Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 209
Filtrar
1.
Artigo em Inglês | MEDLINE | ID: mdl-38718216

RESUMO

OBJECTIVE: Social media-based public health research is crucial for epidemic surveillance, but most studies identify relevant corpora with keyword-matching. This study develops a system to streamline the process of curating colloquial medical dictionaries. We demonstrate the pipeline by curating a UMLS-colloquial symptom dictionary from COVID-19-related tweets as proof of concept. METHODS: COVID-19-related tweets from February 1, 2020, to April 30, 2022 were used. The pipeline includes three modules: a named entity recognition module to detect symptoms in tweets; an entity normalization module to aggregate detected entities; and a mapping module that iteratively maps entities to Unified Medical Language System concepts. A random 500 entity sample were drawn from the final dictionary for accuracy validation. Additionally, we conducted a symptom frequency distribution analysis to compare our dictionary to a pre-defined lexicon from previous research. RESULTS: We identified 498,480 unique symptom entity expressions from the tweets. Pre-processing reduces the number to 18,226. The final dictionary contains 38,175 unique expressions of symptoms that can be mapped to 966 UMLS concepts (accuracy = 95%). Symptom distribution analysis found that our dictionary detects more symptoms and is effective at identifying psychiatric disorders like anxiety and depression, often missed by pre-defined lexicons. CONCLUSIONS: This study advances public health research by implementing a novel, systematic pipeline for curating symptom lexicons from social media data. The final lexicon's high accuracy, validated by medical professionals, underscores the potential of this methodology to reliably interpret and categorize vast amounts of unstructured social media data into actionable medical insights across diverse linguistic and regional landscapes.

2.
Exp Ther Med ; 27(6): 270, 2024 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-38756899

RESUMO

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

3.
Polymers (Basel) ; 16(8)2024 Apr 13.
Artigo em Inglês | MEDLINE | ID: mdl-38675009

RESUMO

A non-pneumatic tire (NPT) overcomes the shortcomings of a traditional pneumatic tire such as wear, punctures and blowouts. In this respect, it shows great potential in improving driving safety, and has received great attention in recent years. In this paper, a carbon fiber-reinforced polyethylene terephthalate (PET/CF) honeycomb is proposed as a support structure for NPTs, which can be easily prepared using 3D printing technology. The experimental results showed that the PET/CF has high strength and modulus and provides excellent mechanical properties. Then, a finite element (FE) model was established to predict the compression performance of auxetic honeycombs. Good agreement was achieved between the experimental data and FE analysis. The influence of the cell parameters on the compressive performance of the support structure were further analyzed. Both the wall thickness and the vertically inclined angle could modulate the mechanical performance of the NPT. Finally, the application of vertical force is used to analyze the static load of the structure. The PET/CF honeycomb as the support structure of the NPT showed outstanding bearing capacity and stiffness in contrast with elastomer counterparts. Consequently, this study broadens the material selection for NPTs and proposes a strategy for manufacturing a prototype, which provides a reference for the design and development of non-pneumatic tires.

4.
Menopause ; 2024 Apr 30.
Artigo em Inglês | MEDLINE | ID: mdl-38688466

RESUMO

OBJECTIVE: The aim of this study was to examine associations of anti-Müllerian hormone (AMH) levels in gravid women in their mid-30s with menopausal symptoms ~14 years later and age at natural menopause. METHODS: In this prospective analysis, 474 participants in Project Viva, a longitudinal cohort, were enrolled during pregnancy between 1999 and 2002. AMH levels were determined using plasma samples collected 3 years postpartum. Participants completed the Menopause Rating Scale (MRS) and self-reported age at and reason for menopause at the 17 years postpartum visit (Mid-Life Visit). Primary outcomes were individual MRS item responses and total MRS score. To examine associations between AMH levels and menopausal outcomes, we performed linear and logistic regressions, and survival analyses, adjusting for confounding variables. RESULTS: Mean (SD) AMH level was 2.80 (2.74) ng/mL, measured at 38.2 (3.9) years. At the Mid-Life Visit, mean (SD) age was 52.3 (3.9) years and total MRS score was 8.0 (5.7). During follow-up, 50% had experienced natural menopause, and self-reported mean (SD) age at natural menopause was 50.4 (3.6) years. AMH in the lowest tertile (mean [SD]: 0.47 [0.32] ng/mL) was associated with higher odds of moderate to severe vaginal dryness (adjusted odds ratio: 2.58; 95% CI: 1.16 to 5.73), a lower MRS psychological subscale (adjusted ß: -0.71; 95% CI: -1.35 to -0.07), and earlier attainment of natural menopause (adjusted hazards ratio: 7.1; 95% CI: 4.6 to 11.0) compared with AMH in the highest tertile (mean [SD]: 6.01 [2.37] ng/mL). CONCLUSIONS: Lower AMH in the mid-30s was associated with earlier menopause and increased odds of vaginal dryness but fewer psychological symptoms ~14 years later.

5.
Foods ; 13(6)2024 Mar 14.
Artigo em Inglês | MEDLINE | ID: mdl-38540871

RESUMO

The food industry holds immense promise for 3D printing technology. Current research focuses mainly on optimizing food material composition, molding characteristics, and printing parameters. However, there is a notable lack of comprehensive studies on the shape changes of food products, especially in modeling and simulating deformations. This study addresses this gap by conducting a detailed simulation of the starch gel printing and deformation process using COMSOL Multiphysics 6.2 software. Additive manufacturing (AM) technology is widely acclaimed for its user-friendly operation and cost-effectiveness. The 3D printing process may lead to changes in part dimensions and mechanical properties, attributable to the accumulation of residual stresses. Studies require a significant amount of time and effort to discover the optimal composition of the printed material and the most effective deformed 3D structure. There is a risk of failure, which can lead to wasted resources and research delays. To tackle this issue, this study thoroughly analyzes the physical properties of the gel material through COMSOL Multiphysics 6.2 software, It simulates the heat distribution during the 3D printing process, providing important insights into how materials melt and solidify. Three-part models with varying aspect ratios were meticulously designed to explore shape changes during both the printing process and exposure to an 80 °C environment, employing NMR and rheological characterization. Using the generalized Maxwell model for material simulation in COMSOL Multiphysics, the study predicted stress and deformation of the parts by analyzing solid heat transfer and solid mechanics physical fields. Simulation results showed that among three models utilizing a gel-PET plastic membrane bilayer structure, Model No. 1, with the largest aspect ratio, exhibited the most favorable deformation under an 80 °C baking environment. It displayed uniform bending in the transverse direction without significant excess warpage in the edge direction. In contrast, Models No. 2 and No. 3 showed varying degrees of excess warpage at the edges, with Model No. 3 exhibiting a more pronounced warpage. These findings closely aligned with the actual printing outcomes.

6.
Environ Pollut ; 348: 123833, 2024 May 01.
Artigo em Inglês | MEDLINE | ID: mdl-38522608

RESUMO

Pyraclostrobin, a widely used fungicide, poses significant risks to both the environment and human health. However, research on the microbial degradation process of pyraclostrobin was scarce. Here, a pyraclostrobin-degrading strain, identified as Burkholderia sp. Pyr-1, was isolated from activated sludge. Pyraclostrobin was efficiently degraded by strain Pyr-1, and completely eliminated within 6 d in the presence of glucose. Additionally, pyraclostrobin degradation was significantly enhanced by the addition of divalent metal cations (Mn2+ and Cu2+). The degradation pathway involving ether bond and N-O bond cleavage was proposed by metabolite identification. The sodium alginate-immobilized strain Pyr-1 had a higher pyraclostrobin removal rate from contaminated lake water than the free cells. Moreover, the toxicity evaluation demonstrated that the metabolite 1-(4-chlorophenyl)-1H-pyrazol-3-ol significantly more effectively inhibited Chlorella ellipsoidea than pyraclostrobin, while its degradation products by strain Pyr-1 alleviated the growth inhibition of C. ellipsoidea, which confirmed that the low-toxic metabolites were generated from pyraclostrobin by strain Pyr-1. The study provides a potential strain Pyr-1 for the bioremediation in pyraclostrobin-contaminated aquatic environments.


Assuntos
Burkholderia , Chlorella , Fungicidas Industriais , Humanos , Fungicidas Industriais/toxicidade , Estrobilurinas , Água , Biodegradação Ambiental
7.
Front Microbiol ; 15: 1265829, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38333585

RESUMO

Introduction: The giant panda (Ailuropoda melanoleuca) reproduction is of worldwide attention, and the vaginal microbiome is one of the most important factors affecting the reproductive rate of giant pandas. The aim of this study is to investigate the diversity of vaginal mycobiota structure, and potential pathogenic fungi in female giant pandas during estrus and non-estrus. Methods: This study combined with high-throughput sequencing and laboratory testing to compare the diversity of the vaginal mycobiota in giant pandas during estrus and non-estrus, and to investigate the presence of potentially pathogenic fungi. Potentially pathogenic fungi were studied in mice to explore their pathogenicity. Results and discussion: The results revealed that during estrus, the vaginal secretions of giant pandas play a crucial role in fungal colonization. Moreover, the diversity of the vaginal mycobiota is reduced and specificity is enhanced. The abundance of Trichosporon and Cutaneotrichosporon in the vaginal mycobiota of giant pandas during estrus was significantly higher than that during non-estrus periods. Apiotrichum and Cutaneotrichosporon were considered the most important genera, and they primarily originate from the environment owing to marking behavior exhibited during the estrous period of giant pandas. Trichosporon is considered a resident mycobiota of the vagina and is an important pathogen that causes infection when immune system is suppressed. Potentially pathogenic fungi were further isolated and identified from the vaginal secretions of giant pandas during estrus, and seven strains of Apiotrichum (A. brassicae), one strain of Cutaneotrichosporon (C. moniliiforme), and nine strains of Trichosporon (two strains of T. asteroides, one strain of T. inkin, one strain of T. insectorum, and five strains of T. japonicum) were identified. Pathogenicity results showed that T. asteroides was the most pathogenic strain, as it is associated with extensive connective tissue replacement and inflammatory cell infiltration in both liver and kidney tissues. The results of this study improve our understanding of the diversity of the vaginal fungi present in giant pandas and will significantly contribute to improving the reproductive health of giant pandas in the future.

8.
Sci Total Environ ; 914: 169844, 2024 Mar 01.
Artigo em Inglês | MEDLINE | ID: mdl-38190915

RESUMO

The synergistic strategy for fine particulate matter (PM2.5) and O3 pollution prevention and control has emerged as a pivotal approach in combating air pollution. Volatile organic compounds (VOCs) serve as crucial precursors to both O3 and secondary organic aerosols (SOAs), with motor vehicles representing one of their significant sources. In this study, a standard for establishing a database of VOC species emission factors for motor vehicles was developed, and a database containing 134 VOC species was constructed through field tests and literature surveys. The VOC emissions of light-duty gasoline passenger vehicles (LDGPVs) comprised primarily alkanes and aromatics. The VOC emissions of light-duty diesel trucks (LDDTs) comprised mostly alkanes. Regarding low-speed trucks, 3-wheel vehicles, medium-duty diesel trucks (MDDTs) and heavy-duty diesel trucks (HDDTs), their VOC emissions comprised mainly oxygenated volatile organic compounds (OVOCs). The update of emission standards resulted in a reduction in VOC species emission factors while altering the composition of VOCs. Attention should be directed toward isopentane, benzene and dichloromethane emitted by LDGPVs, dodecane, undecane, ethene and propene emitted by LDDTs, and acetaldehyde emitted by HDDTs. VOC species originating from LDGPVs were more dispersed than those originating from LDDTs and HDDTs. In addition, variations in VOC species were observed among motor vehicles with different fuel types. Toluene, ethene, benzene, m,p-xylene, isopentane, hexanal, ethyne and 1,2,4-trimethylbenzene were the predominant VOC species emitted by gasoline vehicles. Diesel vehicles emitted mainly dodecane, formaldehyde, propene, undecane, acetaldehyde, ethene, decane and benzene. The results could enhance our comprehension of the emission characteristics of VOC species originating from motor vehicles and provide data support and a scientific foundation for achieving synergistic PM2.5 and O3 pollution prevention and control.

9.
J Am Chem Soc ; 146(2): 1356-1363, 2024 Jan 17.
Artigo em Inglês | MEDLINE | ID: mdl-38170904

RESUMO

Here, we present the second generation of our bicyclic peptide library (NTB), featuring a stereodiversified structure and a simplified construction strategy. We utilized a tandem ring-opening metathesis and ring-closing metathesis reaction (ROM-RCM) to cyclize the linear peptide library in a single step, representing the first reported instance of this reaction being applied to the preparation of macrocyclic peptides. Moreover, the resulting bicyclic peptide can be easily linearized for MS/MS sequencing with a one-step deallylation process. We employed this library to screen against the E363-R378 epitope of MYC and identified several MYC-targeting bicyclic peptides. Subsequent in vitro cell studies demonstrated that one candidate, NT-B2R, effectively suppressed MYC transcription activities and cell proliferation.


Assuntos
Biblioteca de Peptídeos , Espectrometria de Massas em Tandem , Peptídeos/farmacologia , Peptídeos/química
10.
Nat Commun ; 15(1): 659, 2024 Jan 22.
Artigo em Inglês | MEDLINE | ID: mdl-38253565

RESUMO

Endoplasmic reticulum-associated degradation (ERAD) plays indispensable roles in many physiological processes; however, the nature of endogenous substrates remains largely elusive. Here we report a proteomics strategy based on the intrinsic property of the SEL1L-HRD1 ERAD complex to identify endogenous ERAD substrates both in vitro and in vivo. Following stringent filtering using a machine learning algorithm, over 100 high-confidence potential substrates are identified in human HEK293T and mouse brown adipose tissue, among which ~88% are cell type-specific. One of the top shared hits is the catalytic subunit of the glycosylphosphatidylinositol (GPI)-transamidase complex, PIGK. Indeed, SEL1L-HRD1 ERAD attenuates the biogenesis of GPI-anchored proteins by specifically targeting PIGK for proteasomal degradation. Lastly, several PIGK disease variants in inherited GPI deficiency disorders are also SEL1L-HRD1 ERAD substrates. This study provides a platform and resources for future effort to identify proteome-wide endogenous substrates in vivo, and implicates SEL1L-HRD1 ERAD in many cellular processes including the biogenesis of GPI-anchored proteins.


Assuntos
Degradação Associada com o Retículo Endoplasmático , Glicosilfosfatidilinositóis , Animais , Camundongos , Humanos , Células HEK293 , Proteômica , Proteínas Ligadas por GPI , Proteínas
11.
Am J Obstet Gynecol ; 230(3): 366.e1-366.e19, 2024 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-37598996

RESUMO

BACKGROUND: Plant-based diets have been associated with a lower risk of cardiovascular disease in nonpregnant adults, but specific evidence for their effects on risk of hypertensive disorders of pregnancy is scarce. OBJECTIVE: This study aimed to evaluate the prospective association between adherence to plant-based diets before pregnancy and the risk for hypertensive disorders of pregnancy. We hypothesized that women with higher adherence to plant-based diets would have a lower risk for hypertensive disorders of pregnancy. STUDY DESIGN: We followed 11,459 parous women (16,780 singleton pregnancies) without chronic diseases, a history of preeclampsia, and cancers who participated in the Nurses' Health Study II (1991-2009), which was a prospective cohort study. Diet was assessed every 4 years using a validated food frequency questionnaire from which we calculated the plant-based diet index (higher score indicates higher adherence) to evaluate the health associations of plant-based diets among participants while accounting for the quality of plant-based foods. Participants self-reported hypertensive disorders of pregnancy, including preeclampsia and gestational hypertension. We estimated the relative risk of hypertensive disorders of pregnancy in relation to plant-based diet index adherence in quintiles using generalized estimating equations log-binomial regression while adjusting for potential confounders and accounting for repeated pregnancies for the same woman. RESULTS: The mean (standard deviation) age at first in-study pregnancy was 35 (4) years. A total of 1033 cases of hypertensive disorders of pregnancy, including 482 cases of preeclampsia (2.9%) and 551 cases of gestational hypertension (3.3%) were reported. Women in the highest quintile of plant-based diet index were significantly associated with a lower risk for hypertensive disorders of pregnancy than women in the lowest quintile (relative risk, 0.76; 95% confidence interval, 0.62-0.93). There was an inverse dose-response relationship between plant-based diet index and risk for hypertensive disorders of pregnancy. The multivariable-adjusted relative risk (95% confidence interval) of hypertensive disorders of pregnancy for women in increasing quintiles of plant-based diet index were 1 (ref), 0.93 (0.78-1.12), 0.86 (0.72-1.03), 0.84 (0.69-1.03), and 0.76 (0.62-0.93) with a significant linear trend across quintiles (P trend=.005). This association was slightly stronger for gestational hypertension (relative risk, 0.77; 95% confidence interval, 0.60-0.99) than for preeclampsia (relative risk, 0.80; 95% confidence interval, 0.61-1.04). Mediation analysis suggested that body mass index evaluation for dietary assessment and pregnancy explained 39% (95% confidence interval, 15%-70%]) of the relation between plant-based diet index and hypertensive disorders of pregnancy and 48% (95% confidence interval, 12%-86%]) of the relation between plant-based diet index and gestational hypertension. CONCLUSION: Higher adherence to plant-based diets was associated with a lower risk of developing hypertensive disorders of pregnancy. Much of the benefit seems to be related to improved weight control.


Assuntos
Hipertensão Induzida pela Gravidez , Pré-Eclâmpsia , Adulto , Gravidez , Feminino , Humanos , Hipertensão Induzida pela Gravidez/epidemiologia , Pré-Eclâmpsia/epidemiologia , Estudos Prospectivos , Dieta Baseada em Plantas , Dieta
13.
Chin Med J (Engl) ; 137(6): 683-693, 2024 Mar 20.
Artigo em Inglês | MEDLINE | ID: mdl-37898876

RESUMO

BACKGROUND: Previous studies have reported associations of specific maternal and paternal lifestyle factors with offspring's cognitive development during early childhood. This study aimed to investigate the prospective associations between overall parental lifestyle and offspring's cognitive performance during adolescence and young adulthood in China. METHODS: We included 2531 adolescents aged 10-15 years at baseline in 2010 from the China Family Panel Studies. A healthy parental lifestyle score (ranged 0-5) was constructed based on the following five modifiable lifestyle factors: Smoking, drinking, exercise, sleep, and diet. Generalized estimating equation models were used to examine the association between baseline parental healthy lifestyle scores and offspring's fluid and crystallized intelligence in subsequent years (2012, 2014, 2016, and 2018). RESULTS: Offspring in the top tertile of parental healthy lifestyle scores performed better in overall fluid intelligence (multivariable-adjusted ß = 0.53, 95% confidence interval [CI]: 0.29-0.77) and overall crystallized intelligence (multivariable-adjusted ß = 0.35, 95% CI: 0.16-0.54) than those in the bottom tertile of parental healthy lifestyle scores. The results were similar after further adjustment for the offspring's healthy lifestyle scores and persisted across the subgroups of parental socioeconomic status. Additionally, maternal and paternal healthy lifestyle scores were independently associated with better offspring's cognitive performance, with significant contribution observed for paternal never-smoking, weekly exercise, and diversified diet. When both parents and offspring adhered to a healthier lifestyle, we observed the highest level of the offspring's overall crystallized intelligence. CONCLUSIONS: Our study indicates that parental adherence to a healthier lifestyle is associated with significantly better offspring's cognitive performance during adolescence and early adulthood, regardless of socioeconomic status. These findings highlight the potential cognitive benefits of promoting healthy lifestyles among parents of adolescents.


Assuntos
Estilo de Vida Saudável , Pais , Adolescente , Humanos , Pré-Escolar , Adulto Jovem , Adulto , Estudos Prospectivos , Pais/psicologia , Fumar , Estilo de Vida
14.
J Hazard Mater ; 464: 132992, 2024 02 15.
Artigo em Inglês | MEDLINE | ID: mdl-37976859

RESUMO

Pyridine and pyrrole, which are regarded as recalcitrant chemicals, are released into the environment as a result of industrial manufacturing processes, posing serious hazards to both the environment and human health. However, the pyrrole degradation mechanism and the pyridine-degrading gene in Rhodococcus are unknown. Herein, a highly efficient pyridine and pyrrole degradation strain Rhodococcus ruber A5 was isolated. Strain A5 completely degraded 1000 mg/L pyridine in a mineral salt medium within 24 h. The pyridine degradation of strain A5 was optimized using the BoxBehnken design. The optimum degradation conditions were found to be pH 7.15, temperature 28.06 â„ƒ, and inoculation amount 1290.94 mg/L. The pbd gene clusters involved in pyridine degradation were discovered via proteomic analysis. The initial ring cleavage of pyridine and pyrrole in strain A5 was carried out by the two-component flavin-dependent monooxygenase PbdA/PbdE. The degradation pathways of pyridine and pyrrole were proposed by the identification of metabolites and comparisons of homologous genes. Additionally, homologous pbd gene clusters were found to exist in different bacterial genomes. Our study revealed the ring cleavage mechanisms of pyrrole and pyridine, and strain A5 was identified as a promising resource for pyridine bioremediation.


Assuntos
Proteômica , Rhodococcus , Humanos , Rhodococcus/metabolismo , Família Multigênica , Piridinas/metabolismo , Biodegradação Ambiental
15.
Xenobiotica ; 53(12): 644-652, 2023 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-38054840

RESUMO

Atorvastatin, an effective lipid-lowering drug, could reduce the risks of morbidity and mortality of cardiovascular diseases. Patients with cardiovascular diseases often use atorvastatin along with berberine. Atorvastatin is the substrate of CYP3A4 and P-gp. However, berberine is the inhibitor. The combination might lead to DDIs. The aim of this study was to assess the effect of berberine on pharmacokinetics and pharmacodynamics of atorvastatin in rats.Plasma concentrations of atorvastatin with or without berberine were determined by HPLC. Pharmacokinetics parameters were calculated and used to evaluate pharmacokinetics interactions. The effect of berberine on pharmacodynamics of atorvastatin was investigated by detecting blood lipid, SOD, MDA, GSH-Px, AST, ALT, and liver histopathology.Cmax, tmax, and AUC0-t of atorvastatin in combination group significantly increased both in normal and model rats (p < 0.01). The increase of t1/2, AUC0-t in model rats was more significant than that in normal rats (p < 0.05). Pharmacodynamics indexes in treatment groups were significantly improved, especially combination group (p < 0.05). Moreover, it could be found that there is a significant recovery in liver histopathology.In conclusion, berberine could affect pharmacokinetics of atorvastatin, enhance lipid-lowering effect and improve liver injury in rats. More attention should be paid to plasma exposure in clinical to avoid adverse reactions.


Assuntos
Berberina , Doenças Cardiovasculares , Hiperlipidemias , Humanos , Ratos , Animais , Atorvastatina/farmacologia , Berberina/farmacologia , Hiperlipidemias/tratamento farmacológico , Lipídeos
16.
BMC Ophthalmol ; 23(1): 514, 2023 Dec 18.
Artigo em Inglês | MEDLINE | ID: mdl-38110879

RESUMO

BACKGROUND: In the present study, we explored the role of N6-methyladenosine (m6A) modification of long non-coding RNAs (lncRNAs) and its association with ferroptosis in lens epithelium cells (LECs) of age-related cataract (ARC). METHODS: Through m6A RNA immunoprecipitation sequencing (m6A-RIP-seq) and RNA sequencing (RNA-seq), we identified m6A mediated and differentially expressed lncRNAs (dme-lncRNAs) in ARC patients. Based on bioinformatics analysis, we selected critical dme-lncRNAs and pathways associated with ARC formation to reveal their potential molecular mechanisms. The downregulation of glutathione peroxidase 4 (GPX4), a key component of ferroptosis, was confirmed by real-time RT-PCR (RT-qPCR) and Western blotting in age-related cortical cataract (ARCC) samples. Transmission electron microscopy was used to assess the change in mitochondrial in LECs. RESULTS: The analysis revealed a total of 11,193 m6A peaks within lncRNAs, among which 7043 were enriched and 4150 were depleted. Among those, lncRNA ENST00000586817(upstream of the GPX4 gene) was not only significantly upregulated in the LECs of ARCC but also potentially augmented the expression of GPX4 through a cis mechanism. The expression of m6A-modified lncRNA (ENST00000586817) was correlated with that of GPX4 and was downregulated in ARC patients. The TEM results indicated significant mitochondrial changes in ARCC samples. GPX4 downregulation enhanced LEC ferroptosis and decreased viability via RSL3 in SRA01/04 cells. CONCLUSIONS: Our results provide insight into the potential function of m6A-modified lncRNAs. M6A-modified lncRNA ENST00000586817 might regulate the expression of GPX4 by a cis mechanism and be implicated in ferroptosis in ARCs.


Assuntos
Catarata , Ferroptose , Fosfolipídeo Hidroperóxido Glutationa Peroxidase , RNA Longo não Codificante , Humanos , Catarata/genética , Catarata/metabolismo , Epitélio/metabolismo , Ferroptose/genética , Fosfolipídeo Hidroperóxido Glutationa Peroxidase/genética , RNA Longo não Codificante/genética
17.
Virol J ; 20(1): 261, 2023 Nov 13.
Artigo em Inglês | MEDLINE | ID: mdl-37957729

RESUMO

BACKGROUND: Avian influenza (AI) is a disease caused by the avian influenza virus (AIV). These viruses spread naturally among wild aquatic birds worldwide and infect domestic poultry, other birds, and other animal species. Currently, real-time reverse transcription polymerase chain reaction (rRT-PCR) is mainly used to detect the presence of pathogens and has good sensitivity and specificity. However, the diagnosis requires sophisticated instruments under laboratory conditions, which significantly limits point-of-care testing (POCT). Rapid, reliable, non-lab-equipment-reliant, sensitive, and specific diagnostic tests are urgently needed for rapid clinical detection and diagnosis. Our study aimed to develop a reverse transcription recombinase polymerase amplification (RT-RPA)/CRISPR method which improves on these limitations. METHODS: The Cas12a protein was purified by affinity chromatography with Ni-agarose resin and observed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Specific CRISPR RNA (crRNA) and primers targeting the M and NP genes of the AIV were designed and screened. By combining RT-RPA with the Cas12a/crRNA trans-cleavage system, a detection system that uses fluorescence readouts under blue light or lateral flow strips was established. Sensitivity assays were performed using a tenfold dilution series of plasmids and RNA of the M and NP genes as templates. The specificity of this method was determined using H1-H16 subtype AIVs and other avian pathogens, such as newcastle disease virus (NDV), infectious bursal disease virus (IBDV), and infectious bronchitis virus (IBV). RESULTS: The results showed that the method was able to detect AIV and that the detection limit can reach 6.7 copies/µL and 12 copies/µL for the M and NP gene, respectively. In addition, this assay showed no cross-reactivity with other avian-derived RNA viruses such as NDV, IBDV, and IBV. Moreover, the detection system presented 97.5% consistency and agreement with rRT-PCR and virus isolation for detecting samples from poultry. This portable and accurate method has great potential for AIV detection in the field. CONCLUSION: An RT-RPA/CRISPR method was developed for rapid, sensitive detection of AIV. The new system presents a good potential as an accurate, user-friendly, and inexpensive platform for point-of-care testing applications.


Assuntos
Vírus da Influenza A , Influenza Aviária , Animais , Influenza Aviária/diagnóstico , Sistemas CRISPR-Cas , Aves , Aves Domésticas , Sensibilidade e Especificidade , Reação em Cadeia da Polimerase em Tempo Real/métodos , Vírus da Doença de Newcastle/genética , RNA
18.
Vis Comput Ind Biomed Art ; 6(1): 23, 2023 Dec 01.
Artigo em Inglês | MEDLINE | ID: mdl-38036750

RESUMO

Although prognostic prediction of nasopharyngeal carcinoma (NPC) remains a pivotal research area, the role of dynamic contrast-enhanced magnetic resonance (DCE-MR) has been less explored. This study aimed to investigate the role of DCR-MR in predicting progression-free survival (PFS) in patients with NPC using magnetic resonance (MR)- and DCE-MR-based radiomic models. A total of 434 patients with two MR scanning sequences were included. The MR- and DCE-MR-based radiomics models were developed based on 289 patients with only MR scanning sequences and 145 patients with four additional pharmacokinetic parameters (volume fraction of extravascular extracellular space (ve), volume fraction of plasma space (vp), volume transfer constant (Ktrans), and reverse reflux rate constant (kep) of DCE-MR. A combined model integrating MR and DCE-MR was constructed. Utilizing methods such as correlation analysis, least absolute shrinkage and selection operator regression, and multivariate Cox proportional hazards regression, we built the radiomics models. Finally, we calculated the net reclassification index and C-index to evaluate and compare the prognostic performance of the radiomics models. Kaplan-Meier survival curve analysis was performed to investigate the model's ability to stratify risk in patients with NPC. The integration of MR and DCE-MR radiomic features significantly enhanced prognostic prediction performance compared to MR- and DCE-MR-based models, evidenced by a test set C-index of 0.808 vs 0.729 and 0.731, respectively. The combined radiomics model improved net reclassification by 22.9%-52.6% and could significantly stratify the risk levels of patients with NPC (p = 0.036). Furthermore, the MR-based radiomic feature maps achieved similar results to the DCE-MR pharmacokinetic parameters in terms of reflecting the underlying angiogenesis information in NPC. Compared to conventional MR-based radiomics models, the combined radiomics model integrating MR and DCE-MR showed promising results in delivering more accurate prognostic predictions and provided more clinical benefits in quantifying and monitoring phenotypic changes associated with NPC prognosis.

19.
Obstet Gynecol ; 142(6): 1278-1290, 2023 Dec 01.
Artigo em Inglês | MEDLINE | ID: mdl-37826849

RESUMO

OBJECTIVE: To investigate the association of healthy lifestyle factors before pregnancy (body mass index [BMI] 18.5-24.9, nonsmoking, 150 min/wk or more of moderate-to-vigorous physical activity, healthy eating [top 40% of Dietary Approaches to Stop Hypertension score], no or low-to-moderate alcohol intake [less than 15 g/d], and use of multivitamins) with risk of adverse pregnancy outcomes. METHODS: We conducted a secondary analysis of prospectively collected data for women without chronic diseases who are participating in an ongoing cohort in the United States (the NHSII [Nurses' Health Study II]). Healthy lifestyle factors preceding pregnancy were prospectively assessed every 2-4 years from 1991 to 2009 with validated measures. Reproductive history was self-reported in 2001 and 2009. A composite outcome of adverse pregnancy outcomes that included miscarriage, ectopic pregnancy, gestational diabetes, gestational hypertension, preeclampsia, preterm birth, stillbirth, or low birth weight was assessed. RESULTS: Overall, 15,509 women with 27,135 pregnancies were included. The mean maternal age was 35.1±4.2 years. Approximately one in three pregnancies (n=9,702, 35.8%) was complicated by one or more adverse pregnancy outcomes. The combination of six low-risk factors was inversely associated with risk of adverse pregnancy outcomes in a dose-dependent manner ( P for trend <.001). Compared with women who had zero or one healthy lifestyle factor, those with six had a 37% lower risk of adverse pregnancy outcomes (relative risk 0.63, 95% CI 0.55-0.72), driven primarily by lower risks of gestational diabetes, gestational hypertension, and low birth weight. All prepregnancy healthy lifestyle factors, except avoiding harmful alcohol consumption and regular physical activity, were independently associated with lower risk of adverse pregnancy outcomes after mutual adjustment for each other. Healthy BMI, high-quality diet, and multivitamin supplementation showed the strongest inverse associations with adverse pregnancy outcomes. If the observed relationships were causal, 19% of adverse pregnancy outcomes could have been prevented by the adoption of all six healthy lifestyle factors (population attributable risk 19%, 95% CI 13-26%). CONCLUSION: Prepregnancy healthy lifestyle is associated with a substantially lower risk of adverse pregnancy outcomes and could be an effective intervention for the prevention of adverse pregnancy outcomes.


Assuntos
Diabetes Gestacional , Hipertensão Induzida pela Gravidez , Nascimento Prematuro , Gravidez , Feminino , Recém-Nascido , Humanos , Adulto , Resultado da Gravidez , Hipertensão Induzida pela Gravidez/epidemiologia , Hipertensão Induzida pela Gravidez/prevenção & controle , Nascimento Prematuro/epidemiologia , Nascimento Prematuro/prevenção & controle , Fatores de Risco , Estilo de Vida Saudável
20.
Pharmgenomics Pers Med ; 16: 913-924, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-37899885

RESUMO

Background: Arteriosclerosis obliterans (ASO) is the leading cause of nontraumatic lower-extremity amputations. Multiple researches have suggested that circular RNAs (circRNAs) played vital regulatory functions in cancer and cardiovascular disease. Nevertheless, the underlying effect and pathological mechanism of circRNAs in the formation and progression of ASO are still indistinct. Methods and Results: This study used microarray analysis to investigate the expression portrait of circRNAs in normal lower extremity arteries and ASO arteries. Bioinformatics analysis was conducted using the KEGG database to study the enrichment of differentially expressed circRNAs (DE circRNAs) and predict their functions. The accuracy of microarray assay was verified by evaluating expression of the top 5 upregulated and 5 downregulated circRNAs (raw density of normal group ≥200) using RT-qPCR. A circRNA-miRNA-mRNA interaction network was further predicted using software. Compared to the normal lower extremity group, the ASO arteries with HE and EVG staining presented hyperplastic fibrous membrane and luminal stenosis. A total of 12,735 circRNAs were identified, including 1196 DE circRNAs with 276 upregulated and 920 downregulated in ASO group based on |log2(FC)| > 1 and padj < 0.05. Among selected 10 circRNAs, RT-qPCR confirmed that hsa_circ_0003266, hsa_circ_0118936 and hsa_circ_0067161 were upregulated while hsa_circ_0091934 and hsa_circ_0092022 were downregulated in ASO group (p < 0.05). GO analysis presented that the DE circRNAs were primarily enriched in protein binding, intracellular part and organelle organization. KEGG pathway analysis indicated that MAPK signaling pathway, human T-cell leukemia virus 1 infection, proteoglycans in cancer were associated with the DE circRNAs. The circRNA-miRNA-mRNA interactive network revealed that both mRNAs and miRNAs linked to circRNAs played an indispensable role in ASO. Conclusion: This study described the expression portrait of circRNAs in human ASO arteries, and revealed the molecular background for further investigations of the circRNA regulatory mechanism in the formation and progression of ASO.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...