Prevalence of Mental Disorders among Older People in Nepal: A Systematic Review.

Background There has been limited research into the prevalence of mental disorders amongst older adults in developing countries. Developing countries such as Nepal are undergoing significant demographic changes with an increasing number and proportion of older persons. Objective This systematic review reports the prevalence of mental health disorders amongst the elderly in Nepal. Method Databases searched were PubMed, CINAHL, Scopus and PsycINFO. A hand search for relevant articles appearing in reference lists and previously identified research was also undertaken. Result Of the 26 studies (32 articles) included most were community and aged-care home -based studies measuring depression. The prevalence of depressive symptom cases ranged from 25.5% to 60.6% in the community, 17.3% to 89.1% in aged-care facilities and 53.2% to 57.1% in hospital settings. The prevalence of depressive disorders in similar settings varied between 4.4% (in community) to 53.2% (in hospital). The prevalence of anxiety symptom cases ranged from 21.7% to 32.3%. Psychosis, alcohol dependence and dementia were other identified disorders amongst the elderly. Disordered symptom cases are more prevalent in aged-care facilities than in community settings and mental disorders are higher for hospital-based studies compared to community settings. Conclusion This review identified a higher prevalence of depression amongst the elderly in Nepal compared to studies conducted in developed countries. The high rates of reported prevalence among the elderly warrant the need to develop more effective public health and welfare approaches to prevent, treat and manage the mental disorders among this vulnerable population.

Critical care polyneuropathy in burn injuries: An integrative review.

Polyneuropathy is a debilitating condition which may be associated with large burns. The aim of this integrative review is to identify factors that contribute to the development of critical care polyneuropathy in patients admitted to an intensive care unit with a severe burn injury. PubMed, Scopus, CINHAL and EMBASE were searched up until July 2016. Studies/case reports focusing on critical care polyneuropathy for burn injured patients were included. The ten studies, included a total of 2755 burns subjects and identified 128 critical care polyneuropathy patients with an incidence of 4.4%. Three case reports identified prolonged ventilation and development of critical care neuropathy. Overall, factors identified as contributing to the development of critical care polyneuropathy in burn injured patients included prolonged ventilation (>7 days), large and deep total body surface area burns (mean TBSA 40%), and sepsis. Critical care polyneuropathy in burn patients remains challenging to diagnose and treat. To date, there is a lack of long term studies describing the impact of critical care polyneuropathy on functional performance or participation in activities of daily living in the burns population and this is consistent with the general literature addressing the lack of follow up assessments and long term consequences of persistent muscle weakness.

[Detection of anti-ENA autoantibodies in patients with systemic connective tissue diseases. Analytical variability and diagnostic sensitivity of 4 methods]. / La determinazione degli autoanticorpi anti-ENA in pazienti con connettivite sistemica. Variabilità analitica e sensibilità diagnostica di quattro metodi.

This study was designed to assess the analytical sensitivity and rate of agreement between commercial methods and reagents, among the most used in Italy for the detection of autoantibodies to extractable nuclear antigens (ENA). Sixty-eight serum samples from patients with clinically diagnosed systemic rheumatic diseases were aliquoted and distributed to 4 hospital laboratories; three ELISA (Elias, Shield, Inova) and 1 immunoblot method (Euroimmun) were used. Overall agreement between the test reagents, for each anti-ENA specificity, was 69.1% for Ro/SSA, 83.3% for La/SSB, 70.6% for RNP, 73.5% for Sm, 91.1% for Jo1, and 82.3% for Scl70. Lack of specificity (i.e., false positive reactions) was the most important cause of low concordance. When the data were analysed according to the clinical diagnosis, total agreement and specificity improved. However, a significant difference in terms of sensitivity was observed in the SLE group (30 sera) for RNP (positivity ranged from 20% to 43%) and for Sm (from 7% to 37%), and in the Sjögren's syndrome group (13 sera) for anti-La/SSB (from 8% to 38%). Comparable data were obtained for anti-Ro/SSA (from 70% to 77%) both in the SLE and the Sjögren's syndrome group. Sensitivity of all 4 reagents was good in detecting anti-Scl70 autoantibodies in the 8 patients with diffuse systemic sclerosis, as well as anti-Jo1 autoantibody in the 5 polymyositis patients, with a 100% and a 95% agreement, respectively. These data suggest the need of a better standardization of commercial reagents and analytical procedures, and the opportunity that every laboratory should perform anti-ENA determination by at least two different methods, since none of the methods tested was completely reliable in detecting all anti-ENA autoantibody specificities.

C1-esterase inhibitor transfusions in patients with hereditary angioedema.

BACKGROUND: Hereditary angioedema results from the deficiency of C1-esterase inhibitor (C1-INH), and C1-INH replacement would represent definitive treatment for angioedema attacks. In Canada, C1-INH is available only on a compassionate basis at select medical facilities. Our objective is to assess the efficacy of C1-INH transfusions during angioedema attacks at a single Canadian institution. METHODS: A retrospective chart review of transfusion data between January 1, 1995 and June 30, 1996 was performed. Phone interviews with patients elicited their opinions of the treatment. Data collected included the number and duration of angioedema attacks, dose of transfused C1-INH, and side effects of treatment. RESULTS: Of a cohort of 13 patients with hereditary angioedema, seven received transfusions with C1-INH. Attacks totaled 87, and more than 100,000 units of the product were transfused. The mean time for abatement of an attack after initiation of transfusion was 50 +/- 8 minutes (1 SD). There were no reports of adverse effects. Although patients were satisfied with the treatment, they raised concerns regarding long-term safety and availability. CONCLUSIONS: C1-INH transfusion is a satisfactory means of treating angioedema attacks.

Generation and statistical mechanical modeling of Z-DNA in the mouse metallothionein I promoter.

The mouse metallothionein I promoter has a potential Z-DNA sequence 86-102 bases upstream from the transcription start. The alternating purine/pyrimidine nature of this sequence, d-(GCGCGTGACTATGCGTG), is interrupted by a central d(AC) dinucleotide. We reversed the d(AC) to d(CA) by site-directed mutagenesis and subcloned the wild-type and mutated 218 base pair (bp) SstI-BglII fragment containing this region into pUC12. By two-dimensional chloroquine gel analysis, the mutant promoter clearly underwent a B-Z transition with a resulting loss of at least five twists. Purines within this sequence exhibited diethyl pyrocarbonate (DEP) sensitivity, which extended in both the 5' and 3' direction encompassing a region of approximately 32 base pairs. When subjected to sufficient torsional stress, the wild-type sequence showed weak evidence of a transition on chloroquine gels and clear DEP sensitivity with a similar, yet distinct pattern. Statistical mechanical modeling of the chloroquine gel analysis demonstrated that the average free energy of propagation for the mutant sequence (0.7-0.9 kcal mol-1 bp-1) was approximately twice that for d(CG)n sequences and that the sequence d(GACGCGGGGCGCGTGCATATGCGTGG) forms the core Z-DNA region.