Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 257
Filtrar
1.
Plant Dis ; 2024 Sep 05.
Artigo em Inglês | MEDLINE | ID: mdl-39235411

RESUMO

Tomatoes (Solanum lycopersicum L.), as a significant solanaceous crop, have attracted global research interest focused on elucidating its plant virus incidence, epidemiology, and pathogenicity, especially in field production (Li et al. 2021; Rivarez et al. 2023). Tobacco vein banding mosaic virus (TVBMV) is classified in the genus Potyvirus. Since its discovery, TVBMV has been documented to infect tobacco, potato, jimsonweed, wild eggplant under nature conditions (Wang et al. 2017). Also, TVBMV could be transmitted to tomatoes by aphids (Myzus persicae) in laboratory conditions (Bi et al. 2020). However, to date, there is no sequence representing TVBMV infecting tomato deposited in NCBI nucleotide database. In August 2023, about 30% of tomato planted in an open field showing typical viral disease symptoms (chlorosis, yellowing, mosaic, curling, and mottling) in Dali, Yunnan, China. To identify the potential pathogen, about 9 symptomatic leave from different plants were collected, pooled and sent for high-throughput sequencing. In summary, total RNA was extracted using TRIzol® Reagent (Invitrogen, CA, USA). Subsequently, RNA sequencing libraries were constructed using the TruSeq RNA sample prep kit (Illumina, CA, USA), followed by RNA-Seq sequencing performed on an Illumina HiSeq4000 platform (LC Sciences, USA). A total of 71,368,934 raw reads (paired-end) of the length 150-bp were generated. After quality control, 69,746,872 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs (ranging from 186 nt to 15,573 nt) were searched against the NCBI non-redundant protein (NR) to detect potential viral pathogens using BLASTx with a cutoff e-value of 10-5. As a result, 2 viral contigs were assigned to 2 known viruses: TVBMV (Depth: 1960X, BLASTn similarity: 95.26%) and chilli veinal mottle virus (ChiVMV) (Depth: 3581X, BLASTn similarity: 98.22%). No other viruses and viroids were detected. The presence of TVBMV and ChiVMV were tested positive in all of the 9 samples originally collected. Notably, the detection primer for TVBMV identified in tomato (TVBMV-tomato) was designed from the newly assembled TVBMV genome (Forward: 5'- CTCGGTGAGGAAGGTGACATAAGT'; Reverse: 5'- CTTTCAACACCAGGGAATCTAGTG -3'). The nearly complete genome sequence of TVBMV-tomato was validated by overlapping RT-PCR and submitted to NCBI nucleotide database (accession: PP848192). To assess TVBMV-tomato infectivity, symptomatic tomato leaf sap was mechanically inoculated onto 4 healthy tomatoes, with healthy tomato leaf sap serving as a control. After 3 weeks, plants inoculated with symptomatic sap showed leaf curling and stunting, while control plants remained unaffected. All symptomatic samples tested positive for TVBMV via RT-PCR (4/4). For comparison, TVBMV could not be detected in the control sample. Sanger sequencing verified the expected 986 bp amplicon sequences. However, ChiVMV was also detected in all symptomatic tomato samples, which makes it possible that the symptoms after inoculation were the result of the synergism of TVBMV and ChiVMV. Phylogenetic analysis based on complete coding sequence revealed that TVBMV-tomato was most closely related to TVBMV identified from Solanum lyratum. To our knowledge, this work represents the first report of natural occurrence of TVBMV in agroecosystem in Yunnan, China.

2.
J Zhejiang Univ Sci B ; : 1-5, 2024 Sep 26.
Artigo em Inglês, Chinês | MEDLINE | ID: mdl-39327260

RESUMO

Neurodegenerative diseases (NDDs), mainly including Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), and Alzheimer's disease (AD), are sporadic and rare genetic disorders of the central nervous system. A key feature of these conditions is the slow accumulation of misfolded protein deposits in brain neurons, the excessive aggregation of which leads to neurotoxicity and further disorders of the nervous system.

3.
Biochim Biophys Acta Mol Basis Dis ; 1870(8): 167457, 2024 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-39134287

RESUMO

DNA virus infection is a significant cause of morbidity and mortality in patients with multiple myeloma (MM). Monocyte dysfunction in MM patients plays a central role in infectious complications, but the precise molecular mechanism underlying the reduced resistance of monocytes to viruses in MM patients remains to be elucidated. Here, we found that MM cells were able to transfer microRNAs (miRNAs) to host monocytes/macrophages via MM cell-derived exosomes, resulting in the inhibition of innate antiviral immune responses. The screening of miRNAs enriched in exosomes derived from the bone marrow (BM) of MM patients revealed five miRNAs that negatively regulate the cGAS-STING antiviral immune response. Notably, silencing these miRNAs with antagomiRs in MM-bearing C57BL/KaLwRijHsd mice markedly reduced viral replication. These findings identify a novel mechanism whereby MM cells possess the capacity to inhibit the innate immune response of the host, thereby rendering patients susceptible to viral infection. Consequently, targeting the aberrant expression patterns of characteristic miRNAs in MM patients is a promising avenue for therapeutic intervention. Considering the miRNA score and relevant clinical factors, we formulated a practical and efficient model for the optimal assessment of susceptibility to DNA viral infection in patients with MM.


Assuntos
Exossomos , Imunidade Inata , Proteínas de Membrana , Camundongos Endogâmicos C57BL , MicroRNAs , Mieloma Múltiplo , Nucleotidiltransferases , MicroRNAs/genética , MicroRNAs/imunologia , Mieloma Múltiplo/imunologia , Mieloma Múltiplo/genética , Mieloma Múltiplo/patologia , Animais , Humanos , Nucleotidiltransferases/genética , Nucleotidiltransferases/metabolismo , Nucleotidiltransferases/imunologia , Exossomos/imunologia , Exossomos/genética , Exossomos/metabolismo , Camundongos , Proteínas de Membrana/genética , Proteínas de Membrana/imunologia , Proteínas de Membrana/metabolismo , Monócitos/imunologia , Monócitos/metabolismo , Infecções por Vírus de DNA/imunologia , Linhagem Celular Tumoral , Macrófagos/imunologia , Macrófagos/metabolismo , Masculino , Feminino , Replicação Viral
4.
Plant Dis ; 2024 Aug 08.
Artigo em Inglês | MEDLINE | ID: mdl-39115952

RESUMO

Potato virus H (PVH), belonging to the genus Carlavirus in the family Betaflexiviridae, was initially discovered in potato plants in Inner Mongolia, China (Li et al., 2013). Subsequently, it was documented to infect pepino, a perennial shrub of the Solanaceae family like potatoes (Abouelnasr et al., 2014). Tomato (Solanum lycopersicum L.), a major global crop, faces threats from various plant viruses. In an open field survey in Yunnan, China during July 2023, tomatoes (cultivar: Liangsi) showed typical virus symptoms: leaf yellowing, curling, mottling, and fruit with abnormal shape and color. Eleven symptomatic tomato samples were collected for high-throughput sequencing to identify the potential pathogen. RNA sequencing libraries were prepared using the TruSeq RNA sample prep kit (Illumina, San Diego, CA, USA), followed by RNA-seq sequencing on an Illumina HiSeq4000 platform (LC Sciences, USA). Approximately 77,928,560 paired-end reads (150-bp each) were generated. After quality control, 75,808,296 reads were retained and subjected to de novo assembly using Trinity (version 2.8.5). The assembled contigs, ranging from 198 nt to 15865 nt, were used as queries to search against the NCBI non-redundant protein sequence database (NR) or nucleotide sequence database (NT) to detect the potential pathogens using BLASTx and BLASTn program with a cutoff e-value of 10-5. As a consequence, certain contigs were assigned to 3 plant viruses, including PVH (the highest RdRp blastx identity to UAD82396.1: 97.8%), Capsicum chlorosis virus (CaCV, the highest RdRp blastx identity to APQ31267.1: 98.4%), and southern tomato virus (STV, the highest CP-RdRp fusion protein blastx identity to QOW17541.1: 99.74%). The presence of the identified 3 viruses was subsequently screened in the 11 tomato samples originally collected from the corresponding field. Notably, the specific detection primers for the PVH genome was designed from the newly assembled PVH genome (Forward primer: 5'- ATAGTTGTGCACTGTGTGCCTG-3'; Reverse primer: 5'-GCTTAAGGTTCTTAGCGTATTC-3'), targeting ~1.1kb. Consequently, PVH was detected in 3 out of 11 samples: 2 leaf samples and 1 fruit sample, with one leaf sample showing a single infection. The complete genome sequence of PVH in tomatoes (PVH-tomato) was successfully obtained by assembling nine overlapping regions spanning the entire PVH-tomato genome, following the RT-PCR and the 5' RACE and 3' RACE approaches, and deposited in NCBI nucleotide database with accession number OR397130.1Phylogenetic analysis based on the full genome sequences of PVH-tomato and other publicly available PVH isolates revealed that PVH-tomato was closely related to a PVH isolate found in potatoes in Yunnan (blastn similarity: 97.76%) (Fig. S1A). To test PVH-tomato infectivity and pathogenicity, four healthy Nicotiana benthamiana and four healthy tomato plants were mechanically inoculated with PVH-infected leaf sap; controls used sap from healthy plants. Three weeks post-inoculation, all N. benthamiana (4/4) and three tomato plants (3/4) were PVH-positive by RT-PCR. Symptoms were milder in N. benthamiana, and only two tomato plants (2/4) showed leaf curling. No PVH was detected in control samples (Figure S1B, S1C). Sanger sequencing confirmed the amplicons' expected length of 1093 bp. Previously, PVH was documented only in potato and pepino. This is the first report of tomatoes as natural PVH hosts and PVH infecting N. benthamiana under lab conditions.

5.
ACS Appl Mater Interfaces ; 16(32): 43026-43037, 2024 Aug 14.
Artigo em Inglês | MEDLINE | ID: mdl-39093713

RESUMO

The aqueous zinc-ion batteries (ZIBs) have gained increasing attention because of their high specific capacity, low cost, and good safety. However, side reactions, hydrogen evolution reaction, and uncontrolled zinc dendrites accompanying the Zn metal anodes have impeded the applications of ZIBs in grid-scale energy storage. Herein, the poly(3,4-ethylenedioxythiophene) (PEDOT) nanowires as an interfacial layer on the Zn anode (Zn-PEDOT) are reported to address the above issues. Our experimental results and density functional theory simulation reveal that the interactions between the Zn2+ and S atoms in thiophene rings of PEDOT not only facilitate the desolvation of hydrated Zn2+ but also can regulate the diffusion of Zn2+ along the thiophene molecular chains and induce the dendrite-free deposition of Zn along the (002) surface. Consequently, the Zn||Cu-PEDOT half-cell exhibits highly reversible plating/stripping behavior with an average Coulombic efficiency of 99.7% over 2500 cycles at 1 mA cm-2 and a capacity of 0.5 mAh cm-2. A symmetric Zn-PEDOT cell can steadily operate over 1100 h at 1 mA cm-2 (1 mAh cm-2) and 470 h at 10 mA cm-2 (2 mAh cm-2), outperforming the counterpart bare Zn anodes. Besides, a Zn-PEDOT||V2O5 full cell could deliver a specific capacity of 280 mAh g-1 at 1 A g-1 and exhibits a decent cycling stability, which are much superior to the bare Zn||V2O5 cell. Our results demonstrate that PEDOT nanowires are one of the promising interfacial layers for dendrite-free aqueous ZIBs.

6.
ACS Omega ; 9(31): 34140-34150, 2024 Aug 06.
Artigo em Inglês | MEDLINE | ID: mdl-39130598

RESUMO

This is the first study that explores blending polylactic acid (PLA) with various biomasses, including food wastes-brewer's spent grain (BSG), spent coffee grounds (SCG), sesame cake (SC), and thermoplastic starch (TPS) biomass to create composite gastric floating drug delivery systems (GFDDS) through 3D printing. The aim is to investigate the influence of biomass percentage, biomass type, and printing parameters on their corresponding drug release profiles. 3D-printed (3DP) composite filaments were prepared by blending biomasses and PLA before in vitro drug release studies were performed using hydrophilic and hydrophobic model drugs, metoprolol tartrate (MT), and risperidone (RIS). The data revealed that release profiles were influenced by composite compositions and wall thicknesses of 3DP GFDDS capsules. Up to 15% of food waste could be blended with PLA for all food waste types tested. Delivery studies for PLA-food wastes found that MT was fully released by 4 h, exhibiting burst release profiles after a lag time of 0.5 to 1.5 h, and RIS could achieve a sustained release profile of approximately 48 h. PLA-TPS was utilized as a comparison and demonstrated variable release profiles ranging from 8 to 120 h, depending on the TPS content. The results demonstrated the potential for adjusting drug release profiles by incorporating affordable biomasses into GFDDS. This study presents a promising direction for creating delivery systems that are sustainable, customizable, and cost-effective, utilizing sustainable materials that can also be employed for agricultural, nutraceutical, personal care, and wastewater treatment applications.

7.
Zhonghua Nan Ke Xue ; 30(5): 430-434, 2024 May.
Artigo em Chinês | MEDLINE | ID: mdl-39210492

RESUMO

OBJECTIVE: To explore the effect of the "internet + health education system" in nursing care after stapler circumcision. METHODS: A total of 260 patients underwent stapler circumcision in the Outpatient Department of our hospital from January 2022 to July 2022, of whom 130 received routine nursing after operation (the control group), and the other 130 internet + medical nursing service based on the internet + health education system (the experimental group). We followed up the patients on the 1st, 3rd, 7th and 30th day after surgery, recorded their Visual Analogue Scale (VAS) scores within 24 hours postoperatively, their satisfaction scores with surgery and nursing, the incidence of complications and falloff of the stapler nails, and compared them between the two groups. RESULTS: The postoperative VAS scores of the patients and the incidences of postoperative edema, bleeding, infection and other complications were significantly lower (P < 0.05), the falloff of the stapler nails markedly sooner, and the patients' satisfaction scores with surgery and nursing service remarkably higher (P < 0.05) in the experimental than in the control group (P < 0.05). CONCLUSION: The application of the internet + health education system in nursing care after stapler circumcision can impart relevant knowledge to the patients, enhance their self-care ability, effectively reduce postoperative complications, and improve the patients' satisfaction with surgery and nursing service.


Assuntos
Circuncisão Masculina , Internet , Humanos , Masculino , Circuncisão Masculina/instrumentação , Circuncisão Masculina/efeitos adversos , Educação em Saúde/métodos , Satisfação do Paciente , Cuidados de Enfermagem , Complicações Pós-Operatórias/prevenção & controle , Período Pós-Operatório
8.
J Integr Neurosci ; 23(8): 158, 2024 Aug 21.
Artigo em Inglês | MEDLINE | ID: mdl-39207079

RESUMO

BACKGROUND: Most acute cerebral infarctions (ACI) may develop vascular dementia (VD), which involves almost all types of cognitive impairment. Unfortunately, there is currently no effective treatment for VD. Most patients exhibit mild cognitive impairment (MCI) before the development of VD. N-butyl-phthalide (NBP) is used to treat ACI and improve cognitive function. The oxygen and glucose deprivation (OGD) model of neurons is an in vitro model of ischemia, hypoxia, and cognitive dysfunction. METHODS: We conducted clinical studies and in vitro experiments to investigate the clinical efficacy and mechanism of action of NBP for treating ACI-induced MCI. Patients with ACI-induced MCI were randomly divided into control (Ctrl) and NBP groups. We assessed various indicators, such as clinical efficacy, montreal cognitive assessment scale (MOCA), activities of daily living (ADL), and cerebral infarct size in both groups before and after treatment. We observed the morphology of neurons and detected the survival rate, action potentials (APs), expression of high mobility group box 1 (HMGB1), toll-like receptor 4 (TLR4), interleukin-6 (IL-6), and tumor necrosis factor-alpha (TNF-α), and the interaction between TLR4 and HMGB1. RESULTS: The MOCA and ADL scores increased significantly after treatment in the NBP group. A OGD model of neurons was established, and the neurons were divided into Ctrl and NBP groups. We observed that the survival rate and APs amplitude of the neurons were significantly increased in the NBP group, whereas TNF-α expression was decreased. Furthermore, the interaction between TLR4 and HMGB1 decreased in the NBP group. CONCLUSION: NBP plays a neuroprotective role by inhibiting the TLR4/HMGB1 pathway and ameliorating ACI-induced MCI.


Assuntos
Benzofuranos , Infarto Cerebral , Disfunção Cognitiva , Proteína HMGB1 , Fármacos Neuroprotetores , Receptor 4 Toll-Like , Disfunção Cognitiva/etiologia , Disfunção Cognitiva/tratamento farmacológico , Disfunção Cognitiva/metabolismo , Proteína HMGB1/metabolismo , Proteína HMGB1/efeitos dos fármacos , Receptor 4 Toll-Like/metabolismo , Receptor 4 Toll-Like/efeitos dos fármacos , Fármacos Neuroprotetores/farmacologia , Fármacos Neuroprotetores/administração & dosagem , Benzofuranos/farmacologia , Benzofuranos/administração & dosagem , Humanos , Infarto Cerebral/tratamento farmacológico , Masculino , Idoso , Animais , Feminino , Transdução de Sinais/efeitos dos fármacos , Transdução de Sinais/fisiologia , Neurônios/efeitos dos fármacos , Neurônios/metabolismo , Pessoa de Meia-Idade
9.
Biomater Sci ; 12(16): 4006-4023, 2024 Aug 06.
Artigo em Inglês | MEDLINE | ID: mdl-38979939

RESUMO

Sensorineural hearing loss (SNHL) usually involves damage to complex auditory pathways such as inner ear cells and auditory nerves. The highly intricate and nuanced characteristics of these cells render their repair and regeneration extremely challenging, making it difficult to restore hearing to normal levels once it has been compromised. The effectiveness of traditional drugs is so minimal that they provide little help with the treatment. Fortunately, extensive experiments have demonstrated that combining biomaterials with conventional techniques significantly enhances drug effectiveness. This article reviews the research progress of biomaterials in protecting hair cells and the auditory nerve, repairing genes related to hearing, and developing artificial cochlear materials. By organizing the knowledge presented in this article, perhaps new insights can be provided for the clinical management of SNHL.


Assuntos
Materiais Biocompatíveis , Perda Auditiva Neurossensorial , Humanos , Materiais Biocompatíveis/química , Materiais Biocompatíveis/farmacologia , Perda Auditiva Neurossensorial/tratamento farmacológico , Perda Auditiva Neurossensorial/terapia , Animais , Nervo Coclear/efeitos dos fármacos , Células Ciliadas Auditivas/efeitos dos fármacos
10.
Inorg Chem ; 63(29): 13516-13524, 2024 Jul 22.
Artigo em Inglês | MEDLINE | ID: mdl-38959250

RESUMO

Anthrax bacillus is a very dangerous zoonotic pathogen that seriously endangers public health. Rapid and accurate qualitative and quantitative detection of its biomarkers, 2,6-dipicolinic acid (DPA), is crucial for the prevention and treatment of this pathogenic bacterium. In this work, a novel Cd-based MOF (TTCA-Cd) has been synthesized from a polycarboxylate ligand, [1,1':2',1″-terphenyl]-4,4',4″,5'-tetracarboxylic acid (H4TTCA), and further doped with Tb(III), forming a dual-emission lanthanide-functionalized MOF hybrid (TTCA-Cd@Tb). TTCA-Cd@Tb can be developed as a high-performance ratiometric fluorescent sensor toward DPA with a very low detection limit of 7.14 nM and high selectivity in a wide detection range of 0-200 µM, demonstrating a big advancement and providing a new option for the detection of DPA.


Assuntos
Antraz , Bacillus anthracis , Biomarcadores , Corantes Fluorescentes , Estruturas Metalorgânicas , Ácidos Picolínicos , Térbio , Estruturas Metalorgânicas/química , Estruturas Metalorgânicas/síntese química , Térbio/química , Ácidos Picolínicos/análise , Ácidos Picolínicos/química , Corantes Fluorescentes/química , Corantes Fluorescentes/síntese química , Biomarcadores/análise , Antraz/diagnóstico , Cádmio/química , Cádmio/análise , Estrutura Molecular , Limite de Detecção , Espectrometria de Fluorescência
11.
Mater Today Bio ; 27: 101141, 2024 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-39045312

RESUMO

Congenital microtia is the most common cause of auricular defects, with a prevalence of approximately 5.18 per 10,000 individuals. Autologous rib cartilage grafting is the leading treatment modality at this stage of auricular reconstruction currently. However, harvesting rib cartilage may lead to donor site injuries, such as pneumothorax, postoperative pain, chest wall scarring, and deformity. Therefore, in the pursuit of better graft materials, biomaterial scaffolds with great histocompatibility, precise control of morphology, non-invasiveness properties are gradually becoming a new research hotspot in auricular reconstruction. This review collectively presents the exploit and application of 3D printing biomaterial scaffold in auricular reconstruction. Although the tissue-engineered ear still faces challenges before it can be widely applied to patients in clinical settings, and its long-term effects have yet to be evaluated, we aim to provide guidance for future research directions in 3D printing biomaterial scaffold for auricular reconstruction. This will ultimately benefit the translational and clinical application of cartilage tissue engineering and biomaterials in the treatment of auricular defects.

12.
Materials (Basel) ; 17(12)2024 Jun 10.
Artigo em Inglês | MEDLINE | ID: mdl-38930194

RESUMO

In this study, an electrode slurry composed of molybdenum disulfide (MoS2) and vapor-grown carbon fiber (VGCF) prepared through a solid-phase synthesis method was blade-coated onto copper foil to form a thick film as the anode for lithium-ion batteries. In previously reported work, MoS2-based lithium-ion batteries have experienced gradual deformation, fracture, and pulverization of electrode materials during the charge and discharge cycling process. This leads to an unstable electrode structure and rapid decline in battery capacity. Furthermore, MoS2 nanosheets tend to aggregate over charge and discharge cycles, which diminishes the surface activity of the material and results in poor electrochemical performance. In this study, we altered the density of the MoS2-carbon fiber/Cu foil anode electrode by rolling. Three different densities of electrode sheets were obtained through varying rolling repetitions. Our study shows the best electrochemical performance was achieved at a material density of 2.2 g/cm3, maintaining a capacity of 427 mAh/g even after 80 cycles.

13.
Elife ; 132024 May 22.
Artigo em Inglês | MEDLINE | ID: mdl-38775133

RESUMO

Tissue-clearing and labeling techniques have revolutionized brain-wide imaging and analysis, yet their application to clinical formalin-fixed paraffin-embedded (FFPE) blocks remains challenging. We introduce HIF-Clear, a novel method for efficiently clearing and labeling centimeter-thick FFPE specimens using elevated temperature and concentrated detergents. HIF-Clear with multi-round immunolabeling reveals neuron circuitry regulating multiple neurotransmitter systems in a whole FFPE mouse brain and is able to be used as the evaluation of disease treatment efficiency. HIF-Clear also supports expansion microscopy and can be performed on a non-sectioned 15-year-old FFPE specimen, as well as a 3-month formalin-fixed mouse brain. Thus, HIF-Clear represents a feasible approach for researching archived FFPE specimens for future neuroscientific and 3D neuropathological analyses.


Assuntos
Encéfalo , Formaldeído , Neurônios , Inclusão em Parafina , Fixação de Tecidos , Animais , Inclusão em Parafina/métodos , Camundongos , Fixação de Tecidos/métodos , Neurônios/fisiologia , Fixadores/química
14.
Cell Rep ; 43(6): 114258, 2024 Jun 25.
Artigo em Inglês | MEDLINE | ID: mdl-38781073

RESUMO

Transforming growth factor ß (TGF-ß) represents a well-established signal required for tissue-resident memory T cell (TRM) formation at intestinal surfaces, regulating the expression of a large collection of genes coordinately promoting intestinal TRM differentiation. The functional contribution from each TGF-ß-controlled transcription factor is not entirely known. Here, we find that TGF-ß-induced T-bet downregulation and Hic1 induction represent two critical events during intestinal TRM differentiation. Importantly, T-bet deficiency significantly rescues intestinal TRM formation in the absence of the TGF-ß receptor. Hic1 induction further strengthens TRM maturation in the absence of TGF-ß and T-bet. Our results reveal that provision of certain TGF-ß-induced molecular events can partially replace TGF-ß signaling to promote the establishment of intestinal TRMs, which allows the functional dissection of TGF-ß-induced transcriptional targets and molecular mechanisms for TRM differentiation.


Assuntos
Linfócitos T CD8-Positivos , Mucosa Intestinal , Fatores de Transcrição Kruppel-Like , Transdução de Sinais , Proteínas com Domínio T , Animais , Camundongos , Antígenos CD/metabolismo , Linfócitos T CD8-Positivos/imunologia , Linfócitos T CD8-Positivos/metabolismo , Diferenciação Celular , Memória Imunológica , Cadeias alfa de Integrinas/metabolismo , Mucosa Intestinal/citologia , Mucosa Intestinal/imunologia , Mucosa Intestinal/metabolismo , Intestinos/imunologia , Fatores de Transcrição Kruppel-Like/metabolismo , Células T de Memória/metabolismo , Células T de Memória/imunologia , Camundongos Endogâmicos C57BL , Proteínas com Domínio T/metabolismo , Proteínas com Domínio T/genética , Fator de Crescimento Transformador beta/metabolismo
16.
Angew Chem Int Ed Engl ; 63(31): e202404941, 2024 Jul 29.
Artigo em Inglês | MEDLINE | ID: mdl-38743027

RESUMO

Hydrazone-linked covalent organic frameworks (COFs) with structural flexibility, heteroatomic sites, post-modification ability and high hydrolytic stability have attracted great attention from scientific community. Hydrazone-linked COFs, as a subclass of Schiff-base COFs, was firstly reported in 2011 by Yaghi's group and later witnessed prosperous development in various aspects. Their adjustable structures, precise pore channels and plentiful heteroatomic sites of hydrazone-linked structures possess much potential in diverse applications, for example, adsorption/separation, chemical sensing, catalysis and energy storage, etc. Up to date, the systematic reviews about the reported hydrazone-linked COFs are still rare. Therefore, in this review, we will summarize their preparation methods, characteristics and related applications, and discuss the opportunity or challenge of hydrazone-linked COFs. We hope this review could provide new insights about hydrazone-linked COFs for exploring more appealing functions or applications.

17.
Life Sci ; 347: 122653, 2024 Jun 15.
Artigo em Inglês | MEDLINE | ID: mdl-38663839

RESUMO

Autophagy is a cellular degradation system that recycles or degrades damaged organelles, viral particles, and aggregated proteins through the lysosomal pathway. Autophagy plays an indispensable role in cellular homeostasis and communication processes. An interesting aspect is that autophagy also mediates the secretion of cellular contents, a process known as secretory autophagy. Secretory autophagy differs from macroautophagy, which sequesters recruited proteins, organelles, or viral particles into autophagosomes and degrades these sequesters in lysosomes, while the secretory autophagy pathway participates in the extracellular export of cellular contents sequestered by autophagosomes through autophagy and endosomal modulators. Recent evidence reveals that secretory autophagy is pivotal in the occurrence and progression of diseases. In this review, we summarize the molecular mechanisms of secretory autophagy. Furthermore, we review the impact of secretory autophagy on diseases, including cancer, viral infectious diseases, neurodegenerative diseases, and cardiovascular diseases. Considering the pleiotropic actions of secretory autophagy on diseases, studying the mechanism of secretory autophagy may help to understand the relevant pathophysiological processes.


Assuntos
Autofagia , Humanos , Autofagia/fisiologia , Animais , Doenças Neurodegenerativas/metabolismo , Doenças Neurodegenerativas/patologia , Neoplasias/patologia , Neoplasias/metabolismo , Viroses/metabolismo , Viroses/patologia , Autofagossomos/metabolismo , Lisossomos/metabolismo , Doenças Cardiovasculares/metabolismo , Doenças Cardiovasculares/patologia , Doenças Cardiovasculares/fisiopatologia
18.
J Am Med Inform Assoc ; 31(6): 1356-1366, 2024 May 20.
Artigo em Inglês | MEDLINE | ID: mdl-38447590

RESUMO

OBJECTIVE: This study evaluates an AI assistant developed using OpenAI's GPT-4 for interpreting pharmacogenomic (PGx) testing results, aiming to improve decision-making and knowledge sharing in clinical genetics and to enhance patient care with equitable access. MATERIALS AND METHODS: The AI assistant employs retrieval-augmented generation (RAG), which combines retrieval and generative techniques, by harnessing a knowledge base (KB) that comprises data from the Clinical Pharmacogenetics Implementation Consortium (CPIC). It uses context-aware GPT-4 to generate tailored responses to user queries from this KB, further refined through prompt engineering and guardrails. RESULTS: Evaluated against a specialized PGx question catalog, the AI assistant showed high efficacy in addressing user queries. Compared with OpenAI's ChatGPT 3.5, it demonstrated better performance, especially in provider-specific queries requiring specialized data and citations. Key areas for improvement include enhancing accuracy, relevancy, and representative language in responses. DISCUSSION: The integration of context-aware GPT-4 with RAG significantly enhanced the AI assistant's utility. RAG's ability to incorporate domain-specific CPIC data, including recent literature, proved beneficial. Challenges persist, such as the need for specialized genetic/PGx models to improve accuracy and relevancy and addressing ethical, regulatory, and safety concerns. CONCLUSION: This study underscores generative AI's potential for transforming healthcare provider support and patient accessibility to complex pharmacogenomic information. While careful implementation of large language models like GPT-4 is necessary, it is clear that they can substantially improve understanding of pharmacogenomic data. With further development, these tools could augment healthcare expertise, provider productivity, and the delivery of equitable, patient-centered healthcare services.


Assuntos
Farmacogenética , Medicina de Precisão , Humanos , Inteligência Artificial , Bases de Conhecimento , Armazenamento e Recuperação da Informação/métodos , Testes Farmacogenômicos
19.
Clin Exp Pharmacol Physiol ; 51(4): e13850, 2024 04.
Artigo em Inglês | MEDLINE | ID: mdl-38452755

RESUMO

Adolescent and young adults (AYAs) belong to a unique category of patients diagnosed with acute lymphoblastic leukaemia (ALL). Bloodstream infection (BSI) is a leading cause of treatment-related mortality in ALL patients. However, the epidemiology and risk factors for mortality from BSIs in AYA patients remain unclear. In this study, we analysed these aspects in AYAs patients and compared similarities and differences with children (<15 years old) and older adults (>39 years old). We analysed the pathogenic epidemiology, antibiotic resistance and BSI risk factors of 73 children, 180 AYAs, and 110 older adults with ALL in three comprehensive hospitals from January 2010 to August 2021. The data on BSIs in AYAs were compared to that of the other two groups. In this study, the epidemiology of BSIs in AYAs was similar to that of older adult patients. Concerning clinical characteristics, most AYAs and older adults with BSIs were in a relapsed or uncontrolled state (34.5% vs. 35.4%, p = 0.861). In terms of pathogen distribution, Gram-negative bacteria (GNB) were the most common causative pathogens in AYAs and older adult groups. Extended-spectrum beta-lactamase (ESBL)-producing bacteria were more commonly found in AYAs than in children (32.8% vs. 16.4%, p = 0.09). Regarding risk factors, the length of hospitalization (>14 days) and renal inadequacy (creatinine ≥ 177 µmol/L) were influencing factors for 30-day mortality in AYAs patients with BSIs. In our study, AYA patients with BSIs showed clinical characteristics and pathogen distributions similar to those of older adult patients but quite different from those of children.


Assuntos
Leucemia-Linfoma Linfoblástico de Células Precursoras , Sepse , Criança , Humanos , Adolescente , Adulto Jovem , Idoso , Adulto , Estudos Retrospectivos , Fatores de Risco , Bactérias , Leucemia-Linfoma Linfoblástico de Células Precursoras/epidemiologia
20.
BMC Psychol ; 12(1): 95, 2024 Feb 24.
Artigo em Inglês | MEDLINE | ID: mdl-38402398

RESUMO

BACKGROUND: There is a mutual influence between emotions and diseases. Thus, the subject of emotions has gained increasing attention. OBJECTIVE: The primary objective of this study was to conduct a comprehensive review of the developments in emotion recognition technology over the past decade. This review aimed to gain insights into the trends and real-world effects of emotion recognition technology by examining its practical applications in different settings, including hospitals and home environments. METHODS: This study followed the Preferred Reporting Items for Systematic Reviews (PRISMA) guidelines and included a search of 4 electronic databases, namely, PubMed, Web of Science, Google Scholar and IEEE Xplore, to identify eligible studies published between 2013 and 2023. The quality of the studies was assessed using the Critical Appraisal Skills Programme (CASP) criteria. The key information from the studies, including the study populations, application scenarios, and technological methods employed, was summarized and analyzed. RESULTS: In a systematic literature review of the 44 studies that we analyzed the development and impact of emotion recognition technology in the field of medicine from three distinct perspectives: "application scenarios," "techniques of multiple modalities," and "clinical applications." The following three impacts were identified: (i) The advancement of emotion recognition technology has facilitated remote emotion recognition and treatment in hospital and home environments by healthcare professionals. (ii) There has been a shift from traditional subjective emotion assessment methods to multimodal emotion recognition methods that are grounded in objective physiological signals. This technological progress is expected to enhance the accuracy of medical diagnosis. (iii) The evolving relationship between emotions and disease throughout diagnosis, intervention, and treatment processes holds clinical significance for real-time emotion monitoring. CONCLUSION: These findings indicate that the integration of emotion recognition technology with intelligent devices has led to the development of application systems and models, which provide technological support for the recognition of and interventions for emotions. However, the continuous recognition of emotional changes in dynamic or complex environments will be a focal point of future research.


Assuntos
Emoções , Humanos , Telemedicina
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA