 and methionine 109 or 112 are involved. Nuclear magnetic resonance confirmed Cu(2+) and Zn(2+) binding to His-111 and weaker binding to Met-112. An N-terminally acetylated PrP106-126 peptide did not bind Cu(2+), implicating the free amino group in metal binding. Mutagenesis of either His-111, Met-109, or Met-112 abolished PrP106-126 neurotoxicity and its ability to form fibrils. Therefore, Cu(2+) and/or Zn(2+) binding is critical for PrP106-126 aggregation and neurotoxicity.

Warfarin and celecoxib interaction.

OBJECTIVE: To report a case of increased international normalized ratio (INR) in a patient receiving warfarin and celecoxib. CASE SUMMARY: A 73-year-old white woman with hypothyroidism and heart failure was admitted to the hospital with increased orthopnea, dyspnea on exertion, and hemoptysis. On laboratory evaluation, she was noted to have an increased INR. The only reported change in her medications was the addition of celecoxib approximately five weeks before admission. Her INR had previously been stable. After discontinuation of warfarin and celecoxib, fresh frozen plasma and vitamin K were administered to normalize INR. The patient was not rechallenged. DISCUSSION: Warfarin is an oral anticoagulant with numerous reports of drug interactions. It is possible that other drug therapies or disease states may have contributed to the elevation in INR; however, the observed increase in INR occurred five weeks after beginning celecoxib therapy. The Food and Drug Administration has issued a notice about the possibility of interactions between these two medications. CONCLUSIONS: Celecoxib may potentiate the anticoagulant effects of warfarin. Patients receiving warfarin should be carefully monitored when adding, changing, or removing celecoxib from their medication regimen.

Prion protein-deficient neurons reveal lower glutathione reductase activity and increased susceptibility to hydrogen peroxide toxicity.

The prion protein (PrP) has a central role in the pathogenesis of transmissible spongiform encephalopathies (TSE). Accumulating evidence suggests that normal cellular PrP (PrP(c)) may be involved in copper homeostasis and modulation of copper/zinc superoxide dismutase (Cu/ZnSOD) activity in neurons. Hydrogen peroxide (H(2)O(2)) is a toxic reactive oxygen species generated through normal cellular respiration, and neurons contain two important peroxide detoxifying systems (glutathione pathway and catalase). To determine whether PrP expression affects neuronal resistance to H(2)O(2), we exposed primary cerebellar granule neuron cultures derived from PrP knockout (PrP(-/-)) and wild-type (WT) mice to H(2)O(2) for 3, 6, and 24 hours. The PrP(-/-) neurons were significantly more susceptible to H(2)O(2) toxicity than WT neurons after 6 and 24 hours' exposure. The increased H(2)O(2) toxicity may be related to a significant decrease in glutathione reductase activity measured in PrP(-/-) neurons both in vitro and in vivo. This was supported by the finding that inhibition of GR activity with 1,3-bis(2-chloroethyl)-1-nitrosurea (BCNU) increased H(2)O(2) toxicity in WT neurons over the same exposure period. The PrP toxic peptide PrP106-126 significantly reduced neuronal glutathione reductase activity and increased susceptibility to H(2)O(2) toxicity in neuronal cultures suggesting that PrP toxicity in vivo may involve altered glutathione reductase activity. Our results suggest the pathophysiology of prion diseases may involve perturbed PrP(c) function with increased vulnerability to peroxidative stress.

The hydrophobic core sequence modulates the neurotoxic and secondary structure properties of the prion peptide 106-126.

The neurodegeneration seen in spongiform encephalopathies is believed to be mediated by protease-resistant forms of the prion protein (PrP). A peptide encompassing residues 106-126 of human PrP has been shown to be neurotoxic in vitro. The neurotoxicity of PrP106-126 appears to be dependent upon its adoption of an aggregated fibril structure. To examine the role of the hydrophobic core, AGAAAAGA, on PrP106-126 toxicity, we performed structure-activity analyses by substituting two or more hydrophobic residues for the hydrophilic serine residue to decrease its hydrophobicity. A peptide with a deleted alanine was also synthesized. We found all the peptides except the deletion mutant were no longer toxic on mouse cerebellar neuronal cultures. Circular dichroism analysis showed that the nontoxic PrP peptides had a marked decrease in beta-sheet structure. In addition, the mutants had alterations in aggregability as measured by turbidity, Congo red binding, and fibril staining using electron microscopy. These data show that the hydrophobic core sequence is important for PrP106-126 toxicity probably by influencing its assembly into a neurotoxic structure. The hydrophobic sequence may similarly affect aggregation and toxicity observed in prion diseases.

Polymorphisms, but lack of mutations or instability, in the promotor region of the mitochondrial genome in human colonic tumors.

The region of the human mitochondrial D-loop has been sequenced from DNA of colonic tumors and paired normal colonic tissue to determine if mutations in the promotors for the heavy or light strands are responsible for the decrease in mitochondrial gene expression present in colonic tumors. No mutations were detected in the colonic tumors, but new polymorphisms, including a sequence analogous to CA microsatellites in genomic DNA, were revealed. These polymorphisms are restricted to positions within the D-loop which are not essential for accurate and efficient in vitro mitochondrial transcription. Thus, these data confirm the boundaries of the functional heavy and light strand promotors determined by in vitro assays. Further, although some of the tumors investigated show genomic microsatellite instability similar to that recently reported for colonic tumors, the CA polymorphic region in the mitochondrial D-loop does not show coincident instability in the tumors. Therefore, as in yeast, there may be both a mitochondrial and a nuclear enzyme responsible for mismatch repair, with only the latter involved in generation of instability in some human colon cancers. In summary, our data do not find any structural alterations in the D-loop region of the human mitochondrial genome encompassing the heavy and light strand promotors which can account for the decreased expression of the mitochondrial genome in colonic tumors.