RESUMO
In vitro reporter gene assays detecting dioxin-like compounds have been developed and validated since the middle 1990's, and applied to the determination of dioxin-like activities in various samples for their risk management. Data on characterizing the potency of individual brominated dioxins and their activity in mixture with chlorinated dioxins are still limited on the cell-based assay. This study characterized the dioxin-like activities of the 32 brominated dioxins, such as polybrominated dibenzo-p-dioxins, polybrominated dibenzofurans (PBDFs), coplanar polybrominated biphenyls, mixed halogenated dibenzo-p-dioxins and dibenzofurans (PXDFs), as a sole component or in a mixture by DR-CALUX (dioxin-responsive chemically activated luciferase expression) using the rat hepatoma H4IIE cell line and XDS-CALUX (xenobiotic detection systems-chemically activated luciferase expression) assays using the mouse hepatoma H1L6.1 cell line. The 2,3,7,8-TCDD-relative potencies (REPs) of most of the brominated dioxins were within a factor of 10 of the WHO toxicity equivalency factor (WHO-TEF) for the chlorinated analogues. The REPs of a few PXDFs were an order of magnitude higher than the corresponding WHO-TEFs, indicating their toxicological importance. Results with reconstituted mixtures suggest that the activity of brominated and chlorinated dioxins in both CALUX assays was dose-additive. Thus, obtained results indicated the applicability of the CALUX assays as screening tools of brominated dioxins together with their chlorinated analogues.
Assuntos
Dibenzofuranos/toxicidade , Dioxinas/toxicidade , Animais , Bioensaio , Linhagem Celular Tumoral , Relação Dose-Resposta a Droga , Interações Medicamentosas , Genes Reporter , Luciferases/genética , Luciferases/metabolismo , Camundongos , RatosRESUMO
AIMS: A hexanucleotide expansion in C9orf72 is the major genetic cause of inherited behavioural variant Frontotemporal dementia (bvFTD) and motor neurone disease (MND), although the pathological mechanism(s) underlying disease remains uncertain. METHODS: Using antibodies to poly-GA, poly-GP, poly-GR, poly-AP and poly-PR proteins, we examined sections of cerebral cortex, hippocampus, thalamus, cerebellum and spinal cord, from 20 patients with bvFTD and/or MND bearing an expansion in C9orf72 for aggregated deposits of dipeptide repeat proteins (DPR). RESULTS: Antibodies to poly-GA, poly-GP and poly-GR detected numerous rounded cytoplasmic inclusions (NCI) within granule cells of hippocampal dentate gyrus and those of the cerebellum, as well as 'star-burst' shaped NCI in pyramidal neurones of CA3/4 region of hippocampus. NCI were uncommon in Purkinje cells, and only very rarely seen in anterior horn cells. Poly-PA antibody detected occasional NCI within CA3/4 neurones alone, whereas poly-PR antibody did not identify any NCI but immunostained the nucleus of anterior horn cells, CA3/4 neurones and Purkinje cells, in patients with or without expansion in C9orf72, as well as in normal controls. Poly-GA antibody generally detected more DPR than poly-GP, which in turn was greater than poly-GR. All patients with bvFTD + MND or MND showed plentiful p62/TDP-43 positive inclusions in remaining anterior horn cells. CONCLUSION: Degeneration and loss of anterior horn cells associated with expansions in C9orf72 occurs in the absence of DPR, and implies that changes involving loss of nuclear staining for and a cytoplasmic aggregation of TDP-43 are more likely to be the cause of this.
Assuntos
Proteínas de Ligação a DNA/metabolismo , Degeneração Lobar Frontotemporal/patologia , Doença dos Neurônios Motores/patologia , Degeneração Neural/patologia , Proteínas/genética , Idoso , Proteína C9orf72 , Expansão das Repetições de DNA , Dipeptídeos , Feminino , Degeneração Lobar Frontotemporal/genética , Humanos , Imuno-Histoquímica , Corpos de Inclusão/metabolismo , Corpos de Inclusão/patologia , Masculino , Pessoa de Meia-Idade , Doença dos Neurônios Motores/genética , Degeneração Neural/genética , Neurônios/patologiaRESUMO
Brominated flame retardants (BFRs) have been detected in indoor dust in many studies, at concentrations spanning several orders of magnitude. Limited information is available on the pathways via which BFRs migrate from treated products into dust, yet the different mechanisms hypothesized to date may provide an explanation for the range of reported concentrations. In particular, transfer of BFRs to dust via abrasion of particles or fibers from treated products may explain elevated concentrations (up to 210 mg g(-1)) of low volatility BFRs like decabromodiphenyl ether (BDE-209). In this study, an indoor dust sample containing a low concentration of hexabromocyclododecane, or HBCD, (110 ng g(-1) ΣHBCDs) was placed on the floor of an in-house test chamber. A fabric curtain treated with HBCDs was placed on a mesh shelf 3 cm above the chamber floor and abrasion induced using a stirrer bar. This induced abrasion generated fibers of the curtain, which contaminated the dust, and ΣHBCD concentrations in the dust increased to between 4020 and 52 500 ng g(-1) for four different abrasion experiment times. The highly contaminated dust (ΣHBCD at 52 500 ng g(-1)) together with three archived dust samples from various UK microenvironments, were investigated with forensic microscopy techniques. These techniques included Micro X-ray fluorescent spectroscopy, scanning emission microscopy coupled with an energy dispersive X-ray spectrometer, Fourier transform infrared spectroscopy with further BFR analysis on LC-MS/MS. Using these techniques, fibers or particles abraded from a product treated with BFRs were identified in all dust samples, thereby accounting for the elevated concentrations detected in the original dust (3500 to 88 800 ng g(-1) ΣHBCD and 24 000 to 1,438 000 ng g(-1) for BDE-209). This study shows how test chamber experiments alongside forensic microscopy techniques, can provide valuable insights into the pathways via which BFRs contaminate indoor dust.
Assuntos
Poluição do Ar em Ambientes Fechados/análise , Poeira/análise , Monitoramento Ambiental , Retardadores de Chama/análise , Fricção , Habitação , MicroscopiaRESUMO
Microscopic colitis, comprising collagenous colitis and lymphocytic colitis, is epitomized by chronic watery diarrhea, endoscopically normal colonic mucosa, and characteristic histopathological features. Reports on chromoendoscopic findings in microscopic colitis are scarce and in this paper we describe such findings. We have examined 13 patients with microscopic colitis by means of chromoendoscopy with indigo carmine 0.2 %â- 0.5 %. In all 13 cases continuous mucosal changes were seen, with disappearance of innominate grooves or with irregularity of grooves. The segmental distribution of abnormal chromoendoscopic findings corresponded almost completely with the microscopic features. A diffuse mosaic pattern was found in five of 10 cases of collagenous colitis and in all three cases of lymphocytic colitis. Uneven surface was seen in four cases of collagenous colitis, one of collagenous colitis in remission, and one of lymphocytic colitis, and a nodular surface was recorded in five cases of collagenous colitis but in none of the lymphocytic colitis cases. If these findings can be reproduced in larger series of microscopic colitis cases, the need for biopsies as a diagnostic tool might be restricted to patients where chromoendoscopy shows clear mucosal changes, thereby saving costs and limiting possible complications associated with multiple biopsies.
Assuntos
Colite Microscópica/diagnóstico , Colonoscopia , Corantes , Índigo Carmim , Adulto , Idoso , Idoso de 80 Anos ou mais , Colite Colagenosa/diagnóstico , Colite Linfocítica/diagnóstico , Colite Microscópica/patologia , Feminino , Humanos , Mucosa Intestinal/patologia , Masculino , Pessoa de Meia-IdadeRESUMO
Esophageal cancer patients with distant organ metastasis have usually been treated only to palliate symptoms without multimodality therapy. The current study evaluates the role of multimodality therapy in esophageal squamous cell cancer patients with distant organ metastasis. Between February 1988 and January 2007, 80 esophageal squamous cell cancer patients with distant organ metastases were treated at our institution. Multimodality therapy was performed in 58 patients: 43 patients received chemoradiotherapy, 13 underwent surgery followed by chemotherapy and/or radiation therapy, and two received chemotherapy or chemoradiotherapy followed by surgery. Thirteen patients received single-modality therapy; chemotherapy, radiotherapy, or surgery alone. The remaining nine patients received best supportive care alone. The metastatic organ was the liver (n= 40), the lungs (n= 33), bone (n= 10), and other (n= 6). Nine patients had metastasis in two organs. There was no difference in the median survival among the sites of organ metastasis, lung, liver, or bone (P= 0.8786). The survival of patients treated with multimodality therapy was significantly better than that of the patients who received single-modality therapy or best supportive care alone (P < 0.0001). In patients treated with multimodallity therapy, there was no difference in survival for patients treated with surgery compared with patients treated without surgery (P= 0.1291). This retrospective study involves an inevitable issue of patient selection bias. However, these results suggested that multimodality therapy could improve survival of the esophageal squamous cell cancer patients with distant organ metastasis.
Assuntos
Neoplasias Ósseas/secundário , Carcinoma de Células Escamosas/secundário , Neoplasias Esofágicas/mortalidade , Neoplasias Hepáticas/secundário , Neoplasias Pulmonares/secundário , Cuidados Paliativos , Adulto , Idoso , Idoso de 80 Anos ou mais , Protocolos de Quimioterapia Combinada Antineoplásica , Terapia Combinada , Neoplasias Esofágicas/tratamento farmacológico , Neoplasias Esofágicas/patologia , Neoplasias Esofágicas/radioterapia , Neoplasias Esofágicas/cirurgia , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Estadiamento de Neoplasias , Seleção de Pacientes , Estudos Retrospectivos , Taxa de Sobrevida , Resultado do TratamentoRESUMO
The main purpose of this study was to explore the sites and mechanisms of action of metabotropic glutamate receptor 1 (mGluR1) blockade for antipsychotic-like activity using a Fos mapping approach, with the intent of better understanding the similarities and differences between the pharmacological actions of mGluR1 antagonists and atypical antipsychotic drugs such as clozapine. Previously, we showed that an allosteric mGluR1 antagonist (negative allosteric modulator), 2-cyclopropyl-5-[1-(2-fluoro-3-pyridinyl)-5-methyl-1H-1,2,3-triazol-4-yl]-2,3-dihydro-1H-isoindol-1-one (CFMTI), induces Fos expression in the nucleus accumbens and the medial prefrontal cortex (mPFC), but not in the dorsolateral striatum, similar to the action of clozapine. In the present study, the Fos expression profile of CFMTI was more extensively evaluated in various areas of the brain. CFMTI induced Fos expression mainly in glutamatergic neurons in the mPFC, in a manner similar to clozapine. A significant increase in Fos expression was also observed in the locous coeruleus, central amygdaloid nucleus, the bed nucleus of the stria terminalis and the primary somatosensory cortex, but not in the ventral tegmental area, dorsal raphe or lateral septum. Fos expression in orexin neurons in the lateral hypothalamic/perifornical area (LH/PFA) is known to be positively correlated with the weight gain liability of atypical antipsychotics. CFMTI did not increase Fos expression in orexin neurons in the LH/PFA, in contrast to clozapine, which does have weight gain liability. These results suggest that CFMTI has unique and shared actions on Fos expression in various regions of the brain compared with clozapine.
Assuntos
Antipsicóticos/farmacologia , Encéfalo/efeitos dos fármacos , Isoindóis/farmacologia , Proteínas Proto-Oncogênicas c-fos/biossíntese , Receptores de Glutamato Metabotrópico/antagonistas & inibidores , Esquizofrenia/metabolismo , Triazóis/farmacologia , Regulação Alostérica , Animais , Encéfalo/metabolismo , Masculino , Ratos , Ratos Sprague-DawleyRESUMO
This paper reviews 22 cases of minor salivary gland carcinoma of the oral cavity or oropharynx which were treated at Kurume University Hospital between 1976 and 2005. Minor salivary gland carcinoma was observed in eight of 362 patients with cancer of the oral cavity (2 per cent), and in 14 of 275 patients with cancer of the oropharynx (5 per cent). The five-year and 10-year survival rates of patients with oropharyngeal minor salivary gland carcinoma were 90 per cent. No statistically significant difference was observed between survival rates for oropharyngeal minor salivary gland carcinoma and for oropharyngeal squamous cell carcinoma (p = 0.06). The five- and 10-year survival rates of patients with oral cavity minor salivary gland carcinoma were 75 and 37 per cent, respectively. No statistically significant difference was observed between survival rates for oral cavity minor salivary gland carcinoma and oral cavity squamous cell carcinoma.Patients' survival results correlated well with the clinical stage of their lesions. A significant difference in survival was observed, comparing stage IV with stages I, II and III (p = 0.04). In contrast, no significant relationship was found between either survival and tumour type or survival and treatment. Adjuvant therapy is recommended for patients with grade III adenoid cystic carcinoma with perineural infiltration or intravascular infiltration.
Assuntos
Carcinoma de Células Escamosas/mortalidade , Neoplasias Orofaríngeas/mortalidade , Neoplasias das Glândulas Salivares/mortalidade , Adulto , Idoso , Carcinoma de Células Escamosas/patologia , Carcinoma de Células Escamosas/terapia , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Boca , Neoplasias Orofaríngeas/patologia , Neoplasias Orofaríngeas/terapia , Orofaringe , Estudos Retrospectivos , Neoplasias das Glândulas Salivares/patologia , Neoplasias das Glândulas Salivares/terapia , Taxa de SobrevidaRESUMO
The first study to examine whether parental radiation exposure leads to increased heritable risk of common adult-onset multifactorial diseases (i.e., hypertension, diabetes mellitus, hypercholesterolemia, ischemic heart disease, and stroke) was conducted among 11,951 participants in the clinical examination program out of a potential of 24,673 mail survey subjects who were offspring of survivors born from May 1946 through December 1984. Logistic regression analyses demonstrated no evidence of an association between the prevalence of multifactorial diseases in the offspring and parental radiation exposure, after adjusting for age, city, gender and various risk factors. The odds ratio (OR) for a paternal dose of 1 Gy was 0.91 [95% confidence interval (CI) 0.81-1.01, P = 0.08], and that for a maternal dose of 1 Gy was 0.98 (95% CI 0.86-1.10, P = 0.71). There was no apparent effect of parental age at exposure or of elapsed time between parental exposure and birth, but male offspring had a low odds ratio (OR = 0.76 at 1 Gy) for paternal exposure, but cautious interpretation is needed for this finding. The clinical assessment of nearly 12,000 offspring of A-bomb survivors who have reached a median age of about 50 years provided no evidence for an increased prevalence of adult-onset multifactorial diseases in relation to parental radiation exposure.
Assuntos
Filhos Adultos , Doenças Cardiovasculares/epidemiologia , Diabetes Mellitus/epidemiologia , Hipercolesterolemia/epidemiologia , Exposição Materna/efeitos adversos , Armas Nucleares , Exposição Paterna/efeitos adversos , Adulto , Idade de Início , Doenças Cardiovasculares/genética , Diabetes Mellitus/genética , Feminino , Predisposição Genética para Doença , Humanos , Hipercolesterolemia/genética , Japão/epidemiologia , Modelos Logísticos , Masculino , Pessoa de Meia-Idade , Prevalência , Doses de Radiação , Risco , Sobreviventes , Adulto JovemRESUMO
Spilanthes oleracea L., popularly known as toothache plant, belongs to the family Asteraceae and is a South American native plant. Fresh leaves can be eaten for their medicinal properties or used by the cosmetics industry for their spilol contents. Plants showing leaf deformation that were collected in a field in São Paulo State, Brazil in March 2005 were suspected to be infected by a virus. Electron microscopy of leaf dip preparations of symptomatic plants revealed pleiomorphic particles typical of tospoviruses. Extracts from these plants prepared with 0.01 M sodium phosphate buffer, pH 7.0, containing 1% sodium sulfite were mechanically inoculated to indicator plants. Chenopodium amaranticolor and Gomphrena globosa were symptomless. Necrotic local lesions were observed on C. quinoa. Necrotic local lesions followed by a systemic necrosis that caused the death of the plants were observed on Datura stramonium, Nicotiana glutinosa, and N. tabacum 'TNN' and 'Turkish'. Concentric rings followed by systemic necrosis and plant death were induced on N. rustica, N. tabacum 'Havana 425', N. clevelandii, Physalis floridana, Capsicum annum 'Magda', and Solanum lycopersicum 'Santa Clara'. Total RNA was extracted (1) from infected S. oleracea and N. rustica plants for reverse transcription-PCR amplification with tospovirus specific primers BR60 (5' CCCGGATCCTGCAGAGCAATTGTGTCA 3') and BR65 (5' ATCAAGCCTTCTGAAAGTCAT 3') (2), which amplified an approximate 440-bp fragment covering part of the nucleocapsid protein gene. This fragment was sequenced (EMBL Accession No. AM887766) and showed 99% nt sequence identity with Tomato chlorotic spot virus (TCSV) (GenBank Accession No. AF521102), a tospovirus species (3). To our knowledge, this is the first report of a tospovirus infecting S. oleracea in Brazil and indicates that this plant might constitute a reservoir of TCSV or other tospoviruses that could also infect tomato and pepper plants. References: (1) Y. D. Bertheau et al. DNA amplification by polymerase chain reaction (PCR) 1998 in: Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica on Potatoes. M. C. N. Perombelon and J. M. van der Wolf, eds. Scott. Crop Res. Inst. Occas. Publ. Dundee, Scotland, 1998. (2) M. Eiras et al. Fitopatol. Bras. 26:170, 2001. (3) F. Lovato et al. Virus Genes 29:321, 2004.
RESUMO
OBJECTIVE: To determine the mortality risk of Japanese patients with rheumatoid arthritis, taking into account lifestyle and physical factors, including comorbidity. METHODS: 91 individuals with rheumatoid arthritis were identified during screening a cohort of 16 119 Japanese atomic bomb survivors in the period 1958 to 1966. These individuals and the remainder of the cohort were followed for mortality until 1999. Mortality risk of the rheumatoid patients was estimated by the Cox proportional hazards model. In addition to age and sex, lifestyle and physical factors such as smoking status, alcohol consumption, blood pressure, and comorbidity were included as adjustment factors for the analysis of total mortality and for analysis of mortality from each cause of death. RESULTS: 83 of the rheumatoid patients (91.2%) and 8527 of the non-rheumatoid controls (52.9%) died during mean follow up periods of 17.8 and 28.0 years, respectively. The age and sex adjusted hazard ratio for mortality in the rheumatoid patients was 1.60 (95% confidence interval, 1.29 to 1.99), p < 0.001. Multiple adjustments, including for lifestyle and physical factors, resulted in a similar mortality hazard ratio of 1.57 (1.25 to 1.94), p < 0.001. Although mortality risk tended to be higher in male than in female rheumatoid patients, the difference was not significant. Pneumonia, tuberculosis, and liver disease were significantly increased as causes of death in rheumatoid patients. CONCLUSIONS: Rheumatoid arthritis is an independent risk factor for mortality. Infectious events are associated with increased mortality in rheumatoid arthritis.
Assuntos
Artrite Reumatoide/mortalidade , Adulto , Causas de Morte , Comorbidade , Fatores de Confusão Epidemiológicos , Métodos Epidemiológicos , Feminino , Humanos , Japão/epidemiologia , Estilo de Vida , Masculino , Pessoa de Meia-IdadeRESUMO
AIM/HYPOTHESIS: HbA(1)c concentrations are known to be associated with all-cause excess mortality risk in Caucasians. However, the relationship has not been clarified well in the Japanese. In addition, studies of the relationship between HbA(1)c and mortality from malignant neoplasms are scarce. METHODS: HbA(1)c was measured for 3,710 people of a cohort composed of A-bomb survivors and controls. At baseline they were divided into five groups: a normal HbA(1)c group of 1,143 individuals with HbA(1)c of <5.5%, a slightly high but normal HbA(1)c group of 1,341 individuals with HbA(1)c > or =5.5% to <6.0%, a slightly high HbA(1)c group of 589 individuals with HbA(1)c > or =6.0% to <6.5%, a high HbA(1)c group of 259 individuals with HbA(1)c > or =6.5%, and a group of 378 individuals known to have type 2 diabetes. Using a Cox proportional hazards model, hazard ratios based on comparisons with the normal HbA(1)c group were obtained. RESULTS: During the observation period there were 754 deaths. For all-cause and cardiovascular disease mortality, a significant increase of the hazard ratio was observed for the slightly high HbA(1)c group. A similar increase in malignant neoplasm-related mortality was observed for both the high HbA(1)c group and the diabetes group. CONCLUSIONS/INTERPRETATION: Our results suggest that individuals in the Japanese population with HbA(1)c levels of 6% or more might have increased mortality risk. The results indicate that HbA(1)c measurements should be sought even for people who have not been diagnosed with diabetes.
Assuntos
Hemoglobinas Glicadas/metabolismo , Mortalidade , Idoso , Doenças Cardiovasculares/mortalidade , Causas de Morte , Feminino , Humanos , Japão , Masculino , Neoplasias/mortalidade , Guerra Nuclear , Modelos de Riscos Proporcionais , Lesões por Radiação/mortalidade , Valores de ReferênciaRESUMO
BACKGROUND: Dysfunctional and normally perfused remote regions show equal myolysis and glycogen accumulation in pig hibernating myocardium. We tested the hypothesis that these arose secondary to elevations in preload rather than ischemia. METHODS AND RESULTS: Expression of structural protein (desmin, desmoplakin, titin, cardiotin, alpha-smooth muscle actin, lamin-A/C, and lamin-B2) in viable dysfunctional myocardium was analyzed by immunohistochemistry. We performed blinded analysis of paired dysfunctional left anterior descending coronary artery and normal remote subendocardial samples from stunned (24 hours; n=6), and hibernating (2 weeks; n=6) myocardium versus sham controls pigs (n=7). Within 24 hours, cardiac myocytes globally reexpressed alpha-smooth muscle actin. In stunned myocardium, cardiotin was globally reduced, whereas reductions in desmin were restricted to the dysfunctional region. Alterations progressed with the transition to hibernating myocardium, in which desmin, cardiotin, and titin were globally reduced. A qualitatively similar reorganization of cytoskeletal proteins occurred 3 hours after transient elevation of left ventricular end-diastolic pressure to 33+/-3 mm Hg. CONCLUSIONS: Qualitative cardiomyocyte remodeling similar to that in humans with chronic hibernation occurs rapidly after a critical coronary stenosis is applied, as well as after transient elevations in left ventricular end-diastolic pressure in the absence of ischemia. Thus, reorganization of cytoskeletal proteins in patients with viable dysfunctional myocardium appears to reflect chronic and/or cyclical elevations in preload associated with episodes of spontaneous regional ischemia.
Assuntos
Proteínas do Citoesqueleto/biossíntese , Regulação da Expressão Gênica , Proteínas Musculares/biossíntese , Miocárdio Atordoado/genética , Actinina/biossíntese , Actinina/genética , Actinas/biossíntese , Actinas/genética , Animais , Conectina , Doença das Coronárias/genética , Doença das Coronárias/metabolismo , Proteínas do Citoesqueleto/genética , Desmina/biossíntese , Desmina/genética , Desmoplaquinas , Progressão da Doença , Proteínas Fetais/biossíntese , Proteínas Fetais/genética , Lamina Tipo A/biossíntese , Lamina Tipo A/genética , Lamina Tipo B/biossíntese , Lamina Tipo B/genética , Proteínas Musculares/genética , Isquemia Miocárdica/genética , Isquemia Miocárdica/metabolismo , Miocárdio Atordoado/metabolismo , Pressão , Proteínas Quinases/biossíntese , Proteínas Quinases/genética , Método Simples-Cego , Sus scrofaRESUMO
PURPOSE: Ophthalmologic examinations were conducted on atomic bomb (A-bomb) survivors 55 years after exposure. MATERIALS AND METHODS: A-bomb survivors who had been exposed before 13 years of age at the time of the bombings in 1945 or who had been examined in a previous study between 1978 and 1980. The examinations, conducted between June 2000 and September 2002, included slit-lamp examination, digital photography and a cataract grading system for three parts of the lens (nucleus, cortex and posterior subcapsule) as an outcome variable. Proportional odds logistic regression analysis was conducted using the lowest grading class as a reference and included explanatory variables such as age, sex, city, dose and various cataract-related risk factors. When the grades in an individual differed, the worst grade was used. RESULTS: Results indicate that odds ratios (ORs) at 1 Sv were 1.07 (95% confidence intervals [CI] 0.90, 1.27) in nuclear colour, 1.12 (95% CI 0.94, 1.30) in nuclear cataract, 1.29 (95% CI 1.12, 1.49) in cortical cataract and 1.41 (95% CI 1.21, 1.64) in posterior subcapsular cataract. The same was true after excluding 13 people whose posterior subcapsular cataracts had been previously detected. CONCLUSION: Significant radiation effects were observed in two types of cataracts in A-bomb survivors.
Assuntos
Catarata/epidemiologia , Guerra Nuclear/estatística & dados numéricos , Lesões por Radiação/epidemiologia , Medição de Risco/métodos , Sobreviventes/estatística & dados numéricos , Adolescente , Adulto , Distribuição por Idade , Idoso , Criança , Pré-Escolar , Relação Dose-Resposta à Radiação , Feminino , Humanos , Lactente , Recém-Nascido , Japão/epidemiologia , Masculino , Pessoa de Meia-Idade , Doses de Radiação , Fatores de Risco , Índice de Gravidade de Doença , Distribuição por SexoRESUMO
BACKGROUND: Statistical data of mortality and morbidity related to anesthesia have not been reported in Japan since World War II. The need to comprehensively examine the events of cardiac arrest as well as mortality prompted the first national study in Japan. METHODS: Confidential questionnaires were sent to all Japan Society of Anesthesiologists Certified Training Hospitals every year from 1994 through 1998. Collected data were analyzed for incidence of cardiac arrest and other critical events during anesthesia and surgery, and their outcomes within 7 postoperative days. The principal causes of the critical incidents were also analyzed. RESULTS: With an average response rate of 39.9%, a total of 2,363,038 cases were documented over 5 years. The average incidence per year of cardiac arrest during surgery due to all etiologies and that totally attributable to anesthesia was 7.12 [95%CI: 6.30,7.94] and 1.00 [0.88, 1.12]) per 10,000 cases, respectively. The average mortality per year in the operating room or within 7 postoperative days due to all etiologies and that totally attributable to anesthesia was 7.18 [6.22, 8.13] and 0.21 [0.15, 0.27] per 10,000 cases, respectively. The two principal causes of cardiac arrest during anesthesia and surgery due to all etiologies were massive hemorrhage (31.9%) and surgery (30.2%), and those totally attributable to anesthesia were drug overdose or selection error (15.3%) and serious arrhythmia (13.9%). Preventable human errors caused 53.2% of cardiac arrest and 22.2% of deaths in the operating room totally attributable to anesthesia. CONCLUSIONS: The rates in Japan of cardiac arrest and death during anesthesia and surgery due to all etiologies as well as those totally attributable to anesthesia are comparable to those of other developed countries.
Assuntos
Anestesia/efeitos adversos , Anestesia/mortalidade , Parada Cardíaca/epidemiologia , Mortalidade Hospitalar , Humanos , Hipotensão/epidemiologia , Hipóxia/epidemiologia , Complicações Intraoperatórias/mortalidade , Japão/epidemiologia , Morbidade , Complicações Pós-Operatórias/mortalidade , Procedimentos Cirúrgicos Operatórios/efeitos adversos , Procedimentos Cirúrgicos Operatórios/mortalidade , Inquéritos e QuestionáriosRESUMO
Self-incompatibility (SI) discriminating self- and non-self pollen is regulated by S-locus genes in Brassica. In most of the S haplotypes, a highly polymorphic S-locus glycoprotein ( SLG) gene is tightly linked to genes for the SI determinants, S-receptor kinase ( SRK) and SP11, although the precise function of SLG in SI has not been clarified. In the present study, we performed DNA gel blot analysis for S(32), S(33), and S(36) haplotypes of Brassica rapa showing normal SI phenotypes and concluded that there might be no SLG in their genome. RNA gel blot analysis of the SLG-less S haplotypes indicated the possible existence of eSRK transcripts in the stigma. These three S haplotypes are useful resources to discern the molecular mechanism of the SI reaction without SLG.
Assuntos
Brassica/genética , Genoma de Planta , Glicoproteínas/genética , Haplótipos , Proteínas de Plantas/genéticaRESUMO
A nuclear criticality accident occurred in Japan on September 30, 1999, which resulted in severe exposure of three victims to mixed flux of neutrons and gamma-rays. Estimated average doses for the three victims were 5.4 Gy of neutrons and 8.5 Gy of gamma-rays for Patient A, 2.9 Gy of neutrons and 4.5 Gy of gamma-rays for Patient B, and 0.81 Gy of neutrons and 1.3 Gy of gamma-rays for Patient C. They then suffered the consequences of the effects of ionizing radiation resulting in acute radiation syndrome. In Patients A and B, bone marrow failure was so severe that they received haematopoietic stem cell transplantation. The graft initially took successfully in both patients, although in Patient B it was later taken over by his own haematopoietic cells. They also suffered from severe skin lesions, later exhibited gastrointestinal bleeding and eventually died of multiple organ failure 82 and 210 days after the accident, respectively. The survival of these patients beyond the period of agranulocytosis means that bone marrow failure per se caused by exposure to ionizing radiation may now be overcome. Patient C also developed bone marrow failure and was treated with granulocyte colony-stimulating factor as well as supportive care. He recovered without major complications and is now under periodical follow-up. Remarkably, during the prodromal phase, all the patients exhibited hypoxaemia, two of whom also showed interstitial oedema of the lungs. In Patient C these manifestations improved within a week. The circumstances of the accident and the initial medical treatment of the victims are described.
Assuntos
Lesões por Radiação/terapia , Liberação Nociva de Radioativos , Adulto , Evolução Fatal , Raios gama , Transplante de Células-Tronco Hematopoéticas , Humanos , Japão , Masculino , Pessoa de Meia-Idade , Nêutrons , Exposição Ocupacional , Doses de Radiação , Lesões por Radiação/diagnóstico , Lesões por Radiação/etiologiaRESUMO
Myelodysplastic syndrome (MDS) is a clonal disorder of hematopoietic stem cells. To investigate whether chromosomal instability and/or DNA repair defects are involved in the development of MDS, we measured the micronucleus (MN) frequency in peripheral blood lymphocytes exposed to various doses of X-rays, using a cytokinesis-block micronucleus assay. The spontaneous MN frequencies in RAEB and RAEB-T patients were significantly higher than those in normal individuals (P = 0.0224, P = 0.008, respectively). Also, the X-ray-induced MN frequencies in RA/RARS, RAEB, and RAEB-T patients were significantly higher than those in normal individuals (P = 0.007, P = 0.003, P = 0.003, respectively, at 2 Gy). In order to elucidate the cause of unusual radiosensitivity, we measured the expression levels of nucleotide excision repair (NER) genes in peripheral blood mononuclear cells using a RT-PCR method. Reduction of NER gene expression was found in only one of 10 patients with low risk MDS, but in four of 11 patients with high risk MDS. Our data suggest that chromosomal instability and DNA repair defects may be involved in the pathophysiology of disease progression of MDS.
Assuntos
Aberrações Cromossômicas , Endonucleases , Síndromes Mielodisplásicas/genética , Síndromes Mielodisplásicas/radioterapia , Tolerância a Radiação , Adulto , Idoso , Idoso de 80 Anos ou mais , Primers do DNA/química , Reparo do DNA , Proteínas de Ligação a DNA/genética , Relação Dose-Resposta à Radiação , Proteínas de Drosophila/genética , Feminino , Humanos , Cariotipagem , Linfócitos/sangue , Linfócitos/patologia , Masculino , Testes para Micronúcleos , Pessoa de Meia-Idade , Proteínas Nucleares , Proteínas/genética , RNA Mensageiro/metabolismo , RNA Neoplásico/metabolismo , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Fatores de Transcrição , Raios XRESUMO
Accidental exposure to acute high-dose total body neutron radiation is rare. We report a 35-year-old man exposed to a total body dose of 5.4 Gy neutron- and 8.5-13 Gy gamma-radiation in a radiation criticality accident. He received a blood stem cell transplant from his HLA-identical sister. There was bone marrow recovery with complete donor chimerism. Random chromatid breaks were observed in donor cells suggesting a bystander effect of neutron exposure. The subject died 82 days after the accident (75 days post transplant) from multi-organ failure.