Improving the Biological Properties of Thrombin-Binding Aptamer by Incorporation of 8-Bromo-2'-Deoxyguanosine and 2'-Substituted RNA Analogues.

Thrombin-binding aptamer (TBA) is one of the best-known G-quadruplex (G4)-forming aptamers. By adopting its peculiar chair-like G4 structure, TBA can efficiently bind to thrombin, thus producing an anticoagulant effect. The major limit to its therapeutic application is represented by its poor thermal and biological resistance. Therefore, numerous research studies have been focused on the design of TBA analogues with chemical modifications to improve its pharmacokinetic and pharmacodynamic properties. To maintain the functional recognition to protein surface on which TBA anticoagulant activity depends, it is essential to preserve the canonical antiparallel topology of the TBA quadruplex core. In this paper, we have designed three TBA variants with modified G-tetrads to evaluate the effects of nucleobase and sugar moiety chemical modifications on biological properties of TBA, preserving its chair-like G-quadruplex structure. All derivatives contain 8-bromo-2'-deoxyguanosine (GBr) in syn positions, while in the anti-positions, locked nucleic acid guanosine (GLNA) in the analogue TBABL, 2'-O-methylguanosine (GOMe) in TBABM, and 2'-F-riboguanosine (GF) in TBABF is present. CD (Circular Dichroism), CD melting, 1H-NMR (Nuclear Magnetic Resonance), and non-denaturing PAGE (Polyacrylamide Gel Electrophoresis), nuclease stability, prothrombin time (PT) and fibrinogen-clotting assays have been performed to investigate the structural and biological properties of these TBA analogues. The most interesting results have been obtained with TBABF, which revealed extraordinary thermal stability (Tm approximately 40 °C higher than that of TBA), anticoagulant activity almost doubled compared to the original aptamer, and, above all, a never-observed resistance to nucleases, as 50% of its G4 species was still present in 50% FBS at 24 h. These data indicate TBABF as one of the best TBA analogue ever designed and investigated, to the best of our knowledge, overcoming the main limitations to therapeutic applications of this aptamer.

Structural and Biological Features of G-Quadruplex Aptamers as Promising Inhibitors of the STAT3 Signaling Pathway.

In this paper, we investigate the structural and biological features of G-quadruplex (G4) aptamers as promising antiproliferative compounds affecting the STAT3 signalling pathway. Targeting the STAT3 protein through high-affinity ligands to reduce its levels or activity in cancer has noteworthy therapeutic potential. T40214 (STAT) [(G3C)4] is a G4 aptamer that can influence STAT3 biological outcomes in an efficient manner in several cancer cells. To explore the effects of an extra cytidine in second position and/or of single site-specific replacements of loop residues in generating aptamers that can affect the STAT3 biochemical pathway, a series of STAT and STATB [GCG2(CG3)3C] analogues containing a thymidine residue instead of cytidines was prepared. NMR, CD, UV, and PAGE data suggested that all derivatives adopt dimeric G4 structures like that of unmodified T40214 endowed with higher thermal stability, keeping the resistance in biological environments substantially unchanged, as shown by the nuclease stability assay. The antiproliferative activity of these ODNs was tested on both human prostate (DU145) and breast (MDA-MB-231) cancer cells. All derivatives showed similar antiproliferative activities on both cell lines, revealing a marked inhibition of proliferation, particularly at 72 h at 30 µM. Transcriptomic analysis aimed to evaluate STAT's and STATB's influence on the expression of many genes in MDA-MB-231 cells, suggested their potential involvement in STAT3 pathway modulation, and thus their interference in different biological processes. These data provide new tools to affect an interesting biochemical pathway and to develop novel anticancer and anti-inflammatory drugs.

Properties and Potential Antiproliferative Activity of Thrombin-Binding Aptamer (TBA) Derivatives with One or Two Additional G-Tetrads.

In this paper, we study the biological properties of two TBA analogs containing one and two extra G-tetrads, namely TBAG3 and TBAG4, respectively, and two further derivatives in which one of the small loops at the bottom (TBAG41S) or the large loop at the top (TBAG4GS) of the TBAG4 structure has been completely modified by replacing all loop residues with abasic site mimics. The therapeutical development of the TBA was hindered by its low thermodynamic and nuclease stability, while its potential as an anticancer/antiproliferative molecule is also affected by the anticoagulant activity, being a side effect in this case. In order to obtain suitable TBA analogs and to explore the involvement of specific aptamer regions in biological activity, the antiproliferative capability against DU 145 and MDAMB 231 cancer cell lines (MTT), the anticoagulant properties (PT), the biological degradability (nuclease stability assay) and nucleolin (NCL) binding ability (SPR) of the above described TBA derivatives have been tested. Interestingly, none of the TBA analogs exhibits an anticoagulant activity, while all of them show antiproliferative properties to the same extent. Furthermore, TBAG4 displays extraordinary nuclease stability and promising antiproliferative properties against breast cancer cells binding NCL efficiently. These results expand the range of G4-structures targeting NCL and the possibility of developing novel anticancer and antiviral drugs.

Antiproliferative Effects of the Aptamer d(GGGT)4 and Its Analogues with an Abasic-Site Mimic Loop on Different Cancer Cells.

In this paper, we study the T30923 antiproliferative potential and the contribution of its loop residues in six different human cancer cell lines by preparing five T30923 variants using the single residue replacement approach of loop thymidine with an abasic site mimic (S). G-rich oligonucleotides (GRO) show interesting anticancer properties because of their capability to adopt G-quadruplex structures (G4s), such as the G4 HIV-1 integrase inhibitor T30923. Considering the multi-targeted effects of G4-aptamers and the limited number of cancer cell lines tested, particularly for T30923, it should be important to find a suitable tumor line, in addition to considering that the effects also strictly depend on G4s. CD, NMR and non-denaturating polyacrylamide gel electrophoresis data clearly show that all modified ODNs closely resemble the dimeric structure of parallel G4s' parent aptamer, keeping the resistance in biological environments substantially unchanged, as shown by nuclease stability assay. The antiproliferative effects of T30923 and its variants are tried in vitro by MTT assays, showing interesting cytotoxic activity, depending on time and dose, for all G4s, especially in MDA-MB-231 cells with a reduction in cell viability approximately up to 30%. Among all derivatives, QS12 results are the most promising, showing more pronounced cytotoxic effects both in MDA-MB-231 and Hela cells, with a decrease in cell viability from 70% to 60%. In summary, the single loop residue S substitution approach may be useful for designing antiproliferative G4s, considering that most of them, characterized by single residue loops, may be able to bind different targets in several cancer cell pathways. Generally, this approach could be of benefit by revealing some minimal functional structures, stimulating further studies aimed at the development of novel anticancer drugs.

Discovering New G-Quadruplex DNA Catalysts in Enantioselective Sulfoxidation Reaction.

The natural human telomeric G-quadruplex (G4) sequence d(GGGTTAGGGTTAGGGTTAGGG) HT21 was extensively utilized as a G4 DNA-based catalytic system for enantioselective reactions. Nine oligonucleotides (ODNs) based on this sequence and containing 8-bromo-2'-deoxyadenosine (ABr), 8-oxo-2'-deoxyadenosine (Aoxo) or ß-L-2'-deoxyadenosine (AL) at different single loop positions were investigated to evaluate their performances as DNA catalysts in an enantioselective sulfoxidation reaction of thioanisole. The substitution of an adenosine in the loops of HT21 with these modified residues had a negligible impact on the G4 DNA structural features, thermal stability, and catalytic activity, since almost all investigated ODNs were able to form G-quadruplexes strictly resembling that of HT21 and catalyze a full conversion of the thioanisole substrate. More marked effects were obtained in chiral selectivity of G4 DNA metalloenzymes, considering that in most cases the DNA-modified catalysts induced lower enantioselectivities compared to the natural one. However, the HT21 derivative containing an AL residue in the first loop sequence significantly proved to be capable of producing about 84% enantiomeric excess, the highest enantioselectivity for DNA-based oxidation reaction to date.

Exploring New Potential Anticancer Activities of the G-Quadruplexes Formed by [(GTG2T(G3T)3] and Its Derivatives with an Abasic Site Replacing Single Thymidine.

In this paper, we report our investigations on five T30175 analogues, prepared by replacing sequence thymidines with abasic sites (S) one at a time, in comparison to their natural counterpart in order to evaluate their antiproliferative potential and the involvement of the residues not belonging to the central core of stacked guanosines in biological activity. The collected NMR (Nuclear Magnetic Resonance), CD (Circular Dichroism), and PAGE (Polyacrylamide Gel Electrophoresis) data strongly suggest that all of them adopt G-quadruplex (G4) structures strictly similar to that of the parent aptamer with the ability to fold into a dimeric structure composed of two identical G-quadruplexes, each characterized by parallel strands, three all-anti-G-tetrads and four one-thymidine loops (one bulge and three propeller loops). Furthermore, their antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against lung and colorectal cancer cells were tested. Although all of the oligodeoxynucleotides (ODNs) investigated here exhibited anti-proliferative activity, the unmodified T30175 aptamer showed the greatest effect on cell growth, suggesting that both its characteristic folding in dimeric form and its presence in the sequence of all thymidines are crucial elements for antiproliferative activity. This straightforward approach is suitable for understanding the critical requirements of the G-quadruplex structures that affect antiproliferative potential and suggests its application as a starting point to facilitate the reasonable development of G-quadruplexes with improved anticancer properties.

Aptamers against the ß-Conglutin Allergen: Insights into the Behavior of the Shortest Multimeric (Intra)Molecular DNA G-Quadruplex.

In previous work, a 93-mer aptamer was selected against the anaphylactic allergen, ß-conglutin and truncated to an 11-mer, improving the affinity by two orders of magnitude, whilst maintaining the specificity. This 11-mer was observed to fold in a G-quadruplex, and preliminary results indicated the existence of a combination of monomeric and higher-order structures. Building on this previous work, in the current study, we aimed to elucidate a deeper understanding of the structural forms of this 11-mer and the effect of the structure on its binding ability. A battery of techniques including polyacrylamide gel electrophoresis, high-performance liquid chromatography in combination with electrospray ionization time-of-flight mass spectrometry, matrix-assisted laser desorption/ionization time-of-flight, thermal binding analysis, circular dichroism and nuclear magnetic resonance were used to probe the structure of both the 11-mer and the 11-mer flanked with TT- at either the 5' or 3' end or at both ends. The TT-tail at the 5' end hinders stacking effects and effectively enforces the 11-mer to maintain a monomeric form. The 11-mer and the TT- derivatives of the 11-mer were also evaluated for their ability to bind its cognate target using microscale thermophoresis and surface plasmon resonance, and biolayer interferometry confirmed the nanomolar affinity of the 11-mer. All the techniques utilized confirmed that the 11-mer was found to exist in a combination of monomeric and higher-order structures, and that independent of the structural form present, nanomolar affinity was observed.

Structural properties and anticoagulant/cytotoxic activities of heterochiral enantiomeric thrombin binding aptamer (TBA) derivatives.

The thrombin binding aptamer (TBA) possesses promising antiproliferative properties. However, its development as an anticancer agent is drastically impaired by its concomitant anticoagulant activity. Therefore, suitable chemical modifications in the TBA sequence would be required in order to preserve its antiproliferative over anticoagulant activity. In this paper, we report structural investigations, based on circular dichroism (CD) and nuclear magnetic resonance spectroscopy (NMR), and biological evaluation of four pairs of enantiomeric heterochiral TBA analogues. The four TBA derivatives of the d-series are composed by d-residues except for one l-thymidine in the small TT loops, while their four enantiomers are composed by l-residues except for one d-thymidine in the same TT loop region. Apart from the left-handedness for the l-series TBA derivatives, CD and NMR measurements have shown that all TBA analogues are able to adopt the antiparallel, monomolecular, 'chair-like' G-quadruplex structure characteristic of the natural D-TBA. However, although all eight TBA derivatives are endowed with remarkable cytotoxic activities against colon and lung cancer cell lines, only TBA derivatives of the l-series show no anticoagulant activity and are considerably resistant in biological environments.

Novel monomolecular derivatives of the anti-HIV-1 G-quadruplex-forming Hotoda's aptamer containing inversion of polarity sites.

Here we report on the design, preparation and investigation of four analogues of the anti-HIV G-quadruplex-forming Hotoda's aptamer, based on an unprecedented linear topology. In these derivatives, four TGGGAGT tracts have been joined together by exploiting 3'-3' and 5'-5' inversion of polarity sites formed by canonical phosphodiester bonds or a glycerol-based linker. Circular dichroism data suggest that all oligodeoxynucleotides fold in monomolecular G-quadruplex structures characterized by a parallel strand orientation and three side loops connecting 3'- or 5'-ends. The derivative bearing two lipophilic groups, namely HT353LGly, inhibited virus entry into the host cell, with anti-HIV-1 activity in the low nanomolar range; the other derivatives, albeit sharing the same base sequence and similar topology, were inactive. These results highlight that monomolecular Hotoda's aptamers with inversion of polarity sites represent a successful alternative strategy that merges the easiness of synthesis with the maintenance of remarkable activity. They also indicate that two lipophilic groups are necessary and sufficient for biological activity. Our data will inspire the design of further simplified derivatives with improved biophysical and antiviral properties.

Probing the Importance of the G-Quadruplex Grooves for the Activity of the Anti-HIV-Integrase Aptamer T30923.

In this paper, we report studies concerning four variants of the G-quadruplex forming anti-HIV-integrase aptamer T30923, in which specific 2'-deoxyguanosines have been singly replaced by 8-methyl-2'-deoxyguanosine residues, with the aim to exploit the methyl group positioned in the G-quadruplex grooves as a steric probe to investigate the interaction aptamer/target. Although, the various modified aptamers differ in the localization of the methyl group, NMR, circular dichroism (CD), electrophoretic and molecular modeling data suggest that all of them preserve the ability to fold in a stable dimeric parallel G-quadruplex complex resembling that of their natural counterpart T30923. However, the biological data have shown that the T30923 variants are characterized by different efficiencies in inhibiting the HIV-integrase, thus suggesting the involvement of the G-quadruplex grooves in the aptamer/target interaction.

uL3 Mediated Nucleolar Stress Pathway as a New Mechanism of Action of Antiproliferative G-quadruplex TBA Derivatives in Colon Cancer Cells.

The antiproliferative G-quadruplex aptamers are a promising and challenging subject in the framework of the anticancer therapeutic oligonucleotides research field. Although several antiproliferative G-quadruplex aptamers have been identified and proven to be effective on different cancer cell lines, their mechanism of action is still unexplored. We have recently described the antiproliferative activity of a heterochiral thrombin binding aptamer (TBA) derivative, namely, LQ1. Here, we investigate the molecular mechanisms of LQ1 activity and the structural and antiproliferative properties of two further TBA derivatives, differing from LQ1 only by the small loop base-compositions. We demonstrate that in p53 deleted colon cancer cells, LQ1 causes nucleolar stress, impairs ribosomal RNA processing, leading to the accumulation of pre-ribosomal RNAs, arrests cells in the G2/M phase and induces early apoptosis. Importantly, the depletion of uL3 abrogates all these effects, indicating that uL3 is a crucial player in the mechanism of action of LQ1. Taken together, our findings identify p53-independent and uL3-dependent nucleolar stress as a novel stress response pathway activated by a specific G-quadruplex TBA derivative. To the best of our knowledge, this investigation reveals, for the first time, the involvement of the nucleolar stress pathway in the mechanism of action of antiproliferative G-quadruplex aptamers.

Improved performances of catalytic G-quadruplexes (G4-DNAzymes) via the chemical modifications of the DNA backbone to provide G-quadruplexes with double 3'-external G-quartets.

Here we report on the design of a new catalytic G-quadruplex-DNA system (G4-DNAzyme) based on the modification of the DNA scaffold to provide the DNA pre-catalyst with two identical 3'-ends, known to be more catalytically proficient than the 5'-ends. To this end, we introduced a 5'-5' inversion of polarity site in the middle of the G4-forming sequences AG4A and AG6A to obtain d(3'AGG5'-5'GGA3') (or AG2-G2A) and d(3'AGGG5'-5'GGGA3') (or AG3-G3A) that fold into stable G4 whose tetramolecular nature was confirmed via nuclear magnetic resonance (NMR) and circular dichroism (CD) investigations. Both AG2-G2A and AG3-G3A display two identical external G-quartets (3'-ends) known to interact with the cofactor hemin with a high efficiency, making the resulting complex competent to perform hemoprotein-like catalysis (G4-DNAzyme). A systematic comparison of the performances of modified and unmodified G4s lends credence to the relevance of the modification exploited here (5'-5' inversion of polarity site), which represents a new chemical opportunity to improve the overall activity of catalytic G4s.

Investigating the properties of TBA variants with twin thrombin binding domains.

In this paper, we report studies concerning thrombin binding aptamer (TBA) dimeric derivatives in which the 3'-ends of two TBA sequences have been joined by means of linkers containing adenosine or thymidine residues and/or a glycerol moiety. CD and electrophoretic investigations indicate that all modified aptamers are able to form G-quadruplex domains resembling that of the parent TBA structure. However, isothermal titration calorimetry measurements of the aptamer/thrombin interaction point to different affinities to the target protein, depending on the type of linker. Consistently, the best ligands for thrombin show anticoagulant activities higher than TBA. Interestingly, two dimeric aptamers with the most promising properties also show far higher resistances in biological environment than TBA.

miR-125b Upregulates miR-34a and Sequentially Activates Stress Adaption and Cell Death Mechanisms in Multiple Myeloma.

miR-125b, ubiquitously expressed and frequently dysregulated in several tumors, has gained special interest in the field of cancer research, displaying either oncogenic or oncosuppressor potential based on tumor type. We have previously demonstrated its tumor-suppressive role in multiple myeloma (MM), but the analysis of molecular mechanisms needs additional investigation. The purpose of this study was to explore the effects of miR-125b and its chemically modified analogs in modulating cell viability and cancer-associated molecular pathways, also focusing on the functional aspects of stress adaptation (autophagy and senescence), as well as programmed cell death (apoptosis). Based on the well-known low microRNA (miRNA) stability in therapeutic application, we designed chemically modified miR-125b mimics, laying the bases for their subsequent investigation in in vivo models. Our study clearly confirmed an oncosuppressive function depending on the repression of multiple targets, and it allowed the identification, for the first time, of miR-125b-dependent miR-34a stimulation as a possible consequence of the inhibitory role on the interleukin-6 receptor (IL-6R)/signal transducer and activator of transcription 3 (STAT3)/miR-34a feedback loop. Moreover, we identified a pattern of miR-125b-co-regulated miRNAs, shedding light on possible new players of anti-MM activity. Finally, functional studies also revealed a sequential activation of senescence, autophagy, and apoptosis, thus indicating, for the first two processes, an early cytoprotective and inhibitory role from apoptosis activation.

Human AP-endonuclease (Ape1) activity on telomeric G4 structures is modulated by acetylatable lysine residues in the N-terminal sequence.

Loss of telomeres stability is a hallmark of cancer cells. Exposed telomeres are prone to aberrant end-joining reactions leading to chromosomal fusions and translocations. Human telomeres contain repeated TTAGGG elements, in which the 3' exposed strand may adopt a G-quadruplex (G4) structure. The guanine-rich regions of telomeres are hotspots for oxidation forming 8-oxoguanine, a lesion that is handled by the base excision repair (BER) pathway. One key player of this pathway is Ape1, the main human endonuclease processing abasic sites. Recent evidences showed an important role for Ape1 in telomeric physiology, but the molecular details regulating Ape1 enzymatic activities on G4-telomeric sequences are lacking. Through a combination of in vitro assays, we demonstrate that Ape1 can bind and process different G4 structures and that this interaction involves specific acetylatable lysine residues (i.e. K27/31/32/35) present in the unstructured N-terminal sequence of the protein. The cleavage of an abasic site located in a G4 structure by Ape1 depends on the DNA conformation or the position of the lesion and on electrostatic interactions between the protein and the nucleic acids. Moreover, Ape1 mutants mimicking the acetylated protein display increased cleavage activity for abasic sites. We found that nucleophosmin (NPM1), which binds the N-terminal sequence of Ape1, plays a role in modulating telomere length and Ape1 activity at abasic G4 structures. Thus, the Ape1 N-terminal sequence is an important relay site for regulating the enzyme's activity on G4-telomeric sequences, and specific acetylatable lysine residues constitute key regulatory sites of Ape1 enzymatic activity dynamics at telomeres.

Structural studies and biological evaluation of T30695 variants modified with single chiral glycerol-T reveal the importance of LEDGF/p75 for the aptamer anti-HIV-integrase activities.

Some G-quadruplex (GQ) forming aptamers, such as T30695, exhibit particularly promising properties among the potential anti-HIV drugs. T30695 G-quadruplex binds to HIV-1 integrase (IN) and inhibits its activity during 3'-end processing at nanomolar concentrations. Herein we report a study concerning six T30695-GQ variants, in which the R or S chiral glycerol T, singly replaced the thymine residues at the T30695 G-quadruplex loops. CD melting, EMSA and HMRS experiments provided information about the thermal stability and the stoichiometry of T30695-GQ variants, whereas CD and 1H NMR studies were performed to evaluate the effects of the modifications on T30695-GQ topology. Furthermore, LEDGF/p75 dependent and independent integration assays were carried out to evaluate how T loop modifications impact T30695-GQ biological activities. The obtained results showed that LEDGF/p75 adversely affects the potencies of T30695 and its variants. The IN inhibitory activities of the modified aptamers also depended on the position and on the chirality (R or S) of glycerol T loop in the GQ, mostly regardless of the G-quadruplex stabilities. In view of our and literature data, we suggest that the allosteric modulation of IN tetramer conformations by LEDGF/p75 alters the interactions between the aptamers and the enzyme. Therefore, the new T30695 variants could be suitable tools in studies aimed to clarify the HIV-1 IN tetramers allostery and its role in the integration activity.

Thrombin binding aptamer analogues containing inversion of polarity sites endowed with antiproliferative and anti-motility properties against Calu-6 cells.

BACKGROUND: Although the thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative properties, it is possible to reduce the first and enhance the second one by suitable chemical modifications. METHODS: Two oligonucleotides (TBA353 and TBA535) based on the TBA sequence (GGTTGGTGTGGTTGG) and containing inversion of polarity sites have been investigated by CD, UV and electrophoretic techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay), antiproliferative (MTT assay) and anti-motility (wound healing assay) properties against Calu-6 cells have been tested and compared with TBA. RESULTS: CD, UV and electrophoresis data indicate that both ODNs are able to form G-quadruplex structures. Particularly, results suggest that TBA535 adopts a G-quadruplex structure characterized by a loop arrangement different from that of TBA. Both TBA analogues drop the anticoagulant activity. However, TBA535 is endowed with a significant antiproliferative activity against lung cancer Calu-6 cells. Importantly, both TBA and TBA535 possess a remarkable anti-motility property against the same cell line. CONCLUSIONS: Both TBA analogues TBA353 and TBA535 are able to form G-quadruplex structures with no anticoagulant activity. However only TBA535 is endowed with noteworthy antiproliferative and anti-motility properties against lung cancer Calu-6 cells. GENERAL SIGNIFICANCE: The switching from the anticoagulant to antiproliferative property can be obtained also in TBA derivatives not adopting the "chair-like" G-quadruplex structure typical of TBA. Furthermore, results have highlighted an unprecedented anti-cell-motility property of TBA and TBA535 reinforcing the potential of these ODNs as anticancer drugs.

Improvement of the activity of the anti-HIV-1 integrase aptamer T30175 by introducing a modified thymidine into the loops.

In this paper, we report our investigations on analogues of the anti-human immunodeficiency virus type 1 (HIV-1) integrase (IN) aptamer T30175 in which the individual thymidines forming the loops were replaced by 5-hydroxymethyl-2'-deoxyuridine residues (H). Circular dichroism, nuclear magnetic resonance and gel electrophoresis investigations clearly indicated that all the modified aptamers preserve the ability to form the original 5'-5' end-stacked head-to-head dimeric G-quadruplex structure, in which each G-quadruplex adopts a parallel arrangement and is characterized by three G-tetrads, three propeller loops and one bulge-loop. All the modified aptamers were tested in an IN inhibition LEDGF-independent assay. While the modified aptamers INTB-H13 and INTB-H17 showed IC50 values comparable with that of the parent aptamer (INTB-nat), analogues INTB-H2, INTB-H5 and, to a lesser extent, INTB-H9 showed a higher ability to inhibit the HIV IN than the unmodified aptamer. Molecular modelling studies evaluating the aptamer/HIV IN interaction highlighted the ability of the modified thymidines to establish several contacts with the target protein. All the data point to the importance of loops in the aptamer/target interaction and suggest that the site-specific replacement of loop residues with commercially available analogues can be considered a straightforward strategy to improve the biological activities of several G-quadruplex aptamers.

Metastatic group 3 medulloblastoma is driven by PRUNE1 targeting NME1-TGF-ß-OTX2-SNAIL via PTEN inhibition.

Genetic modifications during development of paediatric groups 3 and 4 medulloblastoma are responsible for their highly metastatic properties and poor patient survival rates. PRUNE1 is highly expressed in metastatic medulloblastoma group 3, which is characterized by TGF-ß signalling activation, c-MYC amplification, and OTX2 expression. We describe the process of activation of the PRUNE1 signalling pathway that includes its binding to NME1, TGF-ß activation, OTX2 upregulation, SNAIL (SNAI1) upregulation, and PTEN inhibition. The newly identified small molecule pyrimido-pyrimidine derivative AA7.1 enhances PRUNE1 degradation, inhibits this activation network, and augments PTEN expression. Both AA7.1 and a competitive permeable peptide that impairs PRUNE1/NME1 complex formation, impair tumour growth and metastatic dissemination in orthotopic xenograft models with a metastatic medulloblastoma group 3 cell line (D425-Med cells). Using whole exome sequencing technology in metastatic medulloblastoma primary tumour cells, we also define 23 common 'non-synonymous homozygous' deleterious gene variants as part of the protein molecular network of relevance for metastatic processes. This PRUNE1/TGF-ß/OTX2/PTEN axis, together with the medulloblastoma-driver mutations, is of relevance for future rational and targeted therapies for metastatic medulloblastoma group 3.10.1093/brain/awy039_video1awy039media15742053534001.

The "Janus face" of the thrombin binding aptamer: Investigating the anticoagulant and antiproliferative properties through straightforward chemical modifications.

BACKGROUND: The thrombin binding aptamer (TBA) is endowed with both anticoagulant and antiproliferative activities. Its chemico-physical and/or biological properties can be tuned by the site-specific replacement of selected residues. METHODS: Four oligodeoxynucleotides (ODNs) based on the TBA sequence (5'-GGTTGGTGTGGTTGG-3') and containing 2'-deoxyuridine (U) or 5-bromo-2'-deoxyuridine (B) residues at positions 4 or 13 have been investigated by NMR and CD techniques. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay) have been tested and compared with two further ODNs containing 5-hydroxymethyl-2'-deoxyuridine (H) residues in the same positions, previously investigated. RESULTS: The CD and NMR data suggest that all the investigated ODNs are able to form G-quadruplexes strictly resembling that of TBA. The introduction of B residues in positions 4 or 13 increases the melting temperature of the modified aptamers by 7 °C. The replacement of thymidines with U in the same positions results in an enhanced anticoagulant activity compared to TBA, also at low ODN concentration. Although all ODNs show antiproliferative properties, only TBA derivatives containing H in the positions 4 and 13 lose the anticoagulant activity and remarkably preserve the antiproliferative one. CONCLUSIONS: All ODNs have shown antiproliferative activities against two cancer cell lines but only those with U and B are endowed with anticoagulant activities similar or improved compared to TBA. GENERAL SIGNIFICANCE: The appropriate site-specific replacement of the residues in the TT loops of TBA with commercially available thymine analogues is a useful strategy either to improve the anticoagulant activity or to preserve the antiproliferative properties by quenching the anticoagulant ones.