Changes in Magnetic Resonance Imaging Radiomic Features in Response to Androgen Deprivation Therapy in Patients with Intermediate- and High-risk Prostate Cancer.

AIMS: The benefits of neoadjuvant androgen deprivation therapy (nADT) in the management of intermediate- and high-risk prostate cancer patients have been well-established. The aim of this study was to identify radiomic prognostic features derived from routine anatomic magnetic resonance imaging (MRI) sequences that can predict the response of the prostate cancer to nADT. MATERIALS AND METHODS: Patients with intermediate- and high-risk prostate cancer (with one of clinical stage ≥ T2c, Gleason score ≥7 or presenting prostate-specific antigen ≥10) who received 3 months of ADT prior to radical external beam radiotherapy were enrolled into this study. The relative blood volume and the relative blood flow were used as dynamic MRI kinetic parameters to quantify vascular changes as responses to nADT. For all pre- and post-nADT data sets, a combination of T2-weighted and contrast-enhanced T1-weighted anatomic images were used to define regions of interest (ROI) as the dominant malignant nodules (DMNs) and the benign prostate (the entire prostate with the summed DMNs being subtracted). MRI textural radiomic features associated with prostate cancer response in the literature of energy and homogeneity were selected. Pyradiomics was used to extract textural features of the ROIs. A Wilcoxon signed-rank test was carried out to investigate if there were statistically significant differences in values of radiomic features between: (i) benign prostate ROI and DMN pre-nADT; (ii) pre- and post-nADT of benign prostate ROI; (iii) pre- and post-nADT of DMN. Changes in radiomic features and dynamic MRI kinetic parameters were correlated using the Spearman correlation test. RESULTS: Twenty prostate cancer patients were recruited into the study. The median time between the first baseline scan and the first on-treatment scan was 91.5 days (range 82-105). One patient had no discernible tumour visible, leaving 19 patients with evaluable data for the analysis. Baseline homogeneity and energy values differed significantly between benign and malignant tissue (P < 0.01). In response to nADT, homogeneity and energy showed reciprocal changes, significantly increased in benign prostate while decreasing in the DMN. The reduction in tumour homogeneity and energy feature values showed a positive association with the decline in tumour blood flow and tumour blood volume induced by androgen deprivation as derived from dynamic MRI parameters. CONCLUSION: Energy and homogeneity radiomic features derived from MRI of benign and malignant prostate showed significant reciprocal changes in response to nADT. This study confirms the potential of these radiomic features to act as surrogate markers of tumour androgen sensitivity due to their strong association with ADT-induced physiological effects in prostate tumours.

Anaesthesia for abnormally invasive placenta: a single-institution case series.

BACKGROUND: Abnormally invasive placenta describes a spectrum of disorders resulting in pathological placental implantation. It is associated with the potential for severe maternal haemorrhage and poor fetal outcome. Increasing numbers of women are at risk owing to the rising incidence of uterine surgery and increasing maternal age. We report data over a five-year period describing anaesthetic management of cases of abnormally invasive placenta in a UK tertiary-referral maternity unit and assess how management has developed. METHODS: Surgically confirmed cases of abnormally invasive placenta were identified from January 2011 to January 2016. Cases were identified using standard ICD-10 codes and by review of departmental records, with surgically-confirmed cases included following review of medical records. RESULTS: Forty cases of abnormally invasive placenta were identified. Eighteen (40%) women had significant medical co-morbidity. All parturients were delivered by caesarean delivery. Caesarean hysterectomy occurred in 24 (60%) cases, delayed hysterectomy in two (5%) and the uterus was preserved in the remaining 14 (35%). Thirty-eight (95%) caesarean deliveries were commenced under neuraxial anaesthesia with 17 (45%) converted to general anaesthesia intraoperatively. Interventional radiology was undertaken in 23 (58%) cases. Median [range] estimated blood loss was 1700mL [500-12000mL]. Intraoperative transfusion of packed red cells occurred in 14 (35%) cases. Intraoperative cell salvage was used in 26 (65%) cases. Four (10%) women were admitted to critical care postoperatively. There were no maternal deaths. CONCLUSION: Our data illustrate the burden on healthcare resources associated with management of abnormally invasive placenta, underlining the continued need for centralised services for treatment of these complex cases. An integrated multidisciplinary approach to case planning, case management and service provision is key to a successful outcome in these cases.

The severity of circulating neutrophil dysfunction in patients with cirrhosis is associated with 90-day and 1-year mortality.

BACKGROUND: Patients with cirrhosis are susceptible to sepsis, pre-disposing to the development of encephalopathy, bleeding and organ dysfunction with associated high mortality. AIM: To characterise circulating neutrophil function in a cirrhotic cohort as a determinant of 90-day and 1-year mortality. METHODS: Sixty-two patients with cirrhosis [49 stable (Child-Pugh A/B/C = 24%/39%/37%); 13 acute-on-chronic liver failure] were prospectively studied and compared with 11 healthy controls. Neutrophil function was evaluated at baseline and repeated at critical points during the course of the patient's illness until death/transplantation. Neutrophil phenotype was determined using fluorochrome-labelled antibodies to CD16/CD11b and assessed by flow cytometry. Neutrophil phagocytic activity (NPA) and capacity (NPC) were determined using FITC-labelled opsonised Escherichia coli. Oxidative burst (OB) was quantified by the percentage of neutrophils producing reactive oxygen species (ROS) and mean fluorescence intensity at rest, and after stimulation with E. coli. Physiological variables, biochemistry, microbiology and outcomes were collected. Plasma pro- and anti-inflammatory cytokine profiles were performed by ELISA. RESULTS: NPA/NPC was impaired in cirrhosis with the most significant dysfunction being observed in those with advanced disease and in those treated with propranolol. NPC predicted survival in stable cirrhosis [AUROC 0.83 (95% CI 0.68-0.97); P = 0.021] and differentiated survivors from nonsurvivors (90-day P = 0.01; 1 year P < 0.001). Resting OB ≥12% predicted 90-day mortality with 80% sensitivity and 71% specificity [AUROC 0.81 (95% CI 0.64-0.97); P = 0.026 and differentiated survivors from nonsurvivors; P = 0.015]. CONCLUSION: Circulating neutrophils in patients with cirrhosis are dysfunctional and predict the development of infection, organ dysfunction and survival at 90 days and 1 year.

Comparison of scoring systems and outcome of patients admitted to a liver intensive care unit of a tertiary referral centre with severe variceal bleeding.

BACKGROUND: Acute variceal haemorrhage (AVH) is associated with significant mortality. AIMS: To determine outcome and factors associated with hospital mortality (HM) in patients with AVH admitted to intensive care unit (ICU) and to compare outcomes of patients requiring transfer to a tertiary ICU (transfer group, TG) to a local in-patient group (LG). METHODS: A retrospective study of all adult patients (N = 177) admitted to ICU with AVH from 2000-2008 was performed. RESULTS: Median age was 48 years (16-80). Male represented 58%. Median MELD score was 16 (6-39), SOFA score was 8 (6-11). HM was higher in patients who had severe liver disease or critical illness measured by MELD, SOFA, APACHE II scores and number of failed organs (NFO), P < 0.05. Patients with day-1 lactate ≥ 2 mmol/L had increased HM (P < 0.001). MELD score performed as well as APACHE II, SOFA and NFO (P < 0.001) in predicting HM (AUROC = 0.84, 0.81, 0.79 and 0.82, respectively P > 0.05 for pair wise comparisons). Re-bleeding was associated with increased HM (56.9% vs. 31.6%, P = 0.002). The TG (n = 124) had less severe liver disease and critical illness and consequently had lower HM than local patients (32% vs. 57%, P = 0.002). TG patients with ≥2 endoscopies prior to transfer had increased 6-week mortality (P = 0.03). Time from bleeding to transfer ≥3 days was associated with re-bleeding (OR = 2.290, P = 0.043). CONCLUSIONS: MELD score was comparable to ICU prognostic models in predicting mortality. Blood lactate was also predictive of hospital mortality. Delays in referrals and repeated endoscopy were associated with increased re-bleeding and mortality in this group.

Can combined 18F-FDG-PET and dynamic contrast-enhanced MRI predict behavior of desmoid tumors in patients with familial adenomatous polyposis?

BACKGROUND: Desmoid tumors associated with familial adenomatous polyposis show variable behavior; about 10% grow relentlessly, resulting in severe morbidity or mortality. Investigations that could identify the minority of desmoid tumors that behave aggressively would allow these tumors to be treated early and spare the majority of patients who have more benign disease from unnecessary intervention. OBJECTIVE: The aim of this study was to investigate whether imaging the tumor metabolic-vascular phenotype by modern methods predicts growth. DESIGN: This is a prospective case series study. SETTINGS: The study was conducted at a tertiary center specializing in familial adenomatous polyposis and desmoid disease. PATIENTS: Nine patients with familial adenomatous polyposis (4 male, mean age 39 years) with desmoid tumor underwent 18F-FDG-PET and dynamic contrast-enhanced MRI. Standard MRI was repeated a year later to assess tumor growth. MAIN OUTCOME MEASURES: The primary outcome measured was the correlation between 18F-FDG-PET and dynamic contrast-enhanced MRI parameters and subsequent desmoid growth. RESULTS: Failed intravenous access precluded dynamic contrast-enhanced MRI in 1 female patient. Thirteen desmoid tumors (4 intra-abdominal, 2 extra-abdominal, 7 abdominal wall; mean area, 68 cm) were analyzed in the remaining 8 patients. Two patients died before follow-up MRI. Five tumors decreased in size, 3 increased in size, and 3 remained stable after a year. Significant correlation (Spearman rank correlation, significance at 5%) existed between maximum standardized uptake value and k(ep) (r = -0.56, p = 0.04), but not with other vascular parameters (K(trans) (r = -0.47, p = 0.09); v(e) (r = -0.11, p = 0.72); integrated area under the gadolinium-time curve at 60 seconds (r = -0.47, p = 0.10)). There was no significant difference in the maximum standardized uptake value or dynamic contrast-enhanced MRI parameters (K(trans), v(e), k(ep), integrated area under the gadolinium-time curve at 60 seconds) between the tumors that grew or decreased in size or between the tumor sites. However, vascular metabolic ratio (maximum standardized uptake value/K(trans)) was significantly different for tumor site (p = 0.001) and size (p = 0.001, 1-way ANOVA). LIMITATIONS: This investigation is limited because of its exploratory nature and small patient numbers. CONCLUSIONS: Although not predictive for tumor behavior, some correlations existed between dynamic contrast-enhanced MRI and 18F-FDG-PET parameters. Vascular metabolic ratio may provide further information on tumor behavior; however, this needs to be evaluated with further larger studies.

Ethnicity predicts perceptions of smoking and smoking cessation among veterans.

The objective of this study was to determine if race/ethnicity predicts motivation to quit smoking and preferences for cessation services among smokers serviced by a primarily psychiatric Veterans Affairs hospital. A self-administered survey was given to a convenience sample of smokers (n=146) at the Battle Creek Veterans Affairs Medical Center. Univariate, bivariate and multivariate regression analyses were calculated to determine the association between race/ethnicity and motivation to quit smoking. Forty-two per cent of the sample was non-white. Non-white patients smoked significantly less cigarettes per day as compared with white patients (P=0.002). In the multivariate analyses, compared with whites, non-whites had 3.5 times greater odds of thinking that quitting smoking was extremely/very important to health (P= 0.01), 4.0 times greater odds of thinking of quitting using tobacco products in the next 30 days (P=0.004) and 3.4 times greater odds of being interested in receiving smoking cessation services (P=0.007). Yet, non-white patients were less likely to be interested in intensive nurse counselling and cessation medications. As the number of non-whites continues to increase in the military, novel strategies may be needed to capitalize on the high motivation to quit smoking and preference for non-traditional interventions among non-white smokers treated in Veterans Affairs hospitals.

First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio.

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 µm (mean 583.0 µm), stylet length from 15.0 to 17.8 µm (mean 16.8 µm), tail length from 23.2 to 37.5 µm (mean 29.2 µm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 µm (mean 3.1 µm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c' = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 µm (mean 537.9 µm), stylet length from 15.0 to 17.2 µm (mean 16.2 µm), tail length from 22.7 to 28.1 µm (mean 25.5 µm), spicule from 15.0 to 17.5 µm (mean 16.4 µm), gubernaculum from 3.5 to 4.7 µm (mean 4.0 µm), and DGO from 2.6 to 3.7 µm (mean 3.1 µm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c' = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

First Report of Impatiens Downy Mildew Caused by Plasmopara obducens in Ohio.

Single and double flowered impatiens (Impatiens walleriana Hook.f.) plants with symptoms of downy mildew were found in commercial greenhouses in Delaware, Wayne, and Holmes counties, Ohio, in April 2012. Plants were stunted and defoliated. Symptoms on remaining leaves included general chlorosis without discrete spots and downward curling of leaves. A downy white growth was observed on the lower surface of infected leaves. The disease was widespread in affected greenhouses and incidence in cvs. Shimmer Coral, Accent Mix, and Super Elfin was nearly 90%. The downy growth consisted of coenocytic mycelia, monopodial sporangiophores, and ovoid, hyaline sporangia typical of Plasmopara obducens (J. Schröt.) J. Schröt in Cohn (1,2,4). Sporangia were borne on branchlets measuring 5 to 15 µm long (average 10 µm) at right angles to the main axis of the sporangiophore. Sporangia were 9.4 to 17.5 × 12.8 to 16.3 µm. No oospores were observed. Total DNA was extracted directly from plant tissue with the Wizard SV Genomic DNA Purification System (Promega, Madison, WI) following the manufacturer's instructions. Large ribosomal subunit DNA was amplified by PCR using primers NL-1 and NL-4 (3). Amplicons of 690 bp and 834 bp were produced from each diseased sample, while only the 690-bp amplicon was produced from healthy tissue. DNA from each amplicon of sample IDM041712 was purified using the Wizard SV Gel and PCR Clean-Up System (Promega), sequenced, and the sequence of the diagnostic 834-bp amplicon was deposited in GenBank (JX142134). The sequence of the 834-bp amplicon was 99% similar to those of P. obducens isolates from Serbia (HQ246451) (1), the UK (AY587558), and Austria (EF196869). The sequence of the 690-bp amplicon (JX142135) was 99% similar to that of I. walleriana (HQ223336). Twelve young impatiens 'Shimmer Coral' plants were inoculated with sporangia washed from infected leaves (1 × 104 sporangia/ml). Plants were incubated at room temperature for 24 h in a moist chamber and then maintained in a greenhouse (21 to 23°C) until symptoms appeared. Control plants were sprayed with sterile water and maintained in the same environment. After 12 to 14 days, typical symptoms of downy mildew developed on the inoculated plants and microscopic examination revealed the same pathogen morphology as the original isolate. All non-inoculated control plants remained disease free. To our knowledge, this is the first report of downy mildew on impatiens in Ohio. This disease caused considerable economic losses in Ohio in 2012 and is likely to be a recurring problem requiring intensive preventative management. References: (1) A. Bulajic et al. Plant Dis. 95:491, 2011. (2) O. Constantinescu. Mycologia 83:473, 1991. (3) W. Maier et al. Can. J. Bot. 81:12, 2003. (4) S. N. Wegulo et al. Plant Dis. 88:909, 2004.

Infection and systemic inflammation, not ammonia, are associated with Grade 3/4 hepatic encephalopathy, but not mortality in cirrhosis.

BACKGROUND & AIMS: Patients with cirrhosis are prone to infection which is a frequent precipitant of hepatic encephalopathy (HE). Clinical studies have examined the importance of inflammation and infection in modulating the manifestation of symptoms of HE in acute liver failure and patients with cirrhosis and minimal/low grade HE. It would be logical to presume that this relationship persists in patients who develop severe HE in cirrhosis although this has not been examined to date. METHODS: We report the findings of a prospective audit of 100 consecutive patients with cirrhosis admitted between Jan 2000 and March 2008 to a liver Intensive Care Unit (ICU) where HE was the primary indication for admission (59% Grade 3; 41% Grade 4). Haematological and microbiological data were collected at ICU admission, and organ scores and outcomes were recorded. RESULTS: 46% of patients had positive cultures taken within ± 48h from admission to ICU [25% blood] and a further 22% were culture negative but had evidence of systemic inflammation (SIRS). SIRS score (p=0.03) and SOFA score (p=0.006) were significantly higher in those patients with Grade 4 HE, who were also less likely to survive (p<0.001). HE grade/coma score did not correlate with ammonia, biochemistry or MELD score. Fifty-two percent of patients survived their ICU stay while the remainder developed progressive multiorgan failure and died; 38% survived to discharge, and 16% were transplanted. CONCLUSIONS: These data support an association between infection/SIRS and not ammonia, in patients with cirrhosis that develop severe HE. The presence or absence of infection/SIRS did not determine survival.

Carbogen breathing increases prostate cancer oxygenation: a translational MRI study in murine xenografts and humans.

Hypoxia has been associated with poor local tumour control and relapse in many cancer sites, including carcinoma of the prostate. This translational study tests whether breathing carbogen gas improves the oxygenation of human prostate carcinoma xenografts in mice and in human patients with prostate cancer. A total of 23 DU145 tumour-bearing mice, 17 PC3 tumour-bearing mice and 17 human patients with prostate cancer were investigated. Intrinsic susceptibility-weighted MRI was performed before and during a period of carbogen gas breathing. Quantitative R(2)* pixel maps were produced for each tumour and at each time point and changes in R(2)* induced by carbogen were determined. There was a mean reduction in R(2)* of 6.4% (P=0.003) for DU145 xenografts and 5.8% (P=0.007) for PC3 xenografts. In all, 14 human subjects were evaluable; 64% had reductions in tumour R(2)* during carbogen inhalation with a mean reduction of 21.6% (P=0.0005). Decreases in prostate tumour R(2)* in both animal models and human patients as a result of carbogen inhalation suggests the presence of significant hypoxia. The finding that carbogen gas breathing improves prostate tumour oxygenation provides a rationale for testing the radiosensitising effects of combining carbogen gas breathing with radiotherapy in prostate cancer patients.

Relationship between human tumour angiogenic profile and combretastatin-induced vascular shutdown: an exploratory study.

Combretastatin-A4-phosphate (CA4P) acts most effectively against immature tumour vasculature. We investigated whether histological angiogenic profile can explain the differential sensitivity of human tumours to CA4P, by correlating the kinetic changes demonstrated by dynamic MRI (DCE-MRI) in response to CA4P, with tumour immunohistochemical angiogenic markers. Tissue was received from 24 patients (mean age 59, range 32-73, 18 women, 6 men). An angiogenic profile was performed using standard immunohistochemical techniques. Dynamic MRI data were obtained for the same patients before and 4 h after CA4P. Three patients showed a statistically significant fall in K(trans) following CA4P, and one a statistically significant fall in IAUGC(60). No statistically significant correlations were seen between the continuous or categorical variables and the DCE-MRI kinetic parameters other than between ang-2 and K(trans) (P=0.044). In conclusion, we found no strong relationships between changes in DCE-MRI kinetic variables following CA4P and the immunohistochemical angiogenic profile.

Dynamic contrast-enhanced magnetic resonance imaging is a poor measure of rectal cancer angiogenesis.

BACKGROUND: The aim of this study was to investigate the use of magnetic resonance imaging (MRI) for non-invasive measurement of rectal cancer angiogenesis and hypoxia. METHODS: Fifteen patients with rectal adenocarcinoma underwent preoperative dynamic contrast-enhanced (DCE) and blood oxygenation level-dependent (BOLD) MRI. Microvessel density (CD31 level), and expression of vascular endothelial growth factor (VEGF) and carbonic anhydrase (CA) 9 were measured immunohistochemically in histological tumour sections from 12 patients. Serum VEGF levels were also measured in 14 patients. Correlations between quantitative imaging indices and immunohistochemical variables were examined. RESULTS: There was good correlation between circulating VEGF and CD31 expression (r(S) = 0.88, P < 0.001). CD31 expression did not correlate with any dynamic MRI parameter, except transfer constant, with which it correlated inversely (r(S) = -0.65, P = 0.022). Tissue and circulating VEGF levels did not correlate, and neither correlated with any tumour DCE MRI parameter. No relationship was seen between BOLD MRI and CA-9 expression. CONCLUSION: The negative correlation between transfer constant (reflecting tumour blood flow and microvessel permeability) with CD31 expression is paradoxical. DCE MRI methods for assessing tissue vascularity correlate poorly with histological markers of angiogenesis and hypoxia, suggesting that DCE MRI does not simply reflect static histological vascular properties in patients with rectal cancer.

Effects of platinum/taxane based chemotherapy on acute perfusion in human pelvic tumours measured by dynamic MRI.

Dynamic contrast enhanced MRI (DCE-MRI) is being used increasingly in clinical trials to demonstrate that vascular disruptive and antiangiogenic agents target tumour microcirculation. Significant reductions in DCE-MRI kinetic parameters are seen within 4-24 and 48 h of treatment with vascular disruptive and antiangiogenic agents, respectively. It is important to know whether cytotoxic agents also cause significant acute reductions in these parameters, for reliable interpretation of results. This study investigated changes in transfer constant (K(trans)) and the initial area under the gadolinium curve (IAUGC) following the first dose of chemotherapy in patients with mostly gynaecological tumours. A reproducibility analysis on 20 patients (using two scans performed on consecutive days) was used to determine the significance of DCE-MRI parameter changes 24 h after chemotherapy in 18 patients. In 11 patients who received platinum alone or with a taxane, there were no significant changes in K(trans) or IAUGC in either group or individual patient analyses. When the remaining seven patients (treated with a variety of agents including platinum and taxanes) were included (n=18), there were also no significant changes in K(trans). Therefore, if combination therapy does show changes in DCE-MRI parameters then the effects can be attributed to antivascular therapy rather than chemotherapy.

BOLD MRI of human tumor oxygenation during carbogen breathing.

An MRI method is described for demonstrating improved oxygenation of human tumors and normal tissues during carbogen inhalation (95% O2, 5% CO2). T2*-weighted gradient-echo imaging was performed before, during, and after carbogen breathing in 47 tumor patients and 13 male volunteers. Analysis of artifacts and signal intensity was performed. Thirty-six successful tumor examinations were obtained. Twenty showed significant whole-tumor signal increases (mean 21.0%, range 6.5-82.4%), and one decreased (-26.5 +/- 8.0%). Patterns of signal change were heterogeneous in responding tumors. Five of 13 normal prostate glands (four volunteers and nine patients with nonprostatic tumors) showed significant enhancement (mean 11.4%, range 8.4-14.0%). An increase in brain signal was seen in 11 of 13 assessable patients (mean 8.0 +/- 3.7%, range 5.0-11.7%). T2*-weighted tumor MRI during carbogen breathing is possible in humans. High failure rates occurred due to respiratory distress. Significant enhancement was seen in 56%, suggesting improved tissue oxygenation and blood flow, which could identify these patients as more likely to benefit from carbogen radiosensitization.

5,5'-Bridged bis(1,2,3-dithiazoles): spin states and charge-transfer chemistry.

Bifunctional 1,2,3-dithiazoles bridged with azine and phenylenediamine spacers have been prepared, with a view to determining the extent of communication between the two dithiazole rings as a function of the electronic and steric demands of the bridge. The crystal structure of the closed-shell diazine derivative [S(2)NClC(2)=NN=C(2)ClNS(2)] is rigorously planar. Cyclic voltammetry on this compound indicates two reversible one-electron oxidations. The radical cation state has been characterized by EPR spectroscopy and by crystal structure determination of its 1:1 PF(6)(-) salt. The latter reveals little interaction between neighboring radical cations; consistently, the material exhibits a conductivity of sigma < 10(-5) S cm(-1). Insertion of a phenylene group into the diazine bridge to afford [S(2)NClC(2)=NC(6)H(4)N=C(2)ClNS(2)] leads to significant torsional motion between the phenylene ring and the two end groups, as a result of which the two DTA rings are electronically independent; no radical cation state has been observed for this species. Crystal data for Cl(2)S(4)N(4)C(4): a = 5.1469(15), b = 13.343(2), c = 14.2031(17), orthorhombic, Pbca, Z = 4. Crystal data for Cl(2)S(4)N(4)C(4)PF(6): a = 11.699(4), b = 12.753(5), c = 10.461(4), beta = 112.17(1) degrees, monoclinic, C2/c, Z = 4. Crystal data for C(l2)S(4)N(4)C(10)H(4): a = 3.9477(6), b = 23.790(3), c = 7.3769(9), beta =90.793(12) degrees, monoclinic, P2(1)/c, Z = 2.

Gas exchange parameters in radiotherapy patients during breathing of 2%, 3.5% and 5% carbogen gas mixtures.

The gas mixture carbogen may be breathed by patients to enhance the oxygenation level and therefore the radiosensitivity of tumours. However, owing to the high CO2 content, its inhalation is associated with patient intolerance. Our aim was to determine a suitable carbon dioxide and oxygen gas mixture with similar enhancement of arterial oxygenation to 5% carbogen and with improved patient tolerance. 14 patients entered the study; of those 14, 8 were able to tolerate 2%, 3.5% and 5% carbogen mixtures as well as a control gas for sufficient time to allow successful arterial blood gas sampling. Gas exchange parameters were measured using a carbon dioxide monitor and a blood gas analyser. Arterial carbon dioxide tension ranged from 2.9 kPa to 6.82 kPa whilst breathing the carbogen mixtures, and arterial oxygen tension increased at least three-fold from basal values. There were no significant changes in the respiratory rate, heart rate and blood pH. The results suggest that 2% CO2 in O2 enhances arterial oxygen levels to a similar extent as 3.5% and 5% CO2 and that it is well tolerated.