RESUMO
Wheat (Triticum aestivum) is the third most cultivated field crop in Paraguay; it is grown on over 450,000 hectares with an annual production of 927,776 tons (fao.org/faostat). In 1952, Septoria tritici blotch (STB) was associated with the fungus Septoria tritici solely based on microscopic observation of conidia (Viedma and Delgado 1987). However, no morphometric or molecular studies have been performed in Paraguay up to date. Over the following decades, STB epidemic outbreaks were recorded, with a reduction in wheat production of up to 70% (Viedma and Delgado 1987). During winter 2021, leaf blotch symptoms were observed with an incidence above 50% in wheat fields in Capitán Miranda, Itapúa, Paraguay. Scattered, spherical, buried, and light brown necrotic spots with dark edges were observed on the leaves. Pycnidia with prominent central ostiole were observed. Leaves with symptoms were washed with 1% sodium hypochlorite for 1 min, rinsed with sterile distilled water, and incubated in wet chambers to induce sporulation of the fungus. Pycnidia produced greyish to white cirri. Isolated conidia were thin, elongated, and hyaline, ranging from 26.9-72.7 × 1.5-2.9 µm with one to three septa. Monosporic colonies on potato dextrose agar (PDA, ; Difco laboratories, Detroit, MI) media varied in color from white to pink, dark gray to black, or black with stroma-like structures. Based on morphology, the fungus was characterized as Zymoseptoria tritici (Hoorne et al. 2002; Gilchrist-Saavedra et al. 2005). Fungal DNA was extracted from mycelia, and the internal transcribed spacer (ITS), translation elongation factor 1-α (TEF1-α), 28S rRNA gene (LSU), actin gene (act), calmodulin (CaM) were amplified using ITS1/ITS4, EF1-728F/EF-2, LSU1Fd/ LR5, ACT-512F/ACT-783R, CAL-228F/CAL737R primers, respectively. PCR amplicons were sequenced at Macrogen (Seoul, Republic of Korea) and deposited in the NCBI GenBank database (ITS: OQ360718; TEF1-α: OQ999044, LSU: OQ996413, act: OQ999046, CaM: OQ999045). Sequences were aligned with several isolates of Septoria spp. previously reported (Verkley et al. 2013; Stukenbrock et al. 2012) using ClustalW. The alignments were concatenated with Bioedit (Hall 1999). The UPGMA method with 1,000 bootstrap replications, was used to construct the phylogenetic tree using MEGA11 with Readeriella mirabilis as the outgroup. The isolate from Paraguay grouped into the Zymoseptoria tritici clade with 96% bootstrap support. To confirm pathogenicity, ten wheat plants cv. Itapúa 80 were grown in pots for three weeks in growth chambers (22 ± 2°C; 16 h photoperiod). Subsequently, these plants were inoculated with 1×107 conidia ml-1 suspension, and ten non-inoculated plants served as control. Seven days after inoculation (DAI), symptoms were observed displaying oval necrotic lesions and approximately 14 DAI abundant pycnidia were observed on and around the lesions. Segments of symptomatic leaves were placed in moisture chambers overnight to enhance cirri development. Conidia were mounted on a slide and observed under the compound microscope. Individual cirrhus were transferred to plates containing PDA and produced colonies like those used in the inoculation (Hoorne et al. 2002). We confirmed that the causal agent of STB from wheat fields in Paraguay was Zymoseptoria tritici. This pathogen causes annual wheat disease epidemics in Paraguay; therefore, optimizing surveillance for early detection and understanding its distribution will improve integrated management.
RESUMO
Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.
RESUMO
BACKGROUND: The most common infusion in southern Latin-American countries is prepared with dried leaves of Ilex paraguariensis A. St.-Hil., an aboriginal ancestral beverage known for its high polyphenols concentration currently consumed in > 90% of homes in Argentina, in Paraguay and Uruguay. The economy of entire provinces heavily relies on the production, collection and manufacture of Ilex paraguariensis, the fifth plant species with highest antioxidant activity. Polyphenols are associated to relevant health benefits including strong antioxidant properties. Despite its regional relevance and potential biotechnological applications, little is known about functional genomics and genetics underlying phenotypic variation of relevant traits. By generating tissue specific transcriptomic profiles, we aimed to comprehensively annotate genes in the Ilex paraguariensis phenylpropanoid pathway and to evaluate differential expression profiles. RESULTS: In this study we generated a reliable transcriptome assembly based on a collection of 15 RNA-Seq libraries from different tissues of Ilex paraguariensis. A total of 554 million RNA-Seq reads were assembled into 193,897 transcripts, where 24,612 annotated full-length transcripts had complete ORF. We assessed the transcriptome assembly quality, completeness and accuracy using BUSCO and TransRate; consistency was also evaluated by experimentally validating 11 predicted genes by PCR and sequencing. Functional annotation against KEGG Pathway database identified 1395 unigenes involved in biosynthesis of secondary metabolites, 531 annotated transcripts corresponded to the phenylpropanoid pathway. The top 30 differentially expressed genes among tissue revealed genes involved in photosynthesis and stress response. These significant differences were then validated by qRT-PCR. CONCLUSIONS: Our study is the first to provide data from whole genome gene expression profiles in different Ilex paraguariensis tissues, experimentally validating in-silico predicted genes key to the phenylpropanoid (antioxidant) pathway. Our results provide essential genomic data of potential use in breeding programs for polyphenol content. Further studies are necessary to assess if the observed expression variation in the phenylpropanoid pathway annotated genes is related to variations in leaves' polyphenol content at the population scale. These results set the current reference for Ilex paraguariensis genomic studies and provide a substantial contribution to research and biotechnological applications of phenylpropanoid secondary metabolites.
