Chronic hypoxia promotes an aggressive phenotype in rat prostate cancer cells.

In general, tumors cells that are resistant to apoptosis and increase angiogenesis are a result of the hypoxic responses contributing to the malignant phenotype. In this study, we developed a chronic hypoxic cell model (HMLL), by incubating the prostate cancer MatLyLu cells in a hypoxic chamber (1% O(2)) over 3 weeks. Surviving cells were selected through each cell passage and were grown in the hypoxic condition up to 8 weeks. This strategy resulted in survival of only 5% of the cells. The surviving hypoxic cells displayed a greater stimulation on hypoxic adaptive response, including a greater expression of glucose transporter1 (Glut1) and VEGF secretion. In addition, higher invasion activity was observed in the chronic hypoxic HMLL cells as compared to MatLyLu cells exposed to acute hypoxia (1% O(2), 5 h) using the matrigel assay. To further examine the role of HIF-1alpha in tumor progression, both MatLyLu and HMLL cells were transfected with dominant-negative form of HIF-1alpha (DNHIF-1alpha). The Matrigel invasion activity induced by chronic hypoxia was significantly attenuated by DNHIF-1alpha. These results suggest that signaling pathways leading to hypoxic response may be differentially regulated in chronic hypoxic cells and acute hypoxic cells. Chronic hypoxia may play a greater role than acute hypoxia in promoting the aggressive phenotype of tumor cells. This observation mimics the clinical scenario where tumor cells following treatment with radiation are subjected to hypoxic conditions. The reemergence of tumor following treatment usually results in tumor cells that are more aggressive and metastatic.

Overexpression of manganese superoxide dismutase promotes the survival of prostate cancer cells exposed to hyperthermia.

It has been hypothesized that exposure of cells to hyperthermia results in an increased flux of reactive oxygen species (ROS), primarily superoxide anion radicals, and that increasing antioxidant enzyme levels will result in protection of cells from the toxicity of these ROS. In this study, the prostate cancer cell line, PC-3, and its manganese superoxide dismutase (MnSOD)-overexpressing clones were subjected to hyperthermia (43 degrees C, 1 h). Increased expression of MnSOD increased the mitochondrial membrane potential (MMP). Hyperthermic exposure of PC-3 cells resulted in increased ROS production, as determined by aconitase inactivation, lipid peroxidation, and H2O2 formation with a reduction in cell survival. In contrast, PC-3 cells overexpressing MnSOD had less ROS production, less lipid peroxidation, and greater cell survival compared to PC-3 Wt cells. Since MnSOD removes superoxide, these results suggest that superoxide free radical or its reaction products are responsible for part of the cytotoxicity associated with hyperthermia and that MnSOD can reduce cellular injury and thereby enhance heat tolerance.

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides.

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.

Phospholipid hydroperoxide glutathione peroxidase induces a delay in G1 of the cell cycle.

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) is an antioxidant enzyme that reduces cellular phospholipid hydroperoxides (PLOOHs) to alcohols. Cellular peroxide tone has been implicated in cell growth and differentiation. By reducing the PLOOH level in the cell membrane, PhGPx regulates the peroxide tone and thereby might be involved in cell growth. We hypothesized that overexpression of PhGPx in human breast cancer cells would decrease their growth rate. We stably transfected MCF-7 cells (Wt) with L-PhGPx and measured cell doubling time, plating efficiency, and cell cycle phase transit times. P-4 cells (8-fold increase in PhGPx activity) showed a 2-fold increase in doubling time; doubling time increased directly with PhGPx activity (r = 0.95). The higher the PhGPx activity, the lower the plating efficiency (r = -0.86). The profile of other antioxidant enzymes was unchanged. Overexpression of PhGPx lowered the steady-state level of PLOOH (by > 60%). Results from bromodeoxyuridine pulse-chase experiments and flow cytometry indicate that PhGPx induced a delay in MCF-7 proliferation that was primarily due to a slower progression from G1 to S. These results support the hypothesis that PhGPx plays a regulatory role in the progression of MCF-7 cells from G1 to S possibly by regulating the steady-state levels of PLOOH. These data suggest that PhGPx can lower the peroxide tone, which might change the cellular redox environment resulting in a delay in G1 transit. Thus, PhGPx could be an important factor in cell growth.

Up-regulation of Hsp27 plays a role in the resistance of human colon carcinoma HT29 cells to photooxidative stress.

The Photofrin-resistant cell line (HT29-P14) was used in the present study to investigate the mechanism(s) involved in Photofrin-mediated photodynamic therapy (PDT). We compared gene expression profiles between the resistant cell line and its parental cell line (HT29) using DNA microarray analysis. A significant up-regulation of small heat shock protein 27 (Hsp27) was found in HT29-P14 cells. The elevated Hsp27 level may play an important role in the resistance of HT29-P14 to Photofrin-PDT. To test this hypothesis, we stably transfected HT29 cells with human Hsp27 complementary DNA. The potential role of Hsp27 in the resistance to PDT was examined in Hsp27-overexpressing cells. Stable trasnfected cells (H13) showed an increased survival after Photofrin-PDT, suggesting that the up-regulation of Hsp27 is related to the induced resistance to Photofrin-PDT. Phosphorylation of Hsp27 has been suggested to play an important role in cytoprotection. We have examined the phosphorylation activity of Hsp27 among the parental and resistant cells, as well as the overexpression cells. An elevated level of Hsp27 resulted in an increased ability of phosphorylation in both resistant and overexpressing cells after PDT. The activation of the phosphorylation of Hsp27 induced by PDT was not mediated by the p38 mitogen-activated protein kinase. These data suggest that Hsp27 may play an important role in mediating the adaptive response to Photofrin-PDT-induced oxidative stress and that the pathways leading to Hsp27 phosphorylation may contribute to the resistance of the cells to photooxidative damage.

Comparing beta-carotene, vitamin E and nitric oxide as membrane antioxidants.

Singlet oxygen initiates lipid peroxidation via a nonfree radical mechanism by reacting directly with unsaturated lipids to form lipid hydroperoxides (LOOHs). These LOOHs can initiate free radical chain reactions leading to membrane leakage and cell death. Here we compare the ability and mechanism by which three small-molecule membrane antioxidants (beta-carotene, alpha-tocopherol and nitric oxide) inhibit lipid peroxidation in membranes. We demonstrate that beta-carotene provides protection against singlet oxygen-mediated lipid peroxidation, but does not slow free radical-mediated lipid peroxidation. Alpha-Tocopherol does not protect cells from singlet oxygen, but does inhibit free radical formation in cell membranes. Nitric oxide provides no direct protection against singlet oxygen exposure, but is an exceptional chain-breaking antioxidant as evident from its ability to blunt oxygen consumption during free radical-mediated lipid peroxidation. These three small-molecule antioxidants appear to have complementary mechanisms for the protection of cell membranes from detrimental oxidations.