Apigenin suppresses epithelial-mesenchymal transition in high glucose-induced retinal pigment epithelial cell by inhibiting CBP/p300-mediated histone acetylation.

Epithelial mesenchymal transition (EMT) is a critical process implicated in the pathogenesis of retinal fibrosis and the exacerbation of diabetic retinopathy (DR) within retinal pigment epithelium (RPE) cells. Apigenin (AP), a potential dietary supplement for managing diabetes and its associated complications, has demonstrated inhibitory effects on EMT in various diseases. However, the specific impact and underlying mechanisms of AP on EMT in RPE cells remain poorly understood. In this study, we have successfully validated the inhibitory effects of AP on high glucose-induced EMT in ARPE-19 cells and diabetic db/db mice. Notably, our findings have identified CBP/p300 as a potential therapeutic target for EMT in RPE cells and have further substantiated that AP effectively downregulates the expression of EMT-related genes by attenuating the activity of CBP/p300, consequently reducing histone acetylation alterations within the promoter region of these genes. Taken together, our results provide novel evidence supporting the inhibitory effect of AP on EMT in RPE cells, and highlight the potential of specifically targeting CBP/p300 as a strategy for inhibiting retinal fibrosis in the context of DR.

The effect of music therapy on language communication and social skills in children with autism spectrum disorder: a systematic review and meta-analysis.

Background: Studies have shown that music therapy can be used as a therapeutic aid for clinical disorders. To evaluate the effects of music therapy (MT) on language communication and social skills in children with autism spectrum disorder (ASD), a meta-analysis was performed on eligible studies in this field. Methods: A systematic search was conducted in eight databases: PubMed, Embase, Web of Science, Cochrane Library databases, the China National Knowledge Infrastructure (CNKI), Wanfang Data, the Chinese Biomedical Literature (CBM) Database, and the VIP Chinese Science and Technology Periodicals Database. The standard mean difference (SMD) values were used to evaluate outcomes, and the pooled proportions and SMD with their 95% confidence intervals (CIs) were also calculated. Results: Eighteen randomized controlled trial (RCT) studies were included, with a total of 1,457 children with ASD. This meta-analysis revealed that music therapy improved their language communication [SMD = -1.20; 95%CI -1.45, -0.94; χ2 (17) = 84.17, I2 = 80%, p < 0.001] and social skills [SMD = -1. 13; 95%CI -1.49, -0.78; χ2 (17) = 162.53, I2 = 90%, p < 0.001]. In addition, behavior [SMD = -1.92; 94%CI -2.56, -1.28; χ2 (13) = 235.08, I2 = 95%, p < 0.001], sensory perception [SMD = -1.62; 95%CI -2.17, -1.08; χ2 (16) = 303.80, I2 = 95%, p < 0.001], self-help [SMD = -2. 14; 95%CI -3.17, -1.10; χ2 (6) = 173.07, I2 = 97%, p < 0.001] were all improved. Conclusion: Music therapy has a positive effect on the improvement of symptoms in children with ASD. Systematic review registration: https://www.crd.york.ac.uk/PROSPERO/.

Salivary metabolites are promising noninvasive biomarkers of drug-induced liver injury.

BACKGROUND: Drug-induced liver injury (DILI) is one of the most common adverse events of medication use, and its incidence is increasing. However, early detection of DILI is a crucial challenge due to a lack of biomarkers and noninvasive tests. AIM: To identify salivary metabolic biomarkers of DILI for the future development of noninvasive diagnostic tools. METHODS: Saliva samples from 31 DILI patients and 35 healthy controls (HCs) were subjected to untargeted metabolomics using ultrahigh-pressure liquid chromatography coupled with tandem mass spectrometry. Subsequent analyses, including partial least squares-discriminant analysis modeling, t tests and weighted metabolite coexpression network analysis (WMCNA), were conducted to identify key differentially expressed metabolites (DEMs) and metabolite sets. Furthermore, we utilized least absolute shrinkage and selection operato and random fores analyses for biomarker prediction. The use of each metabolite and metabolite set to detect DILI was evaluated with area under the receiver operating characteristic curves. RESULTS: We found 247 differentially expressed salivary metabolites between the DILI group and the HC group. Using WMCNA, we identified a set of 8 DEMs closely related to liver injury for further prediction testing. Interestingly, the distinct separation of DILI patients and HCs was achieved with five metabolites, namely, 12-hydroxydodecanoic acid, 3-hydroxydecanoic acid, tetradecanedioic acid, hypoxanthine, and inosine (area under the curve: 0.733-1). CONCLUSION: Salivary metabolomics revealed previously unreported metabolic alterations and diagnostic biomarkers in the saliva of DILI patients. Our study may provide a potentially feasible and noninvasive diagnostic method for DILI, but further validation is needed.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

A filtering reconfigurable intelligent surface for interference-free wireless communications.

The powerful capability of reconfigurable intelligent surfaces (RISs) in tailoring electromagnetic waves and fields has put them under the spotlight in wireless communications. However, the current designs are criticized due to their poor frequency selectivity, which hinders their applications in real-world scenarios where the spectrum is becoming increasingly congested. Here we propose a filtering RIS to feature sharp frequency-selecting and 2-bit phase-shifting properties. It permits the signals in a narrow bandwidth to transmit but rejects the out-of-band ones; meanwhile, the phase of the transmitted signals can be digitally controlled, enabling flexible manipulations of signal propagations. A prototype is designed, fabricated, and measured, and its high quality factor and phase-shifting characteristics are validated by scattering parameters and beam-steering phenomena. Further, we conduct a wireless communication experiment to illustrate the intriguing functions of the RIS. The filtering behavior enables the RIS to perform wireless signal manipulations with anti-interference ability, thus showing big potential to advance the development of next-generation wireless communications.

E-CLEAP: An ensemble learning model for efficient and accurate identification of antimicrobial peptides.

With the increasing problem of antimicrobial drug resistance, the search for new antimicrobial agents has become a crucial task in the field of medicine. Antimicrobial peptides, as a class of naturally occurring antimicrobial agents, possess broad-spectrum antimicrobial activity and lower risk of resistance development. However, traditional screening methods for antimicrobial peptides are inefficient, necessitating the development of an efficient screening model. In this study, we aimed to develop an ensemble learning model for the identification of antimicrobial peptides, named E-CLEAP, based on the Multilayer Perceptron Classifier (MLP Classifier). By considering multiple features, including amino acid composition (AAC) and pseudo amino acid composition (PseAAC) of antimicrobial peptides, we aimed to improve the accuracy and generalization ability of the identification process. To validate the superiority of our model, we employed five-fold cross-validation and compared it with other commonly used methods for antimicrobial peptide identification. In the experimental results on an independent test set, E-CLEAP achieved accuracies of 97.33% and 84% for the AAC and PseAAC features, respectively. The results demonstrated that our model outperformed other methods in all evaluation metrics. The findings of this study highlight the potential of the E-CLEAP model in enhancing the efficiency and accuracy of antimicrobial peptide screening, which holds significant implications for drug development, disease treatment, and biotechnology advancement. Future research can further optimize the model by incorporating additional features and information, as well as validating its reliability on larger datasets and in real-world environments. The source code and all datasets are publicly available at https://github.com/Wangsicheng52/E-CLEAP.

Ts2O mediated deoxygenative C2-dithiocarbamation of quinoline N-oxides with CS2 and amines.

A general, efficient and practical protocol for Ts2O promoted deoxygenative dithiocarbamation of quinoline N-oxides with in situ generated dithiocarbamic acids from CS2 and amines is reported. The reaction proceeded well under transition-metal free conditions to obtain a variety of novel quinoline-dithiocarbamate compounds with wide functional group tolerance and good to high yields.

Serum bile acid and unsaturated fatty acid profiles of non-alcoholic fatty liver disease in type 2 diabetic patients.

BACKGROUND: The understanding of bile acid (BA) and unsaturated fatty acid (UFA) profiles, as well as their dysregulation, remains elusive in individuals with type 2 diabetes mellitus (T2DM) coexisting with non-alcoholic fatty liver disease (NAFLD). Investigating these metabolites could offer valuable insights into the pathophy-siology of NAFLD in T2DM. AIM: To identify potential metabolite biomarkers capable of distinguishing between NAFLD and T2DM. METHODS: A training model was developed involving 399 participants, comprising 113 healthy controls (HCs), 134 individuals with T2DM without NAFLD, and 152 individuals with T2DM and NAFLD. External validation encompassed 172 participants. NAFLD patients were divided based on liver fibrosis scores. The analytical approach employed univariate testing, orthogonal partial least squares-discriminant analysis, logistic regression, receiver operating characteristic curve analysis, and decision curve analysis to pinpoint and assess the diagnostic value of serum biomarkers. RESULTS: Compared to HCs, both T2DM and NAFLD groups exhibited diminished levels of specific BAs. In UFAs, particular acids exhibited a positive correlation with NAFLD risk in T2DM, while the ω-6:ω-3 UFA ratio demonstrated a negative correlation. Levels of α-linolenic acid and γ-linolenic acid were linked to significant liver fibrosis in NAFLD. The validation cohort substantiated the predictive efficacy of these biomarkers for assessing NAFLD risk in T2DM patients. CONCLUSION: This study underscores the connection between altered BA and UFA profiles and the presence of NAFLD in individuals with T2DM, proposing their potential as biomarkers in the pathogenesis of NAFLD.

The efficacy and safety of adding PD-1 blockade to induction chemotherapy and concurrent chemoradiotherapy (IC-CCRT) for locoregionally advanced nasopharyngeal carcinoma: an observational, propensity score-matched analysis.

BACKGROUND: Despite the success of PD-1 blockade in recurrent/metastatic nasopharyngeal carcinoma (NPC), its effect for locoregionally advanced NPC (LANPC) remains unclear. This study aimed to evaluate the benefit of adding PD-1 blockade to the current standard treatment (gemcitabine and cisplatin IC  plus cisplatin CCRT ) for LANPC patients. METHODS: From January 2020 to November 2022, 347 patients with non-metastatic high-risk LANPC (stage III-IVA, excluding T3-4N0) were included. Of the 347 patients, 268 patients were treated with standard treatment (IC-CCRT), and 79 received PD-1 blockade plus IC-CCRT (PD-1 group). For the PD-1 group, PD-1 blockade was given intravenously once every 3 weeks for up to 9 cycles (3 induction and 6 adjuvant). The primary endpoint was disease-free survival (DFS) (i.e. freedom from local/regional/distant failure or death). The propensity score matching (PSM) with the ratio of 1:2 was performed to control confounding factors. RESULTS: After PSM analysis, 150 patients receiving standard treatment and 75 patients receiving additional PD-1 blockade remained in the current analysis. After three cycles of IC, the PD-1 group had significantly higher rates of complete response (defined as disappearance of all target lesions; 24% vs. 9%; P = 0.006) and complete biological response (defined as undetectable cell-free Epstein-Barr virus DNA, cfEBV DNA; 79% vs. 65%; P = 0.046) than that in the standard group. And the incidence of grade 3-4 toxicity during IC was 47% in the PD-1 group and 41% in the standard group, with no significant difference (P = 0.396). During follow-up period, additional PD-1 blockade to standard treatment improved 3-year DFS from 84 to 95%, with marginal statistical significance (HR, 0.28; 95%CI, 0.06-1.19; P = 0.064). CONCLUSION: Additiaonl PD-1 blockade to gemcitabine and cisplatin IC and adjuvant treatment results in significant improvement in tumor regression, cfEBV DNA clearance, superior DFS, and comparable toxicity profiles in high-risk LANPC patients.

Chemical constituents from the Saposhnikovia divaricata and their antiproliferative activity.

Nine compounds were isolated and identified from ethanolic extracts of Saposhnikovia divaricata, including one new alkaloid (1), one new pentacyclic triterpenoid (9), and seven known alkaloids (2-8). Structural elucidation of compounds 1 and 9 was established by 1D and 2D NMR spectra referring to the literature, together with high-resolution mass spectrometric analysis. All compounds were evaluated for antiproliferative activity against two cancer cell lines (LN229, A549) in vitro. Compounds (1-9) showed no significant antiproliferative activity.

Meiotic transcriptional reprogramming mediated by cell-cell communications in humans and mice revealed by scATAC-seq and scRNA-seq.

Meiosis is a highly complex process significantly influenced by transcriptional regulation. However, studies on the mechanisms that govern transcriptomic changes during meiosis, especially in prophase I, are limited. Here, we performed single-cell ATAC-seq of human testis tissues and observed reprogramming during the transition from zygotene to pachytene spermatocytes. This event, conserved in mice, involved the deactivation of genes associated with meiosis after reprogramming and the activation of those related to spermatogenesis before their functional onset. Furthermore, we identified 282 transcriptional regulators (TRs) that underwent activation or deactivation subsequent to this process. Evidence suggested that physical contact signals from Sertoli cells may regulate these TRs in spermatocytes, while secreted ENHO signals may alter metabolic patterns in these cells. Our results further indicated that defective transcriptional reprogramming may be associated with non-obstructive azoospermia (NOA). This study revealed the importance of both physical contact and secreted signals between Sertoli cells and germ cells in meiotic progression.

A ResNet mini architecture for brain age prediction.

The brain presents age-related structural and functional changes in the human life, with different extends between subjects and groups. Brain age prediction can be used to evaluate the development and aging of human brain, as well as providing valuable information for neurodevelopment and disease diagnosis. Many contributions have been made for this purpose, resorting to different machine learning methods. To solve this task and reduce memory resource consumption, we develop a mini architecture of only 10 layers by modifying the deep residual neural network (ResNet), named ResNet mini architecture. To support the ResNet mini architecture in brain age prediction, the brain age dataset (OpenNeuro #ds000228) that consists of 155 study participants (three classes) and the Alzheimer MRI preprocessed dataset that consists of 6400 images (four classes) are employed. We compared the performance of the ResNet mini architecture with other popular networks using the two considered datasets. Experimental results show that the proposed architecture exhibits generality and robustness with high accuracy and less parameter number.

Catalytic Hairpin Assembly-Based Self-Ratiometric Gel Electrophoresis Detection Platform for Reliable Nucleic Acid Analysis.

The development of gel electrophoresis-based biodetection assays for point-of-care analysis are highly demanding. In this work, we proposed a ratiometric gel electrophoresis-based biosensing platform by employing catalytic hairpin assembly (CHA) process functions as both the signal output and the signal amplification module. Two types of nucleic acids, DNA and miRNA, are chosen for demonstration. The proposed strategy indeed provides a new paradigm for the design of a portable detection platform and may hold great potential for sensitive diagnoses.

A new 3,4-dihydroisocoumarin and an antiinflammatory coumarin from the roots of Saposhnikovia divaricata (Turcz.) Schischk.

Phytochemical investigation of the roots of Saposhnikovia divaricata (Turcz.) Schischk resulted in the isolation of twelve coumarin derivatives including one new 3,4-dihydroisocoumarin (1) and eleven known 3,4-unsubstituted coumarins (2-12). Structural elucidation of compounds 1-12 was established by 1D and 2D NMR spectra referring to the literature, together with high-resolution mass spectrometric analysis. LPS-induced RAW264.7 inflammatory cell model was used to determine the potential antiinflammation activity of all the isolated compounds in vitro. The results showed that compound 3 significantly inhibited the production of lipopolysaccharide (LPS)-induced NO in macrophages (IC50 = 4.54 ± 1.71 µM), more active than the positive control (L-NMMA).

Indoxyl sulphate-TNFα axis mediates uremic encephalopathy in rodent acute kidney injury.

Acute kidney injury (AKI) is often accompanied by uremic encephalopathy resulting from accumulation of uremic toxins in brain possibly due to impaired blood-brain barrier (BBB) function. Anionic uremic toxins are substrates or inhibitors of organic anionic transporters (OATs). In this study we investigated the CNS behaviors and expression/function of BBB OAT3 in AKI rats and mice, which received intraperitoneal injection of cisplatin 8 and 20 mg/kg, respectively. We showed that cisplatin treatment significantly inhibited the expressions of OAT3, synaptophysin and microtubule-associated protein 2 (MAP2), impaired locomotor and exploration activities, and increased accumulation of uremic toxins in the brain of AKI rats and mice. In vitro studies showed that uremic toxins neither alter OAT3 expression in human cerebral microvascular endothelial cells, nor synaptophysin and MAP2 expressions in human neuroblastoma (SH-SY5Y) cells. In contrast, tumour necrosis factor alpha (TNFα) and the conditioned medium (CM) from RAW264.7 cells treated with indoxyl sulfate (IS) significantly impaired OAT3 expression. TNFα and CM from IS-treated BV-2 cells also inhibited synaptophysin and MAP2 expressions in SH-SY5Y cells. The alterations caused by TNFα and CMs in vitro, and by AKI and TNFα in vivo were abolished by infliximab, a monoclonal antibody designed to intercept and neutralize TNFα, suggesting that AKI impaired the expressions of OAT3, synaptophysin and MAP2 in the brain via IS-induced TNFα release from macrophages or microglia (termed as IS-TNFα axis). Treatment of mice with TNFα (0.5 mg·kg-1·d-1, i.p. for 3 days) significantly increased p-p65 expression and reduced the expressions of Nrf2 and HO-1. Inhibiting NF-κB pathway, silencing p65, or activating Nrf2 and HO-1 obviously attenuated TNFα-induced downregulation of OAT3, synaptophysin and MAP2 expressions. Significantly increased p-p65 and decreased Nrf2 and HO-1 protein levels were also detected in brain of AKI mice and rats. We conclude that AKI inhibits the expressions of OAT3, synaptophysin and MAP2 due to IS-induced TNFα release from macrophages or microglia. TNFα impairs the expressions of OAT3, synaptophysin and MAP2 partly via activating NF-κB pathway and inhibiting Nrf2-HO-1 pathway.

Single-nucleus transcriptomics uncovers a geroprotective role of YAP in primate gingival aging.

Aging has a profound impact on the gingiva and significantly increases its susceptibility to periodontitis, a worldwide prevalent inflammatory disease. However, a systematic characterization and comprehensive understanding of the regulatory mechanism underlying gingival aging is still lacking. Here, we systematically dissected the phenotypic characteristics of gingiva during aging in primates and constructed the first single-nucleus transcriptomic landscape of gingival aging, by which a panel of cell type-specific signatures were elucidated. Epithelial cells were identified as the most affected cell types by aging in the gingiva. Further analyses pinpointed the crucial role of YAP in epithelial self-renew and homeostasis, which declined during aging in epithelial cells, especially in basal cells. The decline of YAP activity during aging was confirmed in the human gingival tissues, and downregulation of YAP in human primary gingival keratinocytes recapitulated the major phenotypic defects observed in the aged primate gingiva while overexpression of YAP showed rejuvenation effects. Our work provides an in-depth understanding of gingival aging and serves as a rich resource for developing novel strategies to combat aging-associated gingival diseases, with the ultimate goal of advancing periodontal health and promoting healthy aging.

METTL14 downregulation drives S100A4+ monocyte-derived macrophages via MyD88/NF-κB pathway to promote MAFLD progression.

Without intervention, a considerable proportion of patients with metabolism-associated fatty liver disease (MAFLD) will progress from simple steatosis to metabolism-associated steatohepatitis (MASH), liver fibrosis, and even hepatocellular carcinoma. However, the molecular mechanisms that control progressive MAFLD have yet to be fully determined. Here, we unraveled that the expression of the N6-methyladenosine (m6A) methyltransferase METTL14 is remarkably downregulated in the livers of both patients and several murine models of MAFLD, whereas hepatocyte-specific depletion of this methyltransferase aggravated lipid accumulation, liver injury, and fibrosis. Conversely, hepatic Mettl14 overexpression alleviated the above pathophysiological changes in mice fed on a high-fat diet (HFD). Notably, in vivo and in vitro mechanistic studies indicated that METTL14 downregulation decreased the level of GLS2 by affecting the translation efficiency mediated by YTHDF1 in an m6A-depedent manner, which might help to form an oxidative stress microenvironment and accordingly recruit Cx3cr1+Ccr2+ monocyte-derived macrophages (Mo-macs). In detail, Cx3cr1+Ccr2+ Mo-macs can be categorized into M1-like macrophages and S100A4-positive macrophages and then further activate hepatic stellate cells (HSCs) to promote liver fibrosis. Further experiments revealed that CX3CR1 can activate the transcription of S100A4 via CX3CR1/MyD88/NF-κB signaling pathway in Cx3cr1+Ccr2+ Mo-macs. Restoration of METTL14 or GLS2, or interfering with this signal transduction pathway such as inhibiting MyD88 could ameliorate liver injuries and fibrosis. Taken together, these findings indicate potential therapies for the treatment of MAFLD progression.

Rational Design and Precise Synthesis of Single-Atom Alloy Catalysts for the Selective Hydrogenation of Nitroarenes.

Single-atom alloys (SAAs) have gained increasing prominence in the field of selective hydrogenation reactions due to their uniform distribution of active sites and the unique host-guest metal interactions. Herein, 15 SAAs are constructed to comprehensively elucidate the relationship between host-guest metal interaction and catalytic performance in the selective hydrogenation of 4-nitrostyrene (4-NS) by density functional theory (DFT) calculations. The results demonstrate that the SAAs with strong host-guest metal interactions exhibit a preference for N─O bond cleavage, and the reaction energy barrier of the hydrogenation process is primarily influenced by the host metal. Among them, Ir1Ni SAA stands out as the prime catalyst candidate, showcasing exceptional activity and selectivity. Furthermore, the Ir1Ni SAA is subsequently prepared through precise synthesis techniques and evaluated in the selective hydrogenation of 4-NS to 4-aminostyrene (4-AS). As anticipated, the Ir1Ni SAA demonstrates extraordinary catalytic performance (yield > 96%). In situ FT-IR experiments and DFT calculations further confirmed that the unique host-guest metal interaction at the Ir-Ni interface site of Ir1Ni SAA endows it with excellent 4-NS selective hydrogenation ability. This work provides valuable insights into enhancing the performance of SAAs catalysts in selective hydrogenation reactions by modulating the host-guest metal interactions.