Assuntos
Bordetella pertussis , Coinfecção , Neisseria meningitidis , Coqueluche , Humanos , Bordetella pertussis/isolamento & purificação , Pré-Escolar , Coinfecção/microbiologia , Coqueluche/microbiologia , Coqueluche/líquido cefalorraquidiano , Neisseria meningitidis/isolamento & purificação , Masculino , FemininoRESUMO
The powerful capability of reconfigurable intelligent surfaces (RISs) in tailoring electromagnetic waves and fields has put them under the spotlight in wireless communications. However, the current designs are criticized due to their poor frequency selectivity, which hinders their applications in real-world scenarios where the spectrum is becoming increasingly congested. Here we propose a filtering RIS to feature sharp frequency-selecting and 2-bit phase-shifting properties. It permits the signals in a narrow bandwidth to transmit but rejects the out-of-band ones; meanwhile, the phase of the transmitted signals can be digitally controlled, enabling flexible manipulations of signal propagations. A prototype is designed, fabricated, and measured, and its high quality factor and phase-shifting characteristics are validated by scattering parameters and beam-steering phenomena. Further, we conduct a wireless communication experiment to illustrate the intriguing functions of the RIS. The filtering behavior enables the RIS to perform wireless signal manipulations with anti-interference ability, thus showing big potential to advance the development of next-generation wireless communications.
RESUMO
BACKGROUND: In our clinical practice, we observed that some osteoporotic vertebral compression fracture patients undergoing vertebral augmentation exhibited pain in the iliac crest region. This pain aligned with the diagnostic criteria for superior cluneal neuralgia (SCN) and affected treatment satisfaction. OBJECTIVE: This study aims to clinically observe patients undergoing vertebral augmentation in a hospital setting and analyze the etiology and risk factors associated with SCN. STUDY DESIGN: Retrospective cohort study. SETTING: Inpatient population of a single center. METHODS: We retrospectively analyzed clinical data from 630 patients who underwent vertebral augmentation in our hospital from March 2022 to March 2023. Fifty-two patients enrolled in the study experienced pain that met the diagnostic criteria for superior cluneal neuralgia during the perioperative period of the vertebral augmentation procedures. Those patients were divided into 2 subgroups according to the conditions involved in the occurrence of SCN: Group A (26 patients) had either no preoperative SCN but developed it postoperatively, or had preoperative SCN that worsened or did not alleviate postoperatively. Group B (26 patients) had preoperative SCN that was relieved postoperatively. Additionally, 52 consecutive patients in March 2022 to March 2023. who did not experience SCN during the perioperative period were selected as the control group (Group C). Variables such as surgical segment, age, height, weight, body mass index, duration of hospitalization, chronic low back pain (CLBP), duration of pain, anesthesia, surgical approach, fracture pattern, preoperative visual analog scale (pre-op VAS) score, intraoperative VAS score, one-day VAS score, one-month VAS score, lumbar sacral angle, and sacral tilt angle were statistically described and analyzed. RESULTS: In our hospital, the incidence of SCN during the perioperative period of vertebral augmentation procedures is 8.25% (52/630). Among all the segments of patients who developed SCN during the perioperative period, the L1 segment had the highest proportion, which was 29.03% and 35.14% in Groups A and B, respectively. Group B and Group C showed significant differences in duration of hospitalization (P = 0.012), pre-op VAS scores (P = 0.026), and CLBP (P < 0.001). Group A had significantly higher VAS scores preoperatively (P = 0.026) and intraoperatively (P = 0.004) and in CLBP (P = 0.001) than did Group C. LIMITATIONS: This is a retrospective study. Single-center noncontrolled studies may introduce selection bias. The small sample size in each group might have also led to bias. CONCLUSION: Perioperative SCN associated with vertebral augmentation is significantly correlated with preoperative VAS scores and CLBP. In addition, intraoperative VAS scores might be a factor contributing to the nonalleviation or exacerbation of postoperative SCN.
Assuntos
Fraturas da Coluna Vertebral , Humanos , Estudos Retrospectivos , Masculino , Feminino , Idoso , Fraturas da Coluna Vertebral/cirurgia , Pessoa de Meia-Idade , Neuralgia/etiologia , Neuralgia/cirurgia , Fraturas por Compressão/cirurgia , Fraturas por Osteoporose/cirurgia , Vertebroplastia/métodosRESUMO
OBJECTIVE: This study seeks to construct a machine learning model that merges clinical characteristics with ultrasound radiomic analysis-encompassing both the intratumoral and peritumoral-to predict the status of axillary lymph nodes in patients with early-stage breast cancer. METHODS: The study employed retrospective methods, collecting clinical information, ultrasound data, and postoperative pathological results from 321 breast cancer patients (including 224 in the training group and 97 in the validation group). Through correlation analysis, univariate analysis, and Lasso regression analysis, independent risk factors related to axillary lymph node metastasis in breast cancer were identified from conventional ultrasound and immunohistochemical indicators, and a clinical feature model was constructed. Additionally, features were extracted from ultrasound images of the intratumoral and its 1-5 mm peritumoral to establish a radiomics feature formula. Furthermore, by combining clinical features and ultrasound radiomics features, six machine learning models (Logistic Regression, Decision Tree, Support Vector Machine, Extreme Gradient Boosting, Random Forest, and K-Nearest Neighbors) were compared for diagnostic efficacy, and constructing a joint prediction model based on the optimal ML algorithm. The use of Shapley Additive Explanations (SHAP) enhanced the visualization and interpretability of the model during the diagnostic process. RESULTS: Among the 321 breast cancer patients, 121 had axillary lymph node metastasis, and 200 did not. The clinical feature model had an AUC of 0.779 and 0.777 in the training and validation groups, respectively. Radiomics model analysis showed that the model including the Intratumor +3 mm peritumor area had the best diagnostic performance, with AUCs of 0.847 and 0.844 in the training and validation groups, respectively. The joint prediction model based on the XGBoost algorithm reached AUCs of 0.917 and 0.905 in the training and validation groups, respectively. SHAP analysis indicated that the Rad Score had the highest weight in the prediction model, playing a significant role in predicting axillary lymph node metastasis in breast cancer. CONCLUSION: The predictive model, which integrates clinical features and radiomic characteristics using the XGBoost algorithm, demonstrates significant diagnostic value for axillary lymph node metastasis in breast cancer. This model can provide significant references for preoperative surgical strategy selection and prognosis evaluation for breast cancer patients, helping to reduce postoperative complications and improve long-term survival rates. Additionally, the utilization of SHAP enhancing the global and local interpretability of the model.
RESUMO
Meiosis is a highly complex process significantly influenced by transcriptional regulation. However, studies on the mechanisms that govern transcriptomic changes during meiosis, especially in prophase I, are limited. Here, we performed single-cell ATAC-seq of human testis tissues and observed reprogramming during the transition from zygotene to pachytene spermatocytes. This event, conserved in mice, involved the deactivation of genes associated with meiosis after reprogramming and the activation of those related to spermatogenesis before their functional onset. Furthermore, we identified 282 transcriptional regulators (TRs) that underwent activation or deactivation subsequent to this process. Evidence suggested that physical contact signals from Sertoli cells may regulate these TRs in spermatocytes, while secreted ENHO signals may alter metabolic patterns in these cells. Our results further indicated that defective transcriptional reprogramming may be associated with non-obstructive azoospermia (NOA). This study revealed the importance of both physical contact and secreted signals between Sertoli cells and germ cells in meiotic progression.
Assuntos
Comunicação Celular , Meiose , Animais , Masculino , Camundongos , Meiose/fisiologia , Humanos , Células de Sertoli/metabolismo , Células de Sertoli/fisiologia , Testículo/metabolismo , Testículo/citologia , Espermatogênese/fisiologia , Regulação da Expressão Gênica , Azoospermia/genética , Transcrição Gênica , RNA Citoplasmático Pequeno/genética , RNA Citoplasmático Pequeno/metabolismo , Análise da Expressão Gênica de Célula ÚnicaRESUMO
Background: Studies have shown that music therapy can be used as a therapeutic aid for clinical disorders. To evaluate the effects of music therapy (MT) on language communication and social skills in children with autism spectrum disorder (ASD), a meta-analysis was performed on eligible studies in this field. Methods: A systematic search was conducted in eight databases: PubMed, Embase, Web of Science, Cochrane Library databases, the China National Knowledge Infrastructure (CNKI), Wanfang Data, the Chinese Biomedical Literature (CBM) Database, and the VIP Chinese Science and Technology Periodicals Database. The standard mean difference (SMD) values were used to evaluate outcomes, and the pooled proportions and SMD with their 95% confidence intervals (CIs) were also calculated. Results: Eighteen randomized controlled trial (RCT) studies were included, with a total of 1,457 children with ASD. This meta-analysis revealed that music therapy improved their language communication [SMD = -1.20; 95%CI -1.45, -0.94; χ2 (17) = 84.17, I2 = 80%, p < 0.001] and social skills [SMD = -1. 13; 95%CI -1.49, -0.78; χ2 (17) = 162.53, I2 = 90%, p < 0.001]. In addition, behavior [SMD = -1.92; 94%CI -2.56, -1.28; χ2 (13) = 235.08, I2 = 95%, p < 0.001], sensory perception [SMD = -1.62; 95%CI -2.17, -1.08; χ2 (16) = 303.80, I2 = 95%, p < 0.001], self-help [SMD = -2. 14; 95%CI -3.17, -1.10; χ2 (6) = 173.07, I2 = 97%, p < 0.001] were all improved. Conclusion: Music therapy has a positive effect on the improvement of symptoms in children with ASD. Systematic review registration: https://www.crd.york.ac.uk/PROSPERO/.
RESUMO
Nine compounds were isolated and identified from ethanolic extracts of Saposhnikovia divaricata, including one new alkaloid (1), one new pentacyclic triterpenoid (9), and seven known alkaloids (2-8). Structural elucidation of compounds 1 and 9 was established by 1D and 2D NMR spectra referring to the literature, together with high-resolution mass spectrometric analysis. All compounds were evaluated for antiproliferative activity against two cancer cell lines (LN229, A549) in vitro. Compounds (1-9) showed no significant antiproliferative activity.
RESUMO
Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.
RESUMO
The brain presents age-related structural and functional changes in the human life, with different extends between subjects and groups. Brain age prediction can be used to evaluate the development and aging of human brain, as well as providing valuable information for neurodevelopment and disease diagnosis. Many contributions have been made for this purpose, resorting to different machine learning methods. To solve this task and reduce memory resource consumption, we develop a mini architecture of only 10 layers by modifying the deep residual neural network (ResNet), named ResNet mini architecture. To support the ResNet mini architecture in brain age prediction, the brain age dataset (OpenNeuro #ds000228) that consists of 155 study participants (three classes) and the Alzheimer MRI preprocessed dataset that consists of 6400 images (four classes) are employed. We compared the performance of the ResNet mini architecture with other popular networks using the two considered datasets. Experimental results show that the proposed architecture exhibits generality and robustness with high accuracy and less parameter number.
Assuntos
Envelhecimento , Encéfalo , Imageamento por Ressonância Magnética , Redes Neurais de Computação , Humanos , Encéfalo/diagnóstico por imagem , Encéfalo/fisiologia , Envelhecimento/fisiologia , Imageamento por Ressonância Magnética/métodos , Aprendizado Profundo , Idoso , Doença de Alzheimer/diagnóstico por imagem , Aprendizado de Máquina , Feminino , Idoso de 80 Anos ou mais , Masculino , Pessoa de Meia-IdadeRESUMO
BACKGROUND: Despite the success of PD-1 blockade in recurrent/metastatic nasopharyngeal carcinoma (NPC), its effect for locoregionally advanced NPC (LANPC) remains unclear. This study aimed to evaluate the benefit of adding PD-1 blockade to the current standard treatment (gemcitabine and cisplatin IC
Assuntos
Quimiorradioterapia , Quimioterapia de Indução , Carcinoma Nasofaríngeo , Neoplasias Nasofaríngeas , Pontuação de Propensão , Humanos , Masculino , Feminino , Carcinoma Nasofaríngeo/terapia , Carcinoma Nasofaríngeo/mortalidade , Carcinoma Nasofaríngeo/tratamento farmacológico , Pessoa de Meia-Idade , Quimiorradioterapia/métodos , Adulto , Neoplasias Nasofaríngeas/terapia , Neoplasias Nasofaríngeas/mortalidade , Neoplasias Nasofaríngeas/tratamento farmacológico , Quimioterapia de Indução/métodos , Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Protocolos de Quimioterapia Combinada Antineoplásica/efeitos adversos , Receptor de Morte Celular Programada 1/antagonistas & inibidores , Inibidores de Checkpoint Imunológico/uso terapêutico , Idoso , Cisplatino/uso terapêutico , Cisplatino/administração & dosagem , Cisplatino/efeitos adversos , Desoxicitidina/análogos & derivados , Desoxicitidina/uso terapêutico , Desoxicitidina/administração & dosagem , Estudos Retrospectivos , GencitabinaRESUMO
With the increasing problem of antimicrobial drug resistance, the search for new antimicrobial agents has become a crucial task in the field of medicine. Antimicrobial peptides, as a class of naturally occurring antimicrobial agents, possess broad-spectrum antimicrobial activity and lower risk of resistance development. However, traditional screening methods for antimicrobial peptides are inefficient, necessitating the development of an efficient screening model. In this study, we aimed to develop an ensemble learning model for the identification of antimicrobial peptides, named E-CLEAP, based on the Multilayer Perceptron Classifier (MLP Classifier). By considering multiple features, including amino acid composition (AAC) and pseudo amino acid composition (PseAAC) of antimicrobial peptides, we aimed to improve the accuracy and generalization ability of the identification process. To validate the superiority of our model, we employed five-fold cross-validation and compared it with other commonly used methods for antimicrobial peptide identification. In the experimental results on an independent test set, E-CLEAP achieved accuracies of 97.33% and 84% for the AAC and PseAAC features, respectively. The results demonstrated that our model outperformed other methods in all evaluation metrics. The findings of this study highlight the potential of the E-CLEAP model in enhancing the efficiency and accuracy of antimicrobial peptide screening, which holds significant implications for drug development, disease treatment, and biotechnology advancement. Future research can further optimize the model by incorporating additional features and information, as well as validating its reliability on larger datasets and in real-world environments. The source code and all datasets are publicly available at https://github.com/Wangsicheng52/E-CLEAP.
Assuntos
Peptídeos Antimicrobianos , Peptídeos Antimicrobianos/química , Peptídeos Antimicrobianos/farmacologia , Aprendizado de Máquina , Anti-Infecciosos/farmacologia , Anti-Infecciosos/química , Aminoácidos/químicaRESUMO
A general, efficient and practical protocol for Ts2O promoted deoxygenative dithiocarbamation of quinoline N-oxides with in situ generated dithiocarbamic acids from CS2 and amines is reported. The reaction proceeded well under transition-metal free conditions to obtain a variety of novel quinoline-dithiocarbamate compounds with wide functional group tolerance and good to high yields.
RESUMO
The development of gel electrophoresis-based biodetection assays for point-of-care analysis are highly demanding. In this work, we proposed a ratiometric gel electrophoresis-based biosensing platform by employing catalytic hairpin assembly (CHA) process functions as both the signal output and the signal amplification module. Two types of nucleic acids, DNA and miRNA, are chosen for demonstration. The proposed strategy indeed provides a new paradigm for the design of a portable detection platform and may hold great potential for sensitive diagnoses.
Assuntos
Técnicas Biossensoriais , DNA , MicroRNAs , MicroRNAs/análise , Catálise , Eletroforese , Ácidos Nucleicos/análiseRESUMO
Epithelial mesenchymal transition (EMT) is a critical process implicated in the pathogenesis of retinal fibrosis and the exacerbation of diabetic retinopathy (DR) within retinal pigment epithelium (RPE) cells. Apigenin (AP), a potential dietary supplement for managing diabetes and its associated complications, has demonstrated inhibitory effects on EMT in various diseases. However, the specific impact and underlying mechanisms of AP on EMT in RPE cells remain poorly understood. In this study, we have successfully validated the inhibitory effects of AP on high glucose-induced EMT in ARPE-19 cells and diabetic db/db mice. Notably, our findings have identified CBP/p300 as a potential therapeutic target for EMT in RPE cells and have further substantiated that AP effectively downregulates the expression of EMT-related genes by attenuating the activity of CBP/p300, consequently reducing histone acetylation alterations within the promoter region of these genes. Taken together, our results provide novel evidence supporting the inhibitory effect of AP on EMT in RPE cells, and highlight the potential of specifically targeting CBP/p300 as a strategy for inhibiting retinal fibrosis in the context of DR.
Assuntos
Apigenina , Transição Epitelial-Mesenquimal , Glucose , Histonas , Epitélio Pigmentado da Retina , Transição Epitelial-Mesenquimal/efeitos dos fármacos , Epitélio Pigmentado da Retina/efeitos dos fármacos , Epitélio Pigmentado da Retina/metabolismo , Epitélio Pigmentado da Retina/patologia , Animais , Apigenina/farmacologia , Acetilação/efeitos dos fármacos , Humanos , Glucose/metabolismo , Glucose/toxicidade , Histonas/metabolismo , Linhagem Celular , Camundongos , Fatores de Transcrição de p300-CBP/metabolismo , Fatores de Transcrição de p300-CBP/antagonistas & inibidores , Camundongos Endogâmicos C57BL , Retinopatia Diabética/metabolismo , Retinopatia Diabética/patologia , Retinopatia Diabética/tratamento farmacológico , Proteína p300 Associada a E1A/metabolismo , Masculino , Células Epiteliais/efeitos dos fármacos , Células Epiteliais/metabolismo , Células Epiteliais/patologia , Proteína de Ligação a CREB/metabolismo , Proteína de Ligação a CREB/genéticaRESUMO
BACKGROUND: Drug-induced liver injury (DILI) is one of the most common adverse events of medication use, and its incidence is increasing. However, early detection of DILI is a crucial challenge due to a lack of biomarkers and noninvasive tests. AIM: To identify salivary metabolic biomarkers of DILI for the future development of noninvasive diagnostic tools. METHODS: Saliva samples from 31 DILI patients and 35 healthy controls (HCs) were subjected to untargeted metabolomics using ultrahigh-pressure liquid chromatography coupled with tandem mass spectrometry. Subsequent analyses, including partial least squares-discriminant analysis modeling, t tests and weighted metabolite coexpression network analysis (WMCNA), were conducted to identify key differentially expressed metabolites (DEMs) and metabolite sets. Furthermore, we utilized least absolute shrinkage and selection operato and random fores analyses for biomarker prediction. The use of each metabolite and metabolite set to detect DILI was evaluated with area under the receiver operating characteristic curves. RESULTS: We found 247 differentially expressed salivary metabolites between the DILI group and the HC group. Using WMCNA, we identified a set of 8 DEMs closely related to liver injury for further prediction testing. Interestingly, the distinct separation of DILI patients and HCs was achieved with five metabolites, namely, 12-hydroxydodecanoic acid, 3-hydroxydecanoic acid, tetradecanedioic acid, hypoxanthine, and inosine (area under the curve: 0.733-1). CONCLUSION: Salivary metabolomics revealed previously unreported metabolic alterations and diagnostic biomarkers in the saliva of DILI patients. Our study may provide a potentially feasible and noninvasive diagnostic method for DILI, but further validation is needed.
Assuntos
Biomarcadores , Doença Hepática Induzida por Substâncias e Drogas , Metabolômica , Saliva , Humanos , Biomarcadores/análise , Biomarcadores/metabolismo , Doença Hepática Induzida por Substâncias e Drogas/diagnóstico , Doença Hepática Induzida por Substâncias e Drogas/etiologia , Doença Hepática Induzida por Substâncias e Drogas/metabolismo , Saliva/química , Saliva/metabolismo , Masculino , Feminino , Metabolômica/métodos , Pessoa de Meia-Idade , Adulto , Estudos de Casos e Controles , Espectrometria de Massas em Tandem/métodos , Curva ROC , Idoso , Cromatografia Líquida de Alta Pressão , Diagnóstico PrecoceRESUMO
BACKGROUND: The understanding of bile acid (BA) and unsaturated fatty acid (UFA) profiles, as well as their dysregulation, remains elusive in individuals with type 2 diabetes mellitus (T2DM) coexisting with non-alcoholic fatty liver disease (NAFLD). Investigating these metabolites could offer valuable insights into the pathophy-siology of NAFLD in T2DM. AIM: To identify potential metabolite biomarkers capable of distinguishing between NAFLD and T2DM. METHODS: A training model was developed involving 399 participants, comprising 113 healthy controls (HCs), 134 individuals with T2DM without NAFLD, and 152 individuals with T2DM and NAFLD. External validation encompassed 172 participants. NAFLD patients were divided based on liver fibrosis scores. The analytical approach employed univariate testing, orthogonal partial least squares-discriminant analysis, logistic regression, receiver operating characteristic curve analysis, and decision curve analysis to pinpoint and assess the diagnostic value of serum biomarkers. RESULTS: Compared to HCs, both T2DM and NAFLD groups exhibited diminished levels of specific BAs. In UFAs, particular acids exhibited a positive correlation with NAFLD risk in T2DM, while the ω-6:ω-3 UFA ratio demonstrated a negative correlation. Levels of α-linolenic acid and γ-linolenic acid were linked to significant liver fibrosis in NAFLD. The validation cohort substantiated the predictive efficacy of these biomarkers for assessing NAFLD risk in T2DM patients. CONCLUSION: This study underscores the connection between altered BA and UFA profiles and the presence of NAFLD in individuals with T2DM, proposing their potential as biomarkers in the pathogenesis of NAFLD.
RESUMO
BACKGROUND: Liver ischemia/reperfusion (I/R) injury is usually caused by hepatic inflow occlusion during liver surgery, and is frequently observed during war wounds and trauma. Hepatocyte ferroptosis plays a critical role in liver I/R injury, however, it remains unclear whether this process is controlled or regulated by members of the DEAD/DExH-box helicase (DDX/DHX) family. METHODS: The expression of DDX/DHX family members during liver I/R injury was screened using transcriptome analysis. Hepatocyte-specific Dhx58 knockout mice were constructed, and a partial liver I/R operation was performed. Single-cell RNA sequencing (scRNA-seq) in the liver post I/R suggested enhanced ferroptosis by Dhx58hep-/-. The mRNAs and proteins associated with DExH-box helicase 58 (DHX58) were screened using RNA immunoprecipitation-sequencing (RIP-seq) and IP-mass spectrometry (IP-MS). RESULTS: Excessive production of reactive oxygen species (ROS) decreased the expression of the IFN-stimulated gene Dhx58 in hepatocytes and promoted hepatic ferroptosis, while treatment using IFN-α increased DHX58 expression and prevented ferroptosis during liver I/R injury. Mechanistically, DHX58 with RNA-binding activity constitutively associates with the mRNA of glutathione peroxidase 4 (GPX4), a central ferroptosis suppressor, and recruits the m6A reader YT521-B homology domain containing 2 (YTHDC2) to promote the translation of Gpx4 mRNA in an m6A-dependent manner, thus enhancing GPX4 protein levels and preventing hepatic ferroptosis. CONCLUSIONS: This study provides mechanistic evidence that IFN-α stimulates DHX58 to promote the translation of m6A-modified Gpx4 mRNA, suggesting the potential clinical application of IFN-α in the prevention of hepatic ferroptosis during liver I/R injury.
Assuntos
Ferroptose , Traumatismo por Reperfusão , Animais , Camundongos , Diclorodifenil Dicloroetileno , Hepatócitos , Interferon-alfa , RNA , RNA MensageiroRESUMO
Without intervention, a considerable proportion of patients with metabolism-associated fatty liver disease (MAFLD) will progress from simple steatosis to metabolism-associated steatohepatitis (MASH), liver fibrosis, and even hepatocellular carcinoma. However, the molecular mechanisms that control progressive MAFLD have yet to be fully determined. Here, we unraveled that the expression of the N6-methyladenosine (m6A) methyltransferase METTL14 is remarkably downregulated in the livers of both patients and several murine models of MAFLD, whereas hepatocyte-specific depletion of this methyltransferase aggravated lipid accumulation, liver injury, and fibrosis. Conversely, hepatic Mettl14 overexpression alleviated the above pathophysiological changes in mice fed on a high-fat diet (HFD). Notably, in vivo and in vitro mechanistic studies indicated that METTL14 downregulation decreased the level of GLS2 by affecting the translation efficiency mediated by YTHDF1 in an m6A-depedent manner, which might help to form an oxidative stress microenvironment and accordingly recruit Cx3cr1+Ccr2+ monocyte-derived macrophages (Mo-macs). In detail, Cx3cr1+Ccr2+ Mo-macs can be categorized into M1-like macrophages and S100A4-positive macrophages and then further activate hepatic stellate cells (HSCs) to promote liver fibrosis. Further experiments revealed that CX3CR1 can activate the transcription of S100A4 via CX3CR1/MyD88/NF-κB signaling pathway in Cx3cr1+Ccr2+ Mo-macs. Restoration of METTL14 or GLS2, or interfering with this signal transduction pathway such as inhibiting MyD88 could ameliorate liver injuries and fibrosis. Taken together, these findings indicate potential therapies for the treatment of MAFLD progression.
Assuntos
NF-kappa B , Hepatopatia Gordurosa não Alcoólica , Animais , Humanos , Camundongos , Regulação para Baixo/genética , Cirrose Hepática/metabolismo , Macrófagos/metabolismo , Metiltransferases/genética , Metiltransferases/metabolismo , Fator 88 de Diferenciação Mieloide/genética , Fator 88 de Diferenciação Mieloide/metabolismo , NF-kappa B/genética , NF-kappa B/metabolismo , Hepatopatia Gordurosa não Alcoólica/metabolismo , Hepatopatia Gordurosa não Alcoólica/patologia , Receptores de Quimiocinas , Proteína A4 de Ligação a Cálcio da Família S100RESUMO
[This corrects the article DOI: 10.3892/ol.2017.7635.].
RESUMO
BACKGROUND: The diseased bile duct in bilobar congenital biliary dilatation is extensive and often requires major hepatectomy or liver transplantation associated with a higher risk. We aimed to evaluate the safety and benefit of modified mesohepatectomy, in comparison with trisectionectomy, to treat bilobar congenital biliary dilatation. METHODS: This study included 28 patients with type IV and V bilobar congenital biliary dilatation. An innovative mesohepatectomy comprising the hepatectomy technique beyond the P/U point and bile duct shaping was applied to 14 patients to address the extensively diseased bile duct and difficulty in hepaticojejunostomy. Another 14 patients received trisectionectomy. The perioperative and long-term outcomes of these patients were compared. RESULTS: The ratio of residual liver volume to standard liver volume in the mesohepatectomy group was higher (78.68% vs. 40.90%, p = 0.005), while the resection rate of the liver parenchyma was lower (28.25% vs. 63.97%, p = 0.000), than that in trisectionectomy group. The mesohepatectomy group had a lower severe complication (>Clavein III, 0% vs. 57.70%, p = 0.019) and incidence of posthepatectomy liver failure (7.14% vs. 42.86%, p = 0.038). No significant difference was observed in blood loss and bile leakage (p > 0.05). All the patients in the mesohepatectomy group achieved optimal results in the long-term follow-up. CONCLUSIONS: mesohepatectomy provides an efficient treatment option for bilobar congenital biliary dilatation and can achieve radical resection, retain more liver parenchyma, and reduce the difficulty of hepaticojejunostomy, especially for patients that are not eligible for major hepatectomy and liver transplantation.