Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 4 de 4
Filtrar
Mais filtros











Base de dados
Intervalo de ano de publicação
1.
Plant Dis ; 96(5): 771, 2012 May.
Artigo em Inglês | MEDLINE | ID: mdl-30727565

RESUMO

In August 2009, yellowing, upward curling of leaves, and stunted growth were observed on 15 to 40% of dry bean (Phaseolus vulgaris cv. Aluvori) plants in each of several experimental fields in Zacatecas, Mexico. Symptoms and presence of the beet leafhopper (Circulifer tenellus) in affected fields suggested an infection by curtoviruses (Geminiviridae). Total DNA extracts from 18 plant samples exhibiting symptoms were obtained by a modified Dellaporta method (2) and subjected to PCR analysis using two pairs of new, degenerate primers specific for curtoviruses: RepQEW-for (CCRAARTAAGMATCRGCCCAYTCTTG) in combination with CP450-rev (GTCCTCGAGTAGACGGCATAGCCTGACC) and V2Gen910-for (ATGTCGACGAAGCATTTGAAGTTTGATATGGC) with Rep2GQ-rev (GAAGATCTGCWCGMGGAGGYCARCAGACGGCT). This double set of primers was used to amplify two overlapping DNA segments encompassing the complete curtovirus genome. All samples produced amplicons of the expected size (1.75 and 1.8 kb, respectively) that were cloned into pGEM-T Easy Vector (Promega, Madison, WI). Restriction fragment length polymorphism analysis of PCR clones with EcoRI and HinfI endonucleases suggested the presence of a single curtovirus species because only one restriction fragment pattern was observed in all cases. Viral amplicons from three plants were sequenced, and the overlapping DNA fragments were subsequently assembled into a complete genome sequence. Comparison of the virus sequence (Accession No. HQ634913) with sequences of all curtovirus isolates available in GenBank showed that it shared the highest nucleotide identity (98%) with Beet mild curly top virus-Mexico SLP1 from pepper (BMCTV-MX [SLP1]; Accession No. EU586260). Amino acid sequence identity of the seven predicted proteins (Rep, TrAP, REn, C4, V1, V2, and V3) encoded by the virus isolated from bean plants shared 98.0, 97.3, 98.5, 98.8, 100, 99.2, and 97.8% sequence identity, respectively, with the homologous proteins of BMCTV-MX [SLP1]. A BMCTV isolate from pepper collected in Zacatecas in 2007 (Accession No. EU586260) with 96% nucleotide sequence identity to the curtovirus identified in bean induced symptoms in P. vulgaris cv. Topcrop similar to those observed in bean in Zacatecas (1). To determine the presence of curtoviruses in the local populations of insect vectors, beet leafhoppers were collected in one of the sampled dry bean fields and total DNA was isolated from a pool of approximately 20 insects. Amplification of viral DNA with the degenerate primers RepQEW-for and CP450-rev and further sequencing of the PCR products confirmed the presence of a curtovirus DNA sharing almost identical nucleotide identity (99%) with the DNA isolated from bean plants. In 2011, symptoms similar to those observed in bean in 2009 occurred in approximately 30% of dry bean plants, suggesting that BMCTV is endemic in the Zacatecas Region. To our knowledge, this is the first report of BMCTV in legumes in Mexico. References: (1) L. F. Chen et al. Arch. Virol. 156:547, 2011. (2) S. L. Dellaporta et al. Plant Mol. Biol. Rep. 1:19, 1983.

2.
Q J Nucl Med Mol Imaging ; 55(6): 603-19, 2011 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-22231581

RESUMO

The present review is aimed at updating the reader with the current role of computed tomography (CT) and magnetic resonance imaging (MRI) in the evaluation of tumor response, contextualizing the imaging methods advantages and limitations. CT has been the most frequent and widely adopted diagnostic tool. The main advantages of such method include wide availability, high reproducibility, capability to contemporarily evaluate soft tissues, bone and lung parenchyma, besides being easy to perform. Its main limitation is related to the use of ionizing radiation. MRI has emerged as a feasible alternative to CT, particularly in patients with contraindications to the use of iodinated contrast agents, with advantages related to its high soft tissues contrast. The disadvantages are based on its operational complexity and the many technical variables involved which may influence and compromise the reproducibility and broad implementation of the method. New criteria for evaluation of tumor response have recently been proposed, contemplating lately developed drugs and therapeutic strategies that demand the utilization of functional parameters. In this context, the technological developments incorporated in the CT and MRI imaging techniques, such as perfusion analysis, diffusion studies (DW-RM) and MR spectroscopy (MRS), among others, have provided relevant information regarding the tumor response to targeted therapies, anticipating dimensional alterations and guiding physicians in the course of the treatment. Despite such developments, further efforts are needed to establish reproducible protocols, functional response criteria and time intervals for response evaluation in order to allow a definitive incorporation of these new technologies in the assessment of tumor response.


Assuntos
Imageamento por Ressonância Magnética/tendências , Imagem Molecular/tendências , Neoplasias/diagnóstico , Neoplasias/terapia , Avaliação de Resultados em Cuidados de Saúde/tendências , Técnica de Subtração/tendências , Tomografia Computadorizada por Raios X/tendências , Humanos , Espectroscopia de Ressonância Magnética/métodos , Resultado do Tratamento
3.
Rev Hosp Clin Fac Med Sao Paulo ; 52(6): 302-5, 1997.
Artigo em Português | MEDLINE | ID: mdl-9629739

RESUMO

We report a study of 6 patients with simple hepatic cyst. All were underwent laparoscopic surgical treatment. The median age of patients was 66 years, 5 women and 1 man were in the series. Cyst diameters varied from 3 to 15 cm. The treatment of choice is laparoscopic fenestration and resection of external part. There were no complications in postoperative period and the follow-up results are encouraging.


Assuntos
Cistos/cirurgia , Laparoscopia/métodos , Hepatopatias/cirurgia , Gravação em Vídeo , Idoso , Cistos/diagnóstico por imagem , Feminino , Humanos , Hepatopatias/diagnóstico por imagem , Masculino , Pessoa de Meia-Idade , Radiografia
4.
Food Addit Contam ; 12(3): 383-6, 1995.
Artigo em Inglês | MEDLINE | ID: mdl-7664932

RESUMO

In this study kerneled corn sold and distributed through wholesale outlets in the city of Monterrey, Mexico was analysed. The extraction of aflatoxins was performed with a mixture of methanol/water (80:20) and its derivatization was carried out with trifluoroacetic acid. The analysis was done by high performance liquid chromatography (HPLC) using fluorescence for detection. From the 41 samples analysed, aflatoxins B1 and G1, were found to be present. Aflatoxin B1 concentrations ranged from 5.03 ng/g to 465.31 ng/g, aflatoxin G1 concentrations ranged from 1.59 ng/g to 57.1 ng/g. It was found that 87.8% of the samples were contaminated with aflatoxins: in addition, 58.5% contained levels above Mexican legal limits which are, at present, 20 ng/g.


Assuntos
Aflatoxinas/análise , Contaminação de Alimentos/análise , Zea mays/química , México
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA