Minimally invasive right colectomy with transrectal natural orifice extraction: could this be the next step forward?

BACKGROUND: The transvaginal natural orifice specimen extraction (NOSE) approach for right-side colon surgery has been proven to exhibit favorable short-term outcomes. However, thus far, no study has reported the advantages of transrectal NOSE for right-side colon surgery. The aim of this study was to compare the technical feasibility, safety, and short-term outcomes of minimally invasive right hemicolectomy using the transrectal NOSE method and those of conventional mini-laparotomy specimen extraction. METHODS: A study was conducted on consecutive patients who had minimally invasive right hemicolectomy either for malignancy or benign disease at Chang Gung Memorial Hospital, Linkou, Taiwan, between January 2017 and December 2018. The patients were divided into two groups: conventional surgery with specimen extraction using mini-laparotomy and NOSE surgery. Surgical outcomes, including complications, postoperative short-term recovery, and pain intensity, were analyzed. RESULTS: We enrolled 297 patients (151 males, mean age 64.9 ± 12.8 years) who had minimally invasive right hemicolectomy. Of these 297 patients, 272 patients had conventional surgery with specimen extraction through mini-laparotomy and 25 patients had NOSE surgery (23 transrectal, 2 transvaginal). The diagnosis of colon disease did not differ significantly between the conventional and NOSE groups. Postoperative morbidity and mortality rates were comparable. The postoperative hospital stay was significantly (p = 0.004) shorter in the NOSE group (median 5 days, range 3-17 days) than in the conventional group (median 7 days, range 3-45 days). Postoperative pain was significantly (p = 0.026 on postoperative day 1 and p = 0.002 on postoperative day 2) greater in the conventional group than in the NOSE group. CONCLUSIONS: NOSE was associated with acceptable short-term surgical outcomes that were comparable to those of conventional surgery. NOSE results in less postoperative wound pain and a shorter hospital stay than conventional surgery. Larger studies are needed.

Molecular diversity of poleroviruses infecting cucurbit crops in four countries reveals the presence of members of six distinct species.

When 66 cucurbit samples with yellowing symptoms from fields in Mali, the Philippines, Thailand and Uzbekistan were screened by RT-PCR using universal polerovirus primers, 21 were identified as harboring polerovirus RNA. When these 21 samples were screened with specific primers for the known cucurbit-infecting poleroviruses, suakwa aphid-borne yellows virus and a recombinant strain of cucurbit aphid-borne yellows virus were detected for the first time in the Philippines and Thailand. However, seven polerovirus-positive samples did not react with any of the known species-specific primers. Sequencing of 1.4-kb universal polerovirus RT-PCR products revealed the presence of two poleroviruses that had not been described previously. These viruses, from Mali and Thailand, were provisionally named pepo aphid-borne yellows virus and luffa aphid-borne yellows virus, respectively.

First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (Blechum pyramidatum).

Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)-two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)-and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

First Report of Bhendi yellow vein mosaic virus Associated with Yellow Vein Mosaic of Okra (Abelmoschus esculentus) in Thailand.

A disease of okra (Abelmoschus esculentus) causing yellowing veins and mosaic on leaves and fruit has emerged in Thailand. Incidences of 50 to 100% diseased plants were observed in fields in Kanchanaburi and Nakhon Pathom provinces in 2009 and 2010, respectively. Leaf samples were collected from three and four diseased plants in Kanchanaburi and Nakhon Pathom, respectively. All seven samples tested positive for begomovirus by PCR using universal primer pair PAL1v1978B/PAR1c715H (3). One sample from Kanchanaburi also tested positive by ELISA using Okra mosaic virus (Genus Tymovirus) antiserum (DSMZ, Braunschweig, Germany). When the nucleotide sequences of the 1.5 kb begomovirus PCR products were compared they were found to share 99.1 to 99.5% identity with each other, and 97.5 to 97.7% identity to Bhendi yellow vein mosaic virus Okra isolate from India (GenBank Accession No. GU112057; BYVMV-[IN: Kai:OY: 06]). The complete DNA-A sequence for a Kanchanaburi isolate (JX678967) was obtained using abutting primers WTHOK6FL-V/-C (WTHOK6FL-V: 5'-GCGAAGCTTAGATAACGCTCCTT-3'; WTHOK6FL-C: 5'-TCCAAGCTTTGAGTCTGCAACGT-3'), while that of a Nakhon Pathom isolate (JX678966) was obtained with primers WTHOK6FLV/WTHOK2FL-C (WTHOK2FL-C: 5'-TCCAAGCTTTGAGTCTGCATCGT-3'). The DNA-A sequences of both isolates are 2,740 nucleotides in length and share 99.6% identity. Each has the geminivirus conserved sequence (TAATATTAC), two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). Based on BLASTn searching GenBank and sequence analysis using MegAlign (DNASTAR), both DNA-A sequences have greatest nucleotide identity (96.2 to 96.4%) with BYVMV-[IN: Kai:OY: 06] from India. Also, BYVMV-associated betasatellite DNA (1.4 kb) was detected in all begomovirus-positive samples, except one sample from Nakhon Pathom (1). However, no virus DNA-B was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (2). Okra infected with BYVMV has been reported in South Asia in Bangladesh, India, and Pakistan. To the best of our knowledge, this is the first report of BYVMV associated with Okra Yellow Vein Mosaic Disease in Southeast Asia. Since fruits with symptoms are regarded as low quality and have little market value, even low incidence of the disease is likely to cause significant reductions in marketable yield. Strategies for managing BYVMV in okra in South and Southeast Asia should be sought, including the breeding and selecting of resistant varieties. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

First Report of Squash leaf curl Philippines virus Infecting Chayote (Sechium edule) in Taiwan.

Young shoots and leaves of chayote (Sechium edule (Jacq.) Sw.) are commonly consumed as a vegetable in Taiwan. In Hualien County, the major chayote-production area of Taiwan, as much as 15% of chayote plants were not marketable between September and October 2010 because of mosaic symptoms on the leaves. Three symptomatic leaves were collected from each of three fields in Hualien. All nine samples tested positive for a begomovirus by PCR using general primer pair PAL1v1978B/PAR1c715H (3) and negative for Zucchini yellow mosaic virus, Cucumber mosaic virus, Cucumber green mottle mosaic virus, Melon yellow spot virus, Papaya ringspot virus - type W, Watermelon mosaic virus, and Watermelon silver mottle virus by ELISA (2). On the basis of the high nucleotide sequence identity (97.7 to 99.6%) of the 1.5-kb begomoviral DNA-A fragments, all nine samples were considered infected by the same begomovirus species. The 1.5-kb sequences had greatest nucleotide sequence identity (96.6 to 97.8%) with Squash leaf curl Philippines virus (SLCPHV) pumpkin isolate from Taiwan (1) (GenBank Accession No. DQ866135; SLCPHV-TW[TW:Pum:05]). One sample was selected to complete viral genomic DNA analysis. Abutting primer pairs PKA-V/C (PKA-V: 5'-AACGGATCCACTTATGCACGATTTCCCT-3'; PKA-C: 5'-TAAGGATCCCACATGTTGTGGAGCA-3') and PKB-V/C (PKB-V: 5'-TGTCCATGGATTGATGCGTTATCGGA-3'; PKB-C: 5'-TGACCATGGCATTTCCGAGATCTCCCA-3'') were used to amplify the complete DNA-A and DNA-B, respectively. The sequences of DNA-A (GenBank Accession No. JF146795) and DNA-B (GenBank Accession No. JF146796) contain 2,734 and 2,715 nucleotides, respectively. The geminivirus conserved sequence TAATATTAC was found in both DNA-A and -B. The DNA-A has two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). The DNA-B also had one ORF each in the virus sense (BV1) and the complementary sense (BC1). When compared by BLASTn in GenBank and analyzed by MEGALIGN software (DNASTAR, Madison, WI), they were found to have greatest nucleotide identity (98.0 to 99.0% of DNA-A and 96.7% of DNA-B) with SLCPHV isolates from Taiwan. In addition, SLCPHV caused similar symptoms on leaves when transmitted to healthy chayote by viruliferous whitefly. In Taiwan, SLCPHV has been detected and sequenced from naturally infected melon (GenBank Accession No. EU479710), pumpkin (GenBank Accession No. DQ866135), and wax gourd (GenBank Accession No. EU310406). To our knowledge, this is the first report of SLCPHV infecting chayote plants in Taiwan. The prevalence of SLCPHV infection on different cucurbit crops should be taken into consideration for managing viral diseases in Taiwan. References: (1) W. S. Tsai et al. Plant Dis. 91:907, 2007. (2) W. S. Tsai et al. Plant Dis. 94:923, 2010. (3) W. S. Tsai et al. Online publication. doi: 10.1111/j.1365-3059.2011.02424.x. Plant Pathol., 2011.

First Report of Zucchini yellow mosaic virus Associated with Leaf Crinkle and Yellow Mosaic Diseases of Cucurbit Plants in Mali.

The aphid-transmitted Zucchini yellow mosaic virus (ZYMV; genus Potyvirus, family Potyviridae) has been reported to cause severe epidemics and yield losses in cucurbit crops worldwide (1). In Africa, ZYMV has been detected in Algeria, Egypt, Madagascar, Mauritius, Mayotte, Morocco, Nigeria, Reunion, South Africa, Sudan, Swaziland, and Tunisia (1). In April 2009, leaf yellowing, mosaic, crinkling, and curling were common on cucurbit plants in fields in Mali. Symptomatic leaf samples were collected from five cucumber (Cucumis sativus) plants in Kati, two watermelon (Citrullus lanatus) plants in Samanko, and one weedy melon (Cucumis sp.) plant in Baguineda. All samples tested positive for ZYMV and were negative for Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV), Papaya ringspot virus type W (PRSV-W), Watermelon mosaic virus (WMV), and Watermelon silver mottle virus (WSMoV) by double-antibody sandwich (DAS)-ELISA. They also tested negative for Melon yellow spot virus (MYSV) by indirect ELISA. Antibodies against ZYMV and WMV were obtained from DSMZ, Braunschweig, Germany, and those against CGMMV, MYSV, PRSV-W, and WSMoV were provided by Shyi-Dong Yeh, National Chung Hsing University, Taichung, Taiwan. Six ZYMV ELISA-positive samples (three cucumber, two watermelon, and the weedy melon sample) were also tested by reverse transcription (RT)-PCR using the potyvirus universal primer pair Sprimer1/Oligo(dT) (2). The expected 1.6-kb viral cDNA was amplified from all six samples and each was sequenced. All sequences obtained from cucumber (GenBank Accession Nos. HM005307, HM005308, and HM005309), watermelon (GenBank Accession Nos. HM005311 and HM005312), and weedy melon (GenBank Accession No. HM005310) isolates were 1,684 nucleotides (nt) long excluding the 3' poly-A tails. They comprised the 3'-terminal of the NIb region (1 to 633 nt), the coat protein region (634 to 1473 nt), and the 3'-untranslated region (1,474 to 1,684 nt). Because the sequences shared high nucleotide identity (98.3 to 99.7%), these isolates were considered to be the same virus species. When the sequences were compared by BLASTn searching in GenBank and analyzed by DNAMAN Sequence Analysis Software (Lynnon Corporation, St-Louis, Pointe-Claire, Quebec, Canada), they were found to have the greatest nucleotide identity (97.4 to 98.0%) with the Connecticut strain of ZYMV (ZYMV-Connecticut; GenBank Accession No. D00692), within a clade of isolates from China, Italy, Japan, and the United States. When assessed separately, their coat protein (97.7 to 98.3% nucleotide and 98.9 to 99.6% amino acid identity) and 3'-untranslated regions (96.7 to 97.2% identity) also had greatest homology with ZYMV-Connecticut. To our knowledge, this is the first report of ZYMV infecting cucurbit plants in Mali. ZYMV should be taken into consideration when breeding cucurbit crops for this region, and managing viral diseases. References: (1) C. Desbiez et al. Plant Pathol. 46:809, 1997. (2) W. S. Tsai et al. Plant Dis. 94:378, 2010.

First Report of Pepper veinal mottle virus Associated with Mosaic and Mottle Diseases of Tomato and Pepper in Mali.

The aphid-transmitted Pepper veinal mottle virus (PVMV; genus Potyvirus, family Potyviridae) has been reported as causing an epidemic in solanaceous crops, including eggplant, pepper, and tomato in Africa (4). In West Africa, PVMV has been detected in Senegal, Sierra Leone, Ivory Coast, Ghana, Togo, Burkina Faso, and Nigeria (2). In April 2009, leaf yellowing, mosaic, mottle, and curling symptoms indicative of viral infection were common on tomato (Solanum lycopersicum) and pepper (Capsicum annuum) plants in home gardens and fields in Mali. Symptomatic leaf samples were collected from two sweet pepper and two tomato plants from Baguineda, four tomato plants and one chili pepper plant in Kati, and three chili pepper plants from Samanko. All samples except two chili pepper from Samanko and two sweet pepper and two tomato from Baguineda tested positive for begomovirus by PCR with primers PAL1v1978/PAR1c715 (3). PVMV was detected by double-antibody sandwich (DAS)-ELISA using PVMV antibody (DSMZ, Braunschweig, Germany) in both Baguineda sweet pepper, one Baguineda tomato, and one Samanko chili pepper sample. Three PVMV ELISA-positive samples, one each of sweet pepper, chili pepper, and tomato, were also confirmed by reverse transcription (RT)-PCR and sequencing. The expected 1.8-kb viral cDNA was amplified from all three samples using the potyvirus general primer Sprimer1 (5'-GGNAAYAAYAGHGGNCARCC-3'), which was modified from the Sprimer (1) as upstream primer, and Oligo(dT) (5'-GCGGGATCCCTTTTTTTTTTTTTTTTTT-3') as downstream primer. The sequences obtained from chili pepper (GenBank Accession No. GQ918274), sweet pepper (GenBank Accession No. GQ918275), and tomato (GenBank Accession No. GQ918276) isolates, excluding the 3' poly-A tails, were each 1,831 nucleotides (nt) long, comprising the 3'-terminal of the NIb region (1 to 642 nt), the coat protein region (643 to 1,455 nt), and the 3'-untranslated region (1,456 to 1,831 nt). The sequences shared between 99.3 and 99.5% nucleotide identity with each other. A comparison of these sequences with corresponding sequences of potyviruses in GenBank revealed they had greatest nucleotide identity (96.5 to 96.6%) with a tomato isolate of PVMV from Taiwan (PVMV-TW; GenBank Accession No. EU719647), between 81.4 and 95.9% identity with other PVMV isolates, and only as much as 67.2% identity with other potyvirus isolates. Analysis of coat protein regions alone also revealed high nucleotide (96.6 to 96.8%) and amino acid (99.3 to 99.6%) identity with PVMV-TW. The PVMV Baguineda tomato isolate caused mosaic and mottle symptoms on tomato (line CLN1558A) and pepper (cv. Early Calwonder) plants following mechanical inoculation. To our knowledge, this is the first report of PVMV infecting plants in Mali and reinforces the need to take this virus into consideration when breeding tomato and pepper for this region. References: (1) J. Chen et al. Arch. Virol. 146:757, 2001. (2) C. Huguenot et al. J. Phytopathol. 144:29, 1996. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) G. Thottappilly, J. Phytopathol. 134:265, 1992.

First Report of Tomato yellow leaf curl Thailand virus Associated with Pepper Leaf Curl Disease in Taiwan.

Whitefly-transmitted begomoviruses (family Geminiviridae, genus Begomovirus) cause severe epidemic and high yield losses on pepper (Capsicum annuum) crops in many areas of the world. In Taiwan, pepper plants showing leaf curling, blistering, distortion, mild vein yellowing, and stunting were observed in fields in Tainan County in 2007, but with disease incidence less than 10%. However, disease incidence of more than 70% was observed in some fields in Pingtung, Kaohsiung, Chiayi, and Yunlin counties in 2009. Two symptomatic samples in 2007 and three for each county in 2009 were collected for begomovirus detection. Viral DNA was extracted and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR using primer pairs PAL1v1978/PAR1c715 (4), DNABLC1/DNABLV2 (2), and Beta01/Beta02 (1), respectively. The expected 1.5-kb PCR product for DNA-A and 2.6-kb for DNA-B were obtained from all samples. However, DNA-beta was not detectable in any of the samples. One positive sample from each, Pingtung (LG6-2), Kaoshiung (LJ3-5), Tainan (P2-4), Chiayi (SG4-3), and Yunlin (HW2-2), were selected for further molecular characterization of DNA-A and DNA-B. On the basis of the sequences of the 1.5-kb DNA-A and 2.6-kb DNA-B PCR product, specific PCR primers were designed to obtain the complete DNA-A and DNA-B sequences for pepper-infecting begomovirus isolate LG6-2 (GenBank Accession Nos. GU208515 and GU208519), LJ3-5 (GenBank Nos. GU208516 and GU208520), P2-4 (GenBank Nos. EU249457 and EU249458), SG4-3 (GenBank Nos. GU208517 and GU208521), and HW2-2 (GenBank Nos. GU208518 and GU208522). The five isolates each contained the begomoviral conserved nonanucleotide sequence-TAATATTAC in DNA-As and DNA-Bs, six open reading frames (ORFs AV1, AV2, AC1, AC2, AC3, and AC4) in DNA-As, and two open reading frames (ORFs BV1 and BC1) in DNA-Bs. Sequence comparison by MegAlign software (DNASTAR, Inc. Madison, WI) showed that the five pepper-infecting begomovirus isolates had 99% nucleotide sequence identity in DNA-As and DNA-Bs and so they are considered isolates of the same species. BLASTn analysis with begomovirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD) indicated that the DNA-As and DNA-Bs of the five isolates had the highest nucleotide sequence identity of 99% each with the respective DNA-A and DNA-B of Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Nos. EF577266 and EF577267), a recently emerging bipartite begomovirus infecting tomato in Taiwan (3). On the basis of the DNA-A sequence comparison and the International Committee on Taxonomy of Viruses demarcation of species at 89% sequence identity, these virus isolates belong to the species TYLCTHV. The isolate P2-4 was found transmissible to C. annuum 'Early Calwonder' by whitefly (Bemisia tabaci biotype B) and induced the same leaf curling, blistering, and mild vein yellowing symptoms as those observed in pepper fields. To our knowledge, this is the first report of a begomovirus infecting pepper in Taiwan. The presence of TYLCTHV in the major pepper-production areas should be taken into consideration for pepper disease management and in developing begomovirus resistant pepper cultivars for Taiwan. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) F.-J. Jan et al. Plant Dis. 91:1363, 2007 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Complete nucleotide sequences of okra isolates of Cotton leaf curl Gezira virus and their associated DNA-beta from Niger.

Okra (Abelmoschus esculentus) is a major crop in Niger. In the fall of 2007, okra leaf curl disease was observed in Niger and the begomovirus and DNA-beta satellite were found associated with the disease. The complete nucleotide sequences of DNA-A (FJ469626 and FJ469627) and associated DNA-beta satellites (FJ469628 and FJ469629) were determined from two samples. This is the first report of molecular characterization of okra-infecting begomovirus and their associated DNA-beta from Niger. The begomovirus and DNA-beta have been identified as Cotton leaf curl Gezira virus and Cotton leaf curl Gezira betasatellite, respectively, which are reported to also infect okra in Egypt, Mali and Sudan.

Identification of a New Begomovirus Associated with Yellow Leaf Curl Diseases of Tomato and Pepper in Sulawesi, Indonesia.

Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5'CCCGGATCCTCTAATTCATCCCT3'; IndC: 5'GACGGATCCCACATGTTTGCCA3') was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. S. Tsai et al. Plant Dis. 90:831, 2006.

Occurrence and Molecular Characterization of Squash leaf curl Phillipines virus in Taiwan.

Whitefly-transmitted, cucurbit-infecting begomoviruses (genus Begomovirus, family Geminiviridae) have been detected on cucurbit crops in Bangladesh, China, Egypt, Israel, Malaysia, Mexico, the Philippines, Thailand, United States, and Vietnam. Pumpkin plants showing leaf curling, blistering, and yellowing symptoms were observed in the AVRDC fields (Tainan, Taiwan) during 2001 and in nearby farmers' fields during 2005. Two samples from symptomatic plants were collected in 2001 and six collected in 2005. Viral DNAs were extracted (2), and the PCR, with previously described primers, was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in one of the 2001 samples and in all 2005 samples. The PCR-amplified 1.5 kb viral DNA-A from one positive sample each from the 2001 and 2005 collections was cloned and sequenced. On the basis of the 1.5-kb DNA-A sequences, specific primers were designed to completely sequence the DNA-A component. The overlap between fragments obtained using primer walking ranged from 43 to 119 bp with 100% nt identities. The complete DNA-A sequences were determined for the two isolates as 2,734 bp (2001) (GenBank Accession No. DQ866135) and 2,733 bp (2005) (GenBank Accession No. EF199774). Sequence comparisons and analyses were performed using the DNAMAN Sequence Analysis Software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of the begomovirus isolates each contained the conserved nanosequence-TAATATTAC and six open reading frames, including two in the virus sense and four in the complementary sense. On the basis of a 99% shared nucleotide sequence identity, they are considered isolates of the same species. BLASTn analysis and a comparison of the sequence with others available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the Taiwan virus shared its highest nt identity (more than 95%) with the Squash leaf curl Philippines virus (GenBank Accession No. AB085793). Virus-associated satellite DNA was not found in any of the samples. DNA-B was found in both samples, providing further evidence that the virus was the same as the bipartite Squash leaf curl Philippines virus. To our knowledge, this is the first report of Squash leaf curl Philippines virus in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

First Report of Tomato yellow leaf curl Thailand virus in Taiwan.

During the 2006 winter and 2007 spring seasons, tomato lines carrying the Ty2 gene, which confers resistance to the Tomato leaf curl Taiwan virus (GenBank Accession No. U88692), showed severe yellowing, leaf curl, and stunting symptoms in several locations in Tainan County, Taiwan. Whiteflies were found to be associated with symptomatic plants, and disease incidences of almost 100% were observed. The presence of a new resistance breaking begomovirus was suspected. Six symptomatic leaf samples of three different tomato plants from each infected field were collected in Liouying (LY3, 7, and 8) and Sigang (SG9, 13, and 18) townships in Tainan County. Viral DNAs were extracted (2), and PCR with previously described primers was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in all tested samples. The PCR-amplified 1.5-kb viral DNA-A from one positive sample from each location (LY3 and SG18) was cloned and sequenced. On the basis of the 1.5 kb DNA-A sequences, specific primers were designed for cloning and sequencing the complete viral DNA-A, which was 2,744 bp for both the Liouying (GenBank Accession No. EF577266) and Sigang (GenBank Accession No. EF577264) isolates. Sequence analyses were conducted with DNAMAN sequence analysis software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of both isolates contained the conserved nanonucleotides-TAATATTAC and six open reading frames, including two in the virus sense (AV1 and AV2) and four in the complementary sense (AC1 to AC4). On the basis of their 99.5% nucleotide identity, they are considered isolates of the same species. BLASTn analysis and sequence comparison with those available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the two isolates had the highest nucleotide identity (more than 98.4%) with the DNA-A of the Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Accession No. AY514631). Virus-associated satellite DNA was not found in any of the samples. However, DNA-B was detected in all six samples, providing further evidence that the two isolates were the same as the bipartite TYLCTHV. All samples, except the LY3, were also found to be infected with Tomato leaf curl Taiwan virus (ToLCTWV), as indicated by a positive PCR reaction using the ToLCTWV-specific primer pair KD-PAV1 (5'ATCGTGTTGGGAAGAGGTTT3') and KD-PAC1 (5'GGAGAAAGCTCCCAAAGATT3'). A pure TYLCTHV isolate of LY3 was obtained in Lycopersicum esculentum TK70 by transmission with Bemisia tabaci Biotype B. The isolated TYLCTHV was found to infect L. esculentum H24 (resistant to ToLCTWV) and induce typical yellow leaf curl symptoms. To our knowledge, this is the first report of the presence of TYLCTHV in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Incidence and factors predictive of acute renal failure in patients with advanced liver cirrhosis.

BACKGROUND: Acute renal failure (ARF) is a life-threatening entity that frequently complicates advanced liver disease. This study documents a number of factors that may predispose to or precipitate ARF and influence outcomes in patients with advanced liver disease. Comparisons are also made between subgroups of patients with viral and alcohol-induced liver cirrhosis in those with ARF. PATIENTS AND METHODS: We conducted a retrospective chart review over one year of 127 consecutive hospital admissions in 82 patients who were diagnosed with advanced liver cirrhosis (Child-Pugh Class C) in a tertiary care center. A diagnosis of ARF was made in 29 admissions and another 98 admissions not complicated by ARF served as controls. This study evaluated different etiologies of ARF and developed a database which included clinical features, biochemical parameters, the etiology of cirrhosis, possible predisposing factors, and precipitating events. Version II of the Acute Physiology and Chronic Health Physiology Scoring system (APACHE II) was applied to predict short-term hospital mortality rates. RESULTS: ARF occurred in 29 admissions over the one-year study period (23%). The mean age of these patients was 56.8 +/- 12.0 years, and 73% were men. The patients with ARF had significant hyponatremia and higher levels of serum bilirubin, aspartate aminotransferase (AST), alanine aminotransferase (ALT), and white cell counts on admission than the controls. Patients who developed ARF were more likely to have had infection, especially septicemia, and gastrointestinal (GI) bleeding. Mortality rate in the patients with ARF was much higher than in those patients without ARF (72% vs. 13%, p < 0.001). The patients with viral cirrhosis and ARF were found to have higher leukocyte counts, serum bilirubin levels, and more frequent incidence of infection, septicemia and GI bleeding compared to the patients with alcoholic liver cirrhosis and ARF. Those with viral hepatitis were also significantly older and had more frequent incidence of ascites, but had lower levels of gamma-glutamyl transpeptidase and less frequent incidence of encephalopathy. CONCLUSIONS: The risk of ARF is significantly increased in patients with advanced liver cirrhosis presenting with marked hyperbilirubinemia, hyponatremia, elevated liver enzymes, infection, and GI bleeding. The presence of ARF leads to higher mortality rates in both viral and alcohol-induced liver cirrhosis.

Molecular Characterization of a Distinct Begomovirus Associated with Tomato Leaf Curl Disease in Arusha of Tanzania.

Mild leaf curling and yellowing symptoms were observed in approximately 5% of 1-month-old tomato plants (Solanum lycopersicum) in a farmer's field in Tengeru, Arusha, Tanzania in January 2006. DNA was extracted from four symptomatic and five asymptomatic plants and tested for the presence of begomovirus by polymerase chain reaction (PCR) using primer pair PAL1v1978/PAR1c715 (4). All asymptomatic samples were negative. Two of four symptomatic samples yielded the expected 1.4-kb DNA-A fragment for begomovirus. DNA-B was not detected in these two samples by PCR using the DNA-B degenerate primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2), and PBL1v2040/PCRc1 and PBL1v2040/PCRc154 (4). DNA-beta was also not detectable using DNA-beta specific primers (1). The 1.4-kb PCR product from one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,766 nucleotides (Genbank Accession No. DQ519575) and was found to contain the geminiviral conserved nanosequence-TAATATTAC in the intergenic region and the six predicted open reading frames (V1, V2, C1, C2, C3, and C4). BLAST analysis was conducted with geminivirus sequences available in GenBank, and MegAlign software (DNASTAR, Inc, Madison, WI) was used for further comparisons. Highest sequence identity (84%) was with the partially sequenced Tomato leaf curl Tanzania virus found in Makutupora, Tanzania in 1994 (1,523 nucleotides, Genbank Accession No. U73498) in the 1,919 nt to 679 nt region. Low sequence identity (78%) was noted with Tomato yellow leaf curl Sardinia virus (Genbank Accession No. X61153) that is reportedly prevalent in Arusha, Morogoro, Dodoma, Iringa, Kilimanjaro, and Dar es Salaam of Tanzania (3). Comparison of the nucleotide sequence of this new virus with those of full-length begomoviral DNA-A available in GenBank indicated highest sequence identity (81%) with Tomato leaf curl Mayotte virus (EMBL Accession No. AJ865341). On the basis of the DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity, the tomato leaf curl virus from Arusha, Tanzania constitutes a distinct begomovirus and the name Tomato leaf curl Arusha virus is proposed. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) B. D. Kashina et al. Arch. Phytopathol. Plant Prot. 35:255, 2002 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

First Report of a Begomovirus Associated with Tomato Yellow Leaf Curl Disease in Ethiopia.

During December 2003, severe leaf yellowing, leaf curling, and stunting symptoms were observed in tomato (Lycopersicon esculentum) plantings in Melkassa (1,550 m above sea level), Ethiopia. Eleven symptomatic samples were collected and tested for the presence of a begomovirus using polymerase chain reaction (PCR) with the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (3). Samples were also tested for Cucumber mosaic virus (CMV), Potato virus Y (PVY), Tobacco etch virus (TEV), Pepper veinal mottle virus (PVMV), and Tomato mosaic virus (ToMV) using enzyme-linked immunosorbent assay (ELISA). All samples were negative for CMV, PVY, TEV, PVMV, and ToMV. However, the expected 1.4-kb PCR product for begomoviruses was obtained from all samples. DNA-B and DNA-beta were not detectable using PCR with the DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/ DNABLV2 (2) and the DNA-beta primer pair Beta01/Beta02 (1), respectively. The 1.4-kb PCR product of one sample was cloned and sequenced. On the basis of the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,785 nucleotides (GenBank Accession No. DQ358913) and was found to contain the six predicted open reading frames (ORFs V1, V2, C1, C2, C3, and C4). A BLAST analysis was conducted with geminivirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD), and DNAMAN software (Lynnon Corporation, Quebec, Canada) was used for further comparisons. The DNA-A sequence of the virus associated with yellow leaf curl disease of tomato from Ethiopia showed highest sequence identity (92%) with Tomato yellow leaf curl Mali virus (TYLCMLV; GenBank Accession No. AY502934). On the basis of the DNA-A sequence comparison and the ICTV demarcation of species at 89% sequence identity, the Ethiopian virus is a provisional strain of TYLCMLV described from Mali. To our knowledge, this is the first report of a begomovirus associated with tomato yellow leaf curl disease in Ethiopia. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Molecular Characterization of a Distinct Tomato-Infecting Begomovirus Associated with Yellow Leaf Curl Diseased Tomato in Lembang, Java Island of Indonesia.

Three distinct tomato-infecting begomoviruses have been identified from Indonesia (GenBank Accessions Nos. AB100304, AB100305, and DQ083765). Severe yellow leaf curl epidemics have been observed on tomato on Java Island since the late 1990s. Viral DNA was extracted (2) from one such sample collected in Lembang, West Java in 1998. Polymerase chain reaction with previously described primers was used to detect the presence of geminiviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). The predicted 1.4-kb DNA-A fragment was amplified with the general primer pair PAL1v1978/PAR1c715 and then cloned and sequenced. DNA-B and satellite DNA were not detected in the sample. On the basis of the partial DNA-A sequences, specific primers were designed to amplify and sequence the complete DNA-A component (2,762 nucleotides, GenBank Accession No. AF189018). The DNA-A sequence contained the geminivirus-conserved nanosequence TAATATTAC in the loop of the hairpin structure of the intergenic region and six open reading frames including two in the virus sense and four in the complementary sense. Pairwise comparison of the full-length DNA-A sequence with those of other begomoviruses available in the GenBank database was done by the MegAlign software (DNASTAR, Inc, Madison, WI). Highest nucleotide sequence identity (74.1%) was with Tomato leaf curl Mayotte virus-[Kahani] (GenBank Accession No. AJ865340). Comparison of the full-length DNA-A sequence with the three above mentioned tomato-infecting begomoviruses from Indonesia also showed less than 71% nucleotide sequence identities. Because the DNA-A sequence had less than 89% identity with other begomoviruses, it should be classified as a distinct virus according to the International Committee on Taxonomy of Viruses. The name Tomato yellow leaf curl Indonesia virus-[Lembang] (TYLCIDV-[Lem]) is proposed. The presence of at least four distinct tomato-infecting begeminiviruses on Java Island needs to be considered when developing tomato cultivars with stable resistance to tomato (yellow) leaf curl disease. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Molecular Characterization of a Begomovirus Associated with Tomato Leaf Curl Disease in Uganda.

During the summer of 2003, leaf curl symptoms were observed in tomato (Lycopersicon esculentum) plantings in the Iganga District of Uganda. Begomoviral infection was suspected. Twelve symptomatic samples were collected. Begomoviral DNA was extracted and amplified using polymerase chain reaction (PCR) with the begomovirus-specific degenerate primer pair PAL1v1978/PAR1c715 (4). The expected 1.4-kb PCR products were obtained from 11 of 12 samples. The 1.4-kb PCR product of one of the samples was cloned and sequenced. Based on the sequence of the 1.4-kb DNA product, specific primers were designed to complete the DNA-A sequence. The DNA-A consisted of 2,747 nucleotides (GenBank Accession No. DQ127170) and was found to contain seven predicted open reading frames (ORFs V1, V2, C1, C2, C3, C4, and C5). A BLAST analysis was conducted with geminivirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD), and MegAlign (DNASTAR, Inc, Madison, WI) software was used for further comparisons. The DNA-A sequence of the virus associated with leaf curl of tomato from Uganda showed less than 79% sequence identity with cassava mosaic viruses from Uganda (GenBank/EMBL Accession Nos. AF126800, AF126802, AF126804, AF126806, and Z83257), the only begomoviruses from the country so far in the public domain. Highest sequence identity (83%) was with Tomato leaf curl Mayotte virus from Dembeni, Mayotte, Comoros Islands (ToLCYTV-[Dem], EMBL Accession No. AJ865341). Pairwise comparison with ToLCYTV-[Dem] showed 60, 88, 91, 82, 84, 86, and 80% sequence identities in the intergenic region, V2, V1, C1, C2, C3, and C4 ORFs, respectively. Only low sequence identities (ranging from 71 to 82%) were obtained with other tomato bego-moviruses reported from Africa (GenBank/EMBL Accession Nos. AF261885, AJ865337-AJ865340, AY044137-AY044139, AY502934, AY502936, AY594174, AY736854, and U73498). There was no evidence for the presence of DNA-B or DNA-beta using PCR with the DNA-B specific primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the DNA-beta primer pair Beta01/Beta02 (1), respectively. Detection of possible recombination was by RDP2 software (3) using DNA-A sequences of begomoviruses from Uganda and tomato begomoviruses from Africa. The DNA-A was found to contain a small recombinant fragment from ToLCYTV-[Dem] in the 411 to 969 nucleotide position with 92% sequence identity. Based on DNA-A sequence comparisons, the tomato leaf curl virus from Uganda most likely constitutes a distinct new begomovirus. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) D. P. Martin et al. Bioinformatics 21:260, 2005. (4) M. R. Rojas et al. Plant Dis.77:340, 1993.

Molecular Characterization of Pepper yellow leaf curl Indonesia virus in Leaf Curl and Yellowing Diseased Tomato and Pepper in Indonesia.

Yellowing and leaf curl symptoms were observed in tomato and pepper fields near Bogor, Java, Indonesia in 2000. Samples were collected from one diseased tomato (Lycopersicum esculentum) and three diseased chili pepper (Capsicum annuum) plants. Viral DNA was extracted (2) and tested for the presence of geminiviral DNA-A, DNA-B, and associated satellite DNA using polymerase chain reaction (PCR) with previously described primers (1,3,4). The begomovirus DNA-A general primer pair PAL1v1978/PAR1c715 amplified the predicted 1.4-kb DNA fragment from the tomato and two of the chili samples. DNA-B and satellite DNA were not detected using PCR with DNA-B general primer pairs (DNABLC1/DNABLV2 and DNABLC2/DNABLV2) and satellite detection primer pair (Beta01/Beta02). The amplicons from the tomato and from one of the chili samples were cloned and sequenced. On the basis of the 1.4-kb DNA sequences, specific primers were designed to complete the DNA-A sequences. Following sequence assembly, the full-length DNA-A nucleotide sequences were determined as 2,744 nt (GenBank Accession No. DQ083765) for the tomato- and 2,743 nt (GenBank Accession No. DQ083764) for the chili-infecting begomoviruses. Sequence comparisons and analyses were conducted using the DNAMAN sequence analysis software (Lynnon Corporation, Quebec, Canada). The DNA-A of both begomoviruses contained six open reading frames, including two in the virus sense and four in the complementary sense, and the geminivirus conserved nanosequence-TAATATTAC in the loop of the hairpin structure of the intergenic region. Because of their high nucleotide sequence identities of 99%, the tomato- and chili-infecting begomovirus are considered the same virus. When compared by using BLAST with available gem-iniviral sequences in the GenBank database, the DNA-A sequences of the tomato and the chili isolates showed highest nucleotide sequence identity (95%) with the partially sequenced Pepper yellow leaf curl Indonesia virus (GenBank Accession No. AB189849) in the 1,842 nt to 660 nt region and in the 1,841 nt to 659 nt region, respectively. Comparisons with full-length DNA-A sequences of begomoviruses available in the GenBank database indicated high sequence identities of 76 and 77% for the tomato and chili isolates, respectively, with an eggplant isolate of Tomato yellow leaf curl Kanchanaburi virus (GenBank Accession No. AF511530) from Thailand. According to our knowledge, this is the first report of full-length DNA-A sequence of the Pepper yellow leaf curl Indonesia virus and its natural occurrence in tomato and pepper in the Bogor area of Indonesia. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Diversity of begomovirus DNA beta satellites of non-malvaceous plants in east and south east Asia.

Two previous analyses of the diversity of begomovirus-associated DNA beta satellites focused predominantly on molecules originating from the Indian sub-continent and southern China. They showed the satellites to group according to the hosts from which they were isolated, either malvaceous or non-malvaceous plants, and then to form sub-groups based upon geographic origin and host. In this study we analysed the diversity of DNA beta satellites in east and south east Asia. Here the satellites group by geographic location and are considerably more diverse than previously indicated. This probably reflects the limited movement of begomovirus/DNA beta complexes in this region and their subsequent diversification from a common ancestor to a variety of hosts.