Abnormal glomerular basement membrane maturation impairs mesangial cell differentiation during murine postnatal nephrogenesis.

Although mesangial cell-glomerular basement membrane (GBM) connections play a key role in maintaining the glomerular capillary loop structure, information remains limited about how these connections are formed during glomerulogenesis. We have previously shown that weakened podocyte-GBM interactions owing to tensin 2 (Tns2) deficiency lead to abnormal GBM maturation during postnatal glomerulogenesis. Here, we investigated whether abnormal GBM maturation affected mesangial cell-GBM connections and mesangial cell differentiation. Histological analysis of the outer cortical glomeruli in Tns2-deficient mice revealed that GBM materials overproduced by stressed immature podocytes accumulated in the mesangium and interrupted the formation of mesangial cell-GBM connections, resulting in fewer capillary loops compared with that of normal glomeruli. In addition, expression of α-smooth muscle actin, an immature mesangial cell marker, persisted in mesangial cells of Tns2-deficient outer cortical glomeruli even after glomerulogenesis was completed, resulting in mesangial expansion. Furthermore, analysis of mouse primary mesangial cells revealed that mesangial cell differentiation depended on the type of extracellular matrix components to which the cells adhered, suggesting the participation of mesangial cell-GBM connections in mesangial cell differentiation. These findings suggest that abnormal GBM maturation affects mesangial cell differentiation by impairing mesangial cell-GBM connections.NEW & NOTEWORTHY Mesangial cell-glomerular basement membrane (GBM) connections play an important role in maintaining the structural integrity of the glomerular tuft. However, information remains scarce about how GBM maturation affects the formation of these connections during glomerular development. Here, we show that abnormal GBM maturation due to tensin 2 deficiency affects mesangial cell differentiation by impairing mesangial cell-GBM connections during postnatal glomerulogenesis.

Urinary protein analysis in mice lacking major urinary proteins.

Mouse urine contains major urinary proteins (MUPs) that are not found in human urine. Therefore, even healthy mice exhibit proteinuria, unlike healthy humans, making it challenging to use mice as models for human diseases. It was also unknown whether dipsticks for urinalysis could measure protein concentrations precisely in urine containing MUPs. To resolve these problems, we produced MUP-knockout (Mup-KO) mice by removing the Mup gene cluster using Cas9 proteins and two guide RNAs and characterized the urinary proteins in these mice. We measured the urinary protein concentrations in Mup-KO and wild-type mice using a protein quantitation kit and dipsticks. We also examined the urinary protein composition using SDS-PAGE and two-dimensional electrophoresis (2DE). The urinary protein concentration was significantly lower (P<0.001) in Mup-KO mice (17.9 ± 1.8 mg/dl, mean ± SD, n=3) than in wild-type mice (73.7 ± 8.2 mg/dl, n=3). This difference was not reflected in the dipstick values, perhaps due to the low sensitivity to MUPs. This suggests that dipsticks have limited ability to measure changes in MUPs with precision. SDS-PAGE and 2DE confirmed that Mup-KO mice, like humans, had no MUPs in their urine, whereas wild-type mice had abundant MUPs in their urine. The absence of the masking effect of MUPs in 2DE would enable clear comparisons of urinary proteins, especially low-molecular-weight proteins. Thus, Mup-KO mice may provide a useful model for human urinalysis.

Tensin2 is important for podocyte-glomerular basement membrane interaction and integrity of the glomerular filtration barrier.

Tensin2 (Tns2), an integrin-linked protein, is enriched in podocytes within the glomerulus. Previous studies have revealed that Tns2-deficient mice exhibit defects of the glomerular basement membrane (GBM) soon after birth in a strain-dependent manner. However, the mechanisms for the onset of defects caused by Tns2 deficiency remains unidentified. Here, we aimed to determine the role of Tns2 using newborn Tns2-deficient mice and murine primary podocytes. Ultrastructural analysis revealed that developing glomeruli during postnatal nephrogenesis exhibited abnormal GBM processing due to ectopic laminin-α2 accumulation followed by GBM thickening. In addition, analysis of primary podocytes revealed that Tns2 deficiency led to impaired podocyte-GBM interaction and massive expression of laminin-α2 in podocytes. Our study suggests that weakened podocyte-GBM interaction due to Tns2 deficiency causes increased mechanical stress on podocytes by continuous daily filtration after birth, resulting in stressed podocytes ectopically producing laminin-α2, which interrupts GBM processing. We conclude that Tns2 plays important roles in the podocyte-GBM interaction and maintenance of the glomerular filtration barrier.

Analysis of the transgene insertion pattern in a transgenic mouse strain using long-read sequencing.

Transgene insertion patterns are critical for the analysis of transgenic animals because the influence of transgenes may change depending on the insertion pattern (such as copy numbers and orientations of concatenations) and the insertion position in the genome. We previously reported a genomic walking strategy to locate transgenes in the genomes of transgenic mice (Exp. Anim. 53: 103-111, 2004) and to analyze transgene insertion patterns (Exp. Anim. 55: 65-69, 2006). With such strategies, however, we could not determine the copy number of transgenes or global genome modification induced by transgene insertion due to read-length limitation. In this study, we used a long-read sequencer (MinION, Oxford Nanopore Technologies) to overcome this limitation. We obtained 922,210 reads using MinION with genomic DNA from a transgenic mouse strain (4C30, Proc. Jpn. Acad. Ser. B. Phys. Biol. Sci. 87: 550-562, 2011). Among the reads, we found one 21,457-bp read containing the transgene using a local BLAST search. Nucleotide dot plot analysis revealed that the transgene was inserted in the genome as a tandem concatemer with an almost entire construct (15-3,508 of 3,508 bp) and a partial fragment (4-660, 657 bp). Ensembl's BLAST search against the C57BL/6N genome revealed a 9,388-bp deletion at the insertion position in the intron of the Sgcd gene, confirming that mutations such as a large genomic deletion could occur at the time of transgene insertion. Thus, long-read sequencers are useful tools for the analysis of transgene insertion patterns.

C1r/C1s deficiency is insufficient to induce murine systemic lupus erythematosus.

C1s deficiency is strongly associated with the development of human systemic lupus erythematosus (SLE); however, the mechanisms by which C1s deficiency contributes to the development of SLE have not yet been elucidated in detail. Using ICR-derived-glomerulonephritis (ICGN) mouse strain that develops SLE and very weakly expresses C1s in the liver, we investigated the protective roles of C1s against SLE. A genetic sequence analysis revealed complete deletion of the C1s1 gene, a mouse homolog of the human C1s gene, with partial deletion of the C1ra and C1rb genes in the ICGN strain. This deletion led to the absence of C1r/C1s and a low level of C1q in the circulation. In order to investigate whether the C1r/C1s deficiency induces SLE, we produced a congenic mouse strain by introducing the deletion region of ICGN into the C57BL/6 strain. Congenic mice exhibited no C1r/C1s and a low level of C1q in the circulation, but did not have any autoimmune defects. These results suggest that C1r/C1s deficiency is not sufficient to drive murine SLE and also that other predisposing genes exist in ICGN mice.

Essential Role of CARD14 in Murine Experimental Psoriasis.

Caspase recruitment domain family member 14 (CARD14) was recently identified as a psoriasis-susceptibility gene, but its immunological role in the pathogenesis of psoriasis in vivo remains unclear. In this study, we examined the role of CARD14 in murine experimental models of psoriasis induced by either imiquimod (IMQ) cream or recombinant IL-23 injection. In all models tested, the psoriasiform skin inflammation was abrogated in Card14-/- mice. Comparison of the early gene signature of the skin between IMQ-cream-treated Card14-/- mice and Tlr7-/-Tlr9-/- mice revealed not only their similarity, but also distinct gene sets targeted by IL-23. Cell type-specific analysis of these mice identified skin Langerinhigh Langerhans cells as a potent producer of IL-23, which was dependent on both TLR7 and TLR9 but independent of CARD14, suggesting that CARD14 is acting downstream of IL-23, not TLR7 or TLR9. Instead, a bone marrow chimera study suggested that CARD14 in radio-sensitive hematopoietic cells was required for IMQ-induced psoriasiform skin inflammation, controlling the number of Vγ4+ T cells producing IL-17 or IL-22 infiltrating through the dermis to the inflamed epidermis. These data indicate that CARD14 is essential and a potential therapeutic target for psoriasis.

Incorrect strain information for mouse cell lines: sequential influence of misidentification on sublines.

Misidentification or cross-contamination of cell lines can cause serious issues. Human cell lines have been authenticated by short tandem repeat profiling; however, mouse cell lines have not been adequately assessed. In this study, mouse cell lines registered with the JCRB cell bank were examined by simple sequence length polymorphism (SSLP) analysis to identify their strains. Based on comparisons with 7 major inbred strains, our results revealed their strains in 80 of 90 cell lines. However, 12 of the 80 cell lines (15%) were found to differ from registered information. Of them, 4 cell lines originated from the same mouse, which had been generated through mating between two different inbred strains. The genotype of the mouse sample had not been examined after the backcross, leading to strain misidentification in those cell lines. Although 8 other cell lines had been established as sublines of a BALB/c cell line, their SSLP profiles are similar to a Swiss cell line. This affects differences in genotypes between inbred and outbred strains. Because the use of inbred samples and interbreeding between strains are not involved in human materials, our results suggest that the cause and influence of misidentification in mouse cell lines are different from those in human.

Parametric analysis of colony morphology of non-labelled live human pluripotent stem cells for cell quality control.

Given the difficulties inherent in maintaining human pluripotent stem cells (hPSCs) in a healthy state, hPSCs should be routinely characterized using several established standard criteria during expansion for research or therapeutic purposes. hPSC colony morphology is typically considered an important criterion, but it is not evaluated quantitatively. Thus, we designed an unbiased method to evaluate hPSC colony morphology. This method involves a combination of automated non-labelled live-cell imaging and the implementation of morphological colony analysis algorithms with multiple parameters. To validate the utility of the quantitative evaluation method, a parent cell line exhibiting typical embryonic stem cell (ESC)-like morphology and an aberrant hPSC subclone demonstrating unusual colony morphology were used as models. According to statistical colony classification based on morphological parameters, colonies containing readily discernible areas of differentiation constituted a major classification cluster and were distinguishable from typical ESC-like colonies; similar results were obtained via classification based on global gene expression profiles. Thus, the morphological features of hPSC colonies are closely associated with cellular characteristics. Our quantitative evaluation method provides a biological definition of 'hPSC colony morphology', permits the non-invasive monitoring of hPSC conditions and is particularly useful for detecting variations in hPSC heterogeneity.

Tensin2-deficient mice on FVB/N background develop severe glomerular disease.

Tensin2 (Tns2) is an essential component for the maintenance of glomerular basement membrane (GBM) structures. Tns2-deficient mice were previously shown to develop mild glomerular injury on a DBA/2 background, but not on a C57BL/6J or a 129/SvJ background, suggesting that glomerular injury by the deletion of Tns2 was strongly dependent on the genetic background. To further understand the mechanisms for the onset and the progression of glomerular injury by the deletion of Tns2, we generated Tns2-deficient mice on an FVB/N (FVB) strain, which is highly sensitive to glomerular disease. Tns2-deficient mice on FVB (FVBGN) developed severe nephrotic syndrome, and female FVBGN mice died within 8 weeks. Ultrastructural analysis revealed that FVBGN mice exhibited severe glomerular defects with mesangial process invasion of glomerular capillary tufts, lamination and thickening of the GBM and subsequent podocyte foot process effacement soon after birth. Aberrant laminin components containing α1, α2 and ß1 chains, which are normally expressed in the mesangium, accumulated in the GBM of FVBGN, suggesting that these components originated from mesangial cells that invaded glomerular capillary tufts. Compared to Tns2-deficient mice on the other backgrounds in previous reports, FVBGN mice developed earlier onset of glomerular defects and rapid progression of renal failure. Thus, this study further extended our understanding of the possible genetic background effect on the deterioration of nephrotic syndrome by Tns2 deficiency.

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

Tenc1-deficient mice develop glomerular disease in a strain-specific manner.

BACKGROUND/AIMS: Tenc1 (also known as tensin2) is an integrin-associated focal adhesion molecule that is broadly expressed in mouse tissues including the liver, muscle, heart and kidney. A mouse strain carrying mutated Tenc1, the ICR-derived glomerulonephritis (ICGN) strain, develops severe nephrotic syndrome. METHODS: To elucidate the function of Tenc1 in the kidney, Tenc1(ICGN) was introduced into 2 genetic backgrounds, i.e. DBA/2J (D2) and C57BL/6J (B6), strains that are respectively susceptible and resistant to chronic kidney disease. RESULTS: Biochemical and histological analysis revealed that homozygous Tenc1(ICGN) mice develop nephrotic syndrome on the D2 background (D2GN) but not on the B6 background (B6GN). Initially, abnormal assembly and maturation of glomerular basement membrane (GBM) were observed, and subsequently effacement of podocyte foot processes was noted in the kidneys of D2GN but not B6GN mice. These defects are likely to be involved in the integrin signaling pathway. CONCLUSION: This study suggests that Tenc1 contributes to the maintenance of GBM structures and that the genetic background influences the severity of nephrotic syndrome.

Gene expression analysis detected a low expression level of C1s gene in ICR-derived glomerulonephritis (ICGN) mice.

BACKGROUND: ICR-derived glomerulonephritis (ICGN) strain is a novel inbred strain of mice with a hereditary nephrotic syndrome. Deletion mutation of tensin 2 (Tns2), a focal adhesion molecule, has been suggested to be responsible for nephrotic syndrome in ICGN mice; however, the existence of other associative factors has been suggested. METHODS AND RESULTS: To identify additional associative factors and to better understand the onset mechanism of nephrotic syndrome in ICGN mice, we conducted a comprehensive gene expression analysis using DNA microarray. Immune-related pathways were markedly altered in ICGN mice kidney as compared with ICR mice. Furthermore, the gene expression level of complement component 1, s subcomponent (C1s), whose human homologue has been reported to associate with lupus nephritis, was markedly low in ICGN mouse kidney. Real-time quantitative reverse transcription-polymerase chain reaction confirmed a low expression level of C1s in ICGN mouse liver where the C1s protein is mainly synthesized. A high serum level of anti-dsDNA antibody and deposits of immune complexes were also detected in ICGN mice by enzyme-linked immunosorbent assay and immunohistochemical analyses, respectively. CONCLUSION: Our results suggest that the immune system, especially the complement system, is associated with nephrotic syndrome in ICGN mice. We identified a low expression level of C1s gene as an additional associative factor for nephrotic syndrome in ICGN mice. Further studies are needed to elucidate the role of the complement system in the onset of nephrotic syndrome in ICGN mice.

Protein kinase C regulates human pluripotent stem cell self-renewal.

BACKGROUND: The self-renewal of human pluripotent stem (hPS) cells including embryonic stem and induced pluripotent stem cells have been reported to be supported by various signal pathways. Among them, fibroblast growth factor-2 (FGF-2) appears indispensable to maintain self-renewal of hPS cells. However, downstream signaling of FGF-2 has not yet been clearly understood in hPS cells. METHODOLOGY/PRINCIPAL FINDINGS: In this study, we screened a kinase inhibitor library using a high-throughput alkaline phosphatase (ALP) activity-based assay in a minimal growth factor-defined medium to understand FGF-2-related molecular mechanisms regulating self-renewal of hPS cells. We found that in the presence of FGF-2, an inhibitor of protein kinase C (PKC), GF109203X (GFX), increased ALP activity. GFX inhibited FGF-2-induced phosphorylation of glycogen synthase kinase-3ß (GSK-3ß), suggesting that FGF-2 induced PKC and then PKC inhibited the activity of GSK-3ß. Addition of activin A increased phosphorylation of GSK-3ß and extracellular signal-regulated kinase-1/2 (ERK-1/2) synergistically with FGF-2 whereas activin A alone did not. GFX negated differentiation of hPS cells induced by the PKC activator, phorbol 12-myristate 13-acetate whereas Gö6976, a selective inhibitor of PKCα, ß, and γ isoforms could not counteract the effect of PMA. Intriguingly, functional gene analysis by RNA interference revealed that the phosphorylation of GSK-3ß was reduced by siRNA of PKCδ, PKCε, and ζ, the phosphorylation of ERK-1/2 was reduced by siRNA of PKCε and ζ, and the phosphorylation of AKT was reduced by PKCε in hPS cells. CONCLUSIONS/SIGNIFICANCE: Our study suggested complicated cross-talk in hPS cells that FGF-2 induced the phosphorylation of phosphatidylinositol-3 kinase (PI3K)/AKT, mitogen-activated protein kinase/ERK-1/2 kinase (MEK), PKC/ERK-1/2 kinase, and PKC/GSK-3ß. Addition of GFX with a MEK inhibitor, U0126, in the presence of FGF-2 and activin A provided a long-term stable undifferentiated state of hPS cells even though hPS cells were dissociated into single cells for passage. This study untangles the cross-talk between molecular mechanisms regulating self-renewal and differentiation of hPS cells.

Oral glucose loading modulates plasma ß-amyloid level in alzheimer's disease patients: potential diagnostic method for Alzheimer's disease.

BACKGROUND: Although plasma ß-amyloid (Aß) has been suggested to be a noninvasive diagnostic biomarker for Alzheimer's disease (AD), its significance and validity have been inconclusive. Thus, it is quite important to establish a novel diagnostic method related to plasma Aß. METHODS: As our previous animal studies demonstrated a relation of glucose with plasma Aß, we examined the effect of glucose loading on plasma Aß levels in AD patients. After fasting, an oral glucose load was administered to AD patients and non-AD dementia patients, and subsequently, blood glucose, plasma insulin, and plasma Aß levels were measured. RESULTS: The plasma levels of baseline blood glucose, plasma insulin, and plasma Aß were not different between the two groups. However, immediately after glucose loading, a significant increase in plasma Aß40 and Aß42 levels was observed in AD patients, whereas a mild decrease in plasma Aß40 and Aß42 levels was detected in non-AD dementia patients. CONCLUSION: The present study clearly demonstrated a different response in plasma Aß40 and Aß42 levels after glucose loading between AD and non-AD dementia patients, which is consistent with our previous animal studies. These findings suggest a novel diagnostic tool for AD using the elevation of plasma Aß level after glucose loading, although further studies are necessary.

A potent inhibitor of SIK2, 3, 3', 7-trihydroxy-4'-methoxyflavon (4'-O-methylfisetin), promotes melanogenesis in B16F10 melanoma cells.

Flavonoids, which are plant polyphenols, are now widely used in supplements and cosmetics. Here, we report that 4'-methylflavonoids are potent inducers of melanogenesis in B16F10 melanoma cells and in mice. We recently identified salt inducible kinase 2 (SIK2) as an inhibitor of melanogenesis via the suppression of the cAMP-response element binding protein (CREB)-specific coactivator 1 (TORC1). Using an in vitro kinase assay targeting SIK2, we identified fisetin as a candidate inhibitor, possibly being capable of promoting melanogenesis. However, fisetin neither inhibited the CREB-inhibitory activity of SIK2 nor promoted melanogenesis in B16F10 melanoma cells. Conversely, mono-methyl-flavonoids, such as diosmetin (4'-O-metlylluteolin), efficiently inhibited SIK2 and promoted melanogenesis in this cell line. The cAMP-CREB system is impaired in A(y)/a mice and these mice have yellow hair as a result of pheomelanogenesis, while Sik2(+/-); A(y)/a mice also have yellow hair, but activate eumelanogenesis when they are exposed to CREB stimulators. Feeding Sik2(+/-); A(y)/a mice with diets supplemented with fisetin resulted in their hair color changing to brown, and metabolite analysis suggested the presence of mono-methylfisetin in their feces. Thus, we decided to synthesize 4'-O-methylfisetin (4'MF) and found that 4'MF strongly induced melanogenesis in B16F10 melanoma cells, which was accompanied by the nuclear translocation of TORC1, and the 4'-O-methylfisetin-induced melanogenic programs were inhibited by the overexpression of dominant negative TORC1. In conclusion, compounds that modulate SIK2 cascades are helpful to regulate melanogenesis via TORC1 without affecting cAMP levels, and the combined analysis of Sik2(+/-) mice and metabolites from these mice is an effective strategy to identify beneficial compounds to regulate CREB activity in vivo.

Adult onset cardiac dilatation in a transgenic mouse line with Galß1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy.

Sugar chain abnormalities in glycolipids and glycoproteins are associated with various diseases. Here, we report an adult onset cardiac dilatation in a transgenic mouse line with Galß1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes. The transgenic hearts at the end-stage, at around 7 months old, were enlarged, with enlarged cavities and thin, low-tensile walls, typical of dilated cardiomyopathy. Although no apparent change was found in heart gangliosides, glycosylation of heart proteins was altered. Interestingly, sugar moieties not directly related to the ST3Gal-II catalytic reaction were also changed. Significant increases in calreticulin and calnexin were observed in hearts of the transgenic mice. These results suggest that expression of ST3Gal-II transgenes induces abnormal protein glycosylation, which disorganizes the endoplasmic/sarcoplasmic reticulum quality control system and elevates the calreticulin/calnexin level, resulting in suppression of cardiac function. The transgenic mice showed 100% incidence of adult onset cardiac dilatation, suggesting great potential as a new model for dilated cardiomyopathy.

Use of sample mixtures for standard curve creation in quantitative western blots.

For accurate protein quantification when using quantitative western blot analysis with chemiluminescence reagents, standard curves are needed because of the narrow quantifiable ranges. However, they are often difficult to obtain because authentic proteins are not always available. Here we present our original and convenient method using a sample mixture as a scale to create standard curves. This method allowed us to determine the quantifiable range of target and loading control proteins, making quantitative comparisons among independent blots more reproducible. Our results indicate that using a sample mixture to create standard curves is a practical method that guarantees the accuracy and reproducibility of quantitative western blot analysis.

Role of insulin signaling in the interaction between Alzheimer disease and diabetes mellitus: a missing link to therapeutic potential.

Diabetes mellitus (DM) is one of the major non-genetic risk factors for Alzheimer disease (AD). However, the mechanism by which DM increases the risk of AD has not been elucidated. Here, we summarize recent findings to address this question. Whereas neuropathological studies in humans suggest that DM does not increase Aß accumulation in the brain (a major hallmark of AD), earlier works in animal models show that Aß does accumulate. Therefore, alternate mechanisms might exist. Recent studies using the human brain indicate that insulin signaling is impaired in the AD brain. In neurons, this insulin signaling plays a key role in modulating synaptic function and neuronal senescence besides regulating tau phosphorylation, another hallmark of AD. On the other hand, in cerebrovessels, DM causes vascular remodeling, which involves increased RAGE (receptor for advanced glycation endproducts) expression, and AD is associated with cerebrovascular amyloid angiopathy (CAA). Our recent study involving AD mice with DM has revealed that a vicious circle underlies the interaction between AD and DM. Interestingly, in our mouse model, AD increased RAGE expression, and DM worsened CAA. The contribution of vascular factors such as RAGE expression and CAA to the impairment of insulin signaling will be discussed. This impaired insulin signaling might be a possible link between AD and DM. Moreover, insulin signaling is also involved in the mechanism of aging, decreasing with an increase in age. An identification of the mechanism whereby DM modifies the pathological condition of AD through the modulation of insulin signaling is required to develop potential therapeutics for AD not only with but also without DM.

Increased globotriaosylceramide levels in a transgenic mouse expressing human alpha1,4-galactosyltransferase and a mouse model for treating Fabry disease.

Fabry disease is a lysosomal storage disorder caused by an α-galactosidase A (α-Gal A) deficiency and resulting in the accumulation of glycosphingolipids, predominantly globotriaosylceramide (Gb3). A transgenic mouse expressing the human α-Gal A R301Q mutant in an α-Gal A-knockout background (TgM/KO) should be useful for studying active-site-specific chaperone (ASSC) therapy for Fabry disease. However, the Gb3 content in the heart tissue of this mouse was too low to detect an ASSC-induced effect. To increase the Gb3 levels in mouse organs, we created transgenic mice (TgG3S) expressing human α1,4-galactosyltransferase (Gb3 synthase). High levels of Gb3 were observed in all major organs of the TgG3S mouse. A TgG3S (+/-)M(+/-)/KO mouse was prepared by cross-breeding the TgG3S and TgM/KO mice and the Gb3 content in the heart of the TgG3S(+/-)M(+/-)/KO mouse was 1.4 µg/mg protein, higher than in the TgM(+/-)/KO (<0.1 µg/mg protein). Treatment with an ASSC, 1-deoxygalactonojirimycin, caused a marked induction of α-Gal A activity and a concomitant reduction of the Gb3 content in the TgG3S(+/-) M(+/-)/KO mouse organs. These data indicated that the TgG3S(+/-) M(+/-)/KO mouse was suitable for studying ASSC therapy for Fabry disease, and that the TgG3S mouse would be useful for studying the effect of high Gb3 levels in mouse organs.

Diabetes-accelerated memory dysfunction via cerebrovascular inflammation and Abeta deposition in an Alzheimer mouse model with diabetes.

Recent epidemiological studies suggest that diabetes mellitus is a strong risk factor for Alzheimer disease. However, the underlying mechanisms remain largely unknown. In this study, to investigate the pathophysiological interaction between these diseases, we generated animal models that reflect the pathologic conditions of both diseases. We crossed Alzheimer transgenic mice (APP23) with two types of diabetic mice (ob/ob and NSY mice), and analyzed their metabolic and brain pathology. The onset of diabetes exacerbated Alzheimer-like cognitive dysfunction without an increase in brain amyloid-beta burden in double-mutant (APP(+)-ob/ob) mice. Notably, APP(+)-ob/ob mice showed cerebrovascular inflammation and severe amyloid angiopathy. Conversely, the cross-bred mice showed an accelerated diabetic phenotype compared with ob/ob mice, suggesting that Alzheimer amyloid pathology could aggravate diabetes. Similarly, APP(+)-NSY fusion mice showed more severe glucose intolerance compared with diabetic NSY mice. Furthermore, high-fat diet feeding induced severe memory deficits in APP(+)-NSY mice without an increase in brain amyloid-beta load. Here, we created Alzheimer mouse models with early onset of cognitive dysfunction. Cerebrovascular changes and alteration in brain insulin signaling might play a pivotal role in this relationship. These findings could provide insights into this intensely debated association.