Genera of phytopathogenic fungi: GOPHY 4.

This paper is the fourth contribution in the Genera of Phytopathogenic Fungi (GOPHY) series. The series provides morphological descriptions and information about the pathology, distribution, hosts and disease symptoms, as well as DNA barcodes for the taxa covered. Moreover, 12 whole-genome sequences for the type or new species in the treated genera are provided. The fourth paper in the GOPHY series covers 19 genera of phytopathogenic fungi and their relatives, including Ascochyta, Cadophora, Celoporthe, Cercospora, Coleophoma, Cytospora, Dendrostoma, Didymella, Endothia, Heterophaeomoniella, Leptosphaerulina, Melampsora, Nigrospora, Pezicula, Phaeomoniella, Pseudocercospora, Pteridopassalora, Zymoseptoria, and one genus of oomycetes, Phytophthora. This study includes two new genera, 30 new species, five new combinations, and 43 typifications of older names. Taxonomic novelties: New genera: Heterophaeomoniella L. Mostert, C.F.J. Spies, Halleen & Gramaje, Pteridopassalora C. Nakash. & Crous; New species: Ascochyta flava Qian Chen & L. Cai, Cadophora domestica L. Mostert, R. van der Merwe, Halleen & Gramaje, Cadophora rotunda L. Mostert, R. van der Merwe, Halleen & Gramaje, Cadophora vinacea J.R. Úrbez-Torres, D.T. O'Gorman & Gramaje, Cadophora vivarii L. Mostert, Havenga, Halleen & Gramaje, Celoporthe foliorum H. Suzuki, Marinc. & M.J. Wingf., Cercospora alyssopsidis M. Bakhshi, Zare & Crous, Dendrostoma elaeocarpi C.M. Tian & Q. Yang, Didymella chlamydospora Qian Chen & L. Cai, Didymella gei Qian Chen & L. Cai, Didymella ligulariae Qian Chen & L. Cai, Didymella qilianensis Qian Chen & L. Cai, Didymella uniseptata Qian Chen & L. Cai, Endothia cerciana W. Wang. & S.F. Chen, Leptosphaerulina miscanthi Qian Chen & L. Cai, Nigrospora covidalis M. Raza, Qian Chen & L. Cai, Nigrospora globospora M. Raza, Qian Chen & L. Cai, Nigrospora philosophiae-doctoris M. Raza, Qian Chen & L. Cai, Phytophthora transitoria I. Milenkovic, T. Májek & T. Jung, Phytophthora panamensis T. Jung, Y. Balci, K. Broders & I. Milenkovic, Phytophthora variabilis T. Jung, M. Horta Jung & I. Milenkovic, Pseudocercospora delonicicola C. Nakash., L. Suhaizan & I. Nurul Faziha, Pseudocercospora farfugii C. Nakash., I. Araki, & Ai Ito, Pseudocercospora hardenbergiae Crous & C. Nakash., Pseudocercospora kenyirana C. Nakash., L. Suhaizan & I. Nurul Faziha, Pseudocercospora perrottetiae Crous, C. Nakash. & C.Y. Chen, Pseudocercospora platyceriicola C. Nakash., Y. Hatt, L. Suhaizan & I. Nurul Faziha, Pseudocercospora stemonicola C. Nakash., Y. Hatt., L. Suhaizan & I. Nurul Faziha, Pseudocercospora terengganuensis C. Nakash., Y. Hatt., L. Suhaizan & I. Nurul Faziha, Pseudocercospora xenopunicae Crous & C. Nakash.; New combinations: Heterophaeomoniella pinifoliorum (Hyang B. Lee et al.) L. Mostert, C.F.J. Spies, Halleen & Gramaje, Pseudocercospora pruni-grayanae (Sawada) C. Nakash. & Motohashi., Pseudocercospora togashiana (K. Ito & Tak. Kobay.) C. Nakash. & Tak. Kobay., Pteridopassalora nephrolepidicola (Crous & R.G. Shivas) C. Nakash. & Crous, Pteridopassalora lygodii (Goh & W.H. Hsieh) C. Nakash. & Crous; Typification: Epitypification: Botrytis infestans Mont., Cercospora abeliae Katsuki, Cercospora ceratoniae Pat. & Trab., Cercospora cladrastidis Jacz., Cercospora cryptomeriicola Sawada, Cercospora dalbergiae S.H. Sun, Cercospora ebulicola W. Yamam., Cercospora formosana W. Yamam., Cercospora fukuii W. Yamam., Cercospora glochidionis Sawada, Cercospora ixorana J.M. Yen & Lim, Cercospora liquidambaricola J.M. Yen, Cercospora pancratii Ellis & Everh., Cercospora pini-densiflorae Hori & Nambu, Cercospora profusa Syd. & P. Syd., Cercospora pyracanthae Katsuki, Cercospora horiana Togashi & Katsuki, Cercospora tabernaemontanae Syd. & P. Syd., Cercospora trinidadensis F. Stevens & Solheim, Melampsora laricis-urbanianae Tak. Matsumoto, Melampsora salicis-cupularis Wang, Phaeoisariopsis pruni-grayanae Sawada, Pseudocercospora angiopteridis Goh & W.H. Hsieh, Pseudocercospora basitruncata Crous, Pseudocercospora boehmeriigena U. Braun, Pseudocercospora coprosmae U. Braun & C.F. Hill, Pseudocercospora cratevicola C. Nakash. & U. Braun, Pseudocercospora cymbidiicola U. Braun & C.F. Hill, Pseudocercospora dodonaeae Boesew., Pseudocercospora euphorbiacearum U. Braun, Pseudocercospora lygodii Goh & W.H. Hsieh, Pseudocercospora metrosideri U. Braun, Pseudocercospora paraexosporioides C. Nakash. & U. Braun, Pseudocercospora symploci Katsuki & Tak. Kobay. ex U. Braun & Crous, Septogloeum punctatum Wakef.; Neotypification: Cercospora aleuritis I. Miyake; Lectotypification: Cercospora dalbergiae S.H. Sun, Cercospora formosana W. Yamam., Cercospora fukuii W. Yamam., Cercospora glochidionis Sawada, Cercospora profusa Syd. & P. Syd., Melampsora laricis-urbanianae Tak. Matsumoto, Phaeoisariopsis pruni-grayanae Sawada, Pseudocercospora symploci Katsuki & Tak. Kobay. ex U. Braun & Crous. Citation: Chen Q, Bakhshi M, Balci Y, Broders KD, Cheewangkoon R, Chen SF, Fan XL, Gramaje D, Halleen F, Horta Jung M, Jiang N, Jung T, Májek T, Marincowitz S, Milenkovic T, Mostert L, Nakashima C, Nurul Faziha I, Pan M, Raza M, Scanu B, Spies CFJ, Suhaizan L, Suzuki H, Tian CM, Tomsovský M, Úrbez-Torres JR, Wang W, Wingfield BD, Wingfield MJ, Yang Q, Yang X, Zare R, Zhao P, Groenewald JZ, Cai L, Crous PW (2022). Genera of phytopathogenic fungi: GOPHY 4. Studies in Mycology 101: 417-564. doi: 10.3114/sim.2022.101.06.

Diversity of Sporocadaceae (pestalotioid fungi) from Rosa in China.

Rosa (Rosaceae) is an important ornamental and medicinal plant genus worldwide, with several species being cultivated in China. Members of Sporocadaceae (pestalotioid fungi) are globally distributed and include endophytes, saprobes but also plant pathogens, infecting a broad range of host plants on which they can cause important plant diseases. Although several Sporocadaceae species were recorded to inhabit Rosa spp., the taxa occurring on Rosa remain largely unresolved. In this study, a total of 295 diseased samples were collected from branches, fruits, leaves and spines of eight Rosa species (R. chinensis, R. helenae, R. laevigata, R. multiflora, R. omeiensis, R. rugosa, R. spinosissima and R. xanthina) in Gansu, Henan, Hunan, Qinghai, Shaanxi Provinces and the Ningxia Autonomous Region of China. Subsequently 126 strains were obtained and identified based on comparisons of DNA sequence data. Based on these results 15 species residing in six genera of Sporocadaceae were delineated, including four known species (Pestalotiopsis chamaeropis, Pes. rhodomyrtus, Sporocadus sorbi and Spo. trimorphus) and 11 new species described here as Monochaetia rosarum, Neopestalotiopsis concentrica, N. subepidermalis, Pestalotiopsis tumida, Seimatosporium centrale, Seim. gracile, Seim. nonappendiculatum, Seim. parvum, Seiridium rosae, Sporocadus brevis, and Spo. spiniger. This study also represents the first report of Pes. chamaeropis, Pes. rhodomyrtus and Spo. sorbi on Rosa. The overall data revealed that Pestalotiopsis was the most prevalent genus, followed by Seimatosporium, while Pes. chamaeropis and Pes. rhodomyrtus were the two most prevalent species. Analysis of Sporocadaceae abundance on Rosa species and plant organs revealed that spines of R. chinensis had the highest species diversity. Citation: Peng C, Crous PW, Jiang N, et al. 2022. Diversity of Sporocadaceae (pestalotioid fungi) from Rosa in China. Persoonia 49: 201-260. https://doi.org/10.3767/persoonia.2022.49.07.

Cytospora (Diaporthales) in China.

Members of the genus Cytospora are often reported as endophytes, saprobes or phytopathogens, primarily causing canker diseases of woody host plants. They occur on a wide range of hosts and have a worldwide distribution. Although several species have in the past been reported from China, the vast majority are not known from culture or DNA phylogeny. The primary aim of the present study was thus to clarify the taxonomy and phylogeny of a large collection of Cytospora species associated with diverse hosts in China. Cytospora spp. were collected in northeast, northwest, north and southwest China, indicating that the cold and dry environments favour these fungi. In this paper, we provide an assessment of 52 Cytospora spp. in China, focussing on 40 species represented by 88 isolates from 28 host genera. Based on a combination of morphology and a six-locus phylogeny (ITS, LSU, act1, rpb2, tef1-α and tub2), 13 new species and one new combination are introduced. The majority of the species investigated here appear to be host-specific, although further collections and pathogenicity studies will be required to confirm this conclusion.

Families and genera of diaporthalean fungi associated with canker and dieback of tree hosts.

In this study we accept 25 families in Diaporthales based on phylogenetic analyses using partial ITS, LSU, rpb2 and tef1-α gene sequences. Four different families associated with canker and dieback of tree hosts are morphologically treated and phylogenetically compared. These include three new families (Diaporthostomataceae, Pseudomelanconidaceae, Synnemasporellaceae), and one new genus, Dendrostoma (Erythrogloeaceae). Dendrostoma is newly described from Malus spectabilis, Osmanthus fragrans and Quercus acutissima having fusoid to cylindrical, bicellular ascospores, with three new species namely D. mali, D. osmanthi and D. quercinum. Diaporthostomataceae is characterised by conical and discrete perithecia with bicellular, fusoid ascospores on branches of Machilus leptophylla. Pseudomelanconidaceae is defined by conidiogenous cells with apical collarets and discreet annellations, and the inconspicuous hyaline conidial sheath when mature on Carya cathayensis, compared to morphologically similar families Melanconidaceae and Juglanconidaceae. Synnemasporellaceae is proposed to accommodate fungi with synnematous conidiomata, with descriptions of S. toxicodendri on Toxicodendron sylvestre and S. aculeans on Rhus copallina.

Arthrinium species associated with bamboo and reed plants in China.

Arthrinium species are presently recognised based on a combination of morphological characteristics and internal transcribed spacer (ITS) sequence data. In the present study fresh Arthrinium specimens from bamboo and reed plants were collected in China. Morphological comparison and phylogenetic analyses were subsequently performed for species identification. From the results obtained two new species, Arthrinium gaoyouense and A. qinlingense are proposed, and three known species, Arthrinium arundinis, A. paraphaeospermum and A. yunnanum are identified based on morphological characteristics from the host and published DNA sequence data.

Phylogeny and taxonomy of the scab and spot anthracnose fungus Elsinoë (Myriangiales, Dothideomycetes).

Species of Elsinoë are phytopathogens causing scab and spot anthracnose on many plants, including some economically important crops such as avocado, citrus, grapevines, and ornamentals such as poinsettias, field crops and woody hosts. Disease symptoms are often easily recognisable, and referred to as signature-bearing diseases, for the cork-like appearance of older infected tissues with scab-like appearance. In some Elsinoë-host associations the resulting symptoms are better described as spot anthracnose. Additionally the infected plants may also show mild to severe distortions of infected organs. Isolation of Elsinoë in pure culture can be very challenging and examination of specimens collected in the field is often frustrating because of the lack of fertile structures. Current criteria for species recognition and host specificity in Elsinoë are unclear due to overlapping morphological characteristics, and the lack of molecular and pathogenicity data. In the present study we revised the taxonomy of Elsinoë based on DNA sequence and morphological data derived from 119 isolates, representing 67 host genera from 17 countries, including 64 ex-type cultures. Combined analyses of ITS, LSU, rpb2 and TEF1-α DNA sequence data were used to reconstruct the backbone phylogeny of the genus Elsinoë. Based on the single nomenclature for fungi, 26 new combinations are proposed in Elsinoë for species that were originally described in Sphaceloma. A total of 13 species are epitypified with notes on their taxonomy and phylogeny. A further eight new species are introduced, leading to a total of 75 Elsinoë species supported by molecular data in the present study. For the most part species of Elsinoë appear to be host specific, although the majority of the species treated are known only from a few isolates, and further collections and pathogenicity studies will be required to reconfirm this conclusion.

CLINICAL DIAGNOSIS OF CAROTID ATHEROSCLEROSTIC PLAQUE IN HYPERTENSIVE PATIENTS WITH HIGH RESOLUTION MAGNETIC RESONANCE ANGIOGRAPHY.

As the incidence of ischemic cerebrovascular disease increases continuously over the years, carotid atherosclerosis as an important dangerous factor has drawn a lot of attention from many experts and scholars. To explore the clinical significance of high resolution magnetic resonance angiography (MRA) in carotid atherosclerosis and ischemic cerebrovascular disease, a group contrasting method was adopted. One hundred patients with ischemic cerebrovascular disease and 100 patients without ischemic cerebrovascular disease were taken as observation group and control group, respectively. High resolution MRA was used for examining and observing the development of carotid atherosclerostic plaque in patients in the two groups. We found that the proportion of carotid atherosclerostic plaque in the experimental group and control group had statistical difference (P<0.05); and the proportion of carotid atherosclerostic plaque in patients over 60 years of age was higher than in patients under 60 years, and the difference was statistically significant (P<0.05). The proportion of carotid atherosclerostic plaque in patients with high blood pressure was also higher than in patients without high blood pressure, and the difference was statistically significant (P<0.05). Moreover, the proportion of carotid atherosclerostic plaque in patients with hyperlipidemia was higher than in patients without hyperlipidemia, and the differences were statistically significant (P<0.05). We can therefrore draw a conclusion that the development of carotid atherosclerostic plaque affects the occurrence of ischemic cerebrovascular disease, which is related to patient’s age, level of blood pressure and blood lipids. In addition, high resolution MRA is helpful to early discovery of the formation of carotid atherosclerostic plaque.

First Report of Pitch Canker Disease Caused by Rhizosphaera kalkhoffii on Pinus sylvestris in China.

In November 2010, pitch canker disease was first discovered on Pinus sylvestris var. mongolica Litv. from Daxinganling region in Inner Mongolia Province, China, resulting in severe dieback and bark cracking on the host, accompanied by resin flowing profusely from cankers on the infected branches, cones, and trunks (2). The early stage symptoms consisted of sunken cankers, reddish-brown needles on infected twigs followed by heavy resin soaking of the wood as the disease progressed. Pieces of pitch-soaked wood (3 × 3 mm2) cut from cankerous tissue on branches were surface-sterilized with 0.4% NaOCl for 2 min and then rinsed twice in sterile distilled water. The fragments were placed on potato dextrose agar and incubated at 28°C in the dark. After 7 to 8 days, this process consistently yielded cultures with whitish, dense, aerial mycelium that later darkened to gray. Microconidia were single, oblong to cylindrical, aseptate, and 4 to 10 × 2 to 4 µm. Macroconidia were hyaline, 1- to 2-septate, oblong to cylindrical, with tiny papillae at both ends, and 10 to 13 × 2 to 5 µm, fitting the description of Rhizosphaera kalkhoffii (1). To verify the identification based on morphological features, the internal transcribed spacer (ITS) region of the ribosomal RNA genes was amplified using primers ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) according to the published protocol (3), and then sequenced and compared to the GenBank database through BLAST search. Comparison of the sequences revealed 98% homology to R. kalkhoffii (EU700375.1 and EU700376.1). Representative sequences of R. kalkhoffii (JQ353721 and JQ353722) were deposited in GenBank. The pathogenicity of two representative isolates of R. kalkhoffii was also confirmed by spraying 40 µl of conidial suspension (4.6 × 106 conidia/ml) on the bark surface of 20 2-year-old healthy pine seedlings, wounded by scratching with a sterilized knife. Sterile distilled water sprays were used for the controls. Within 4 to 8 weeks after inoculation, 90% of inoculated P. sylvestris exhibited symptoms of pitch cankers around the inoculation site similar to those on the original infection. R. kalkhoffii was consistently reisolated from all inoculated plants but not from water-treated controls, fulfilling Koch's postulates. R. kalkhoffii have previously been documented as pathogens of needle blight of Picea pungens (1). To our knowledge, this is the first report of R. kalkhoffii as a pathogen on Pinus sylvestris in China, and furthermore, pitch canker disease is currently listed as a quarantine disease in China, increasing the significance of this report. References: (1) J. Kumi et al. Eur. J. Forest Pathol. 9:35, 1979. (2) J. K. Lee et al. Plant Pathol. 16:52, 2000. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.