Chromatin binding protein HMGN1 promotes HBV cccDNA transcription and replication by regulating the phosphorylation of histone 3.

BACKGROUND AND AIMS: Direct elimination of cccDNA remains a formidable obstacle due to the persistent and stable presence of cccDNA in hepatocyte nuclei. The silencing of cccDNA transcription enduringly is one of alternative strategies in the treatment of hepatitis B. Protein binding to cccDNA plays an important role in its transcriptional regulation; thus, the identification of key factors involved in this process is of great importance. APPROACHES AND RESULTS: In the present study, high mobility group nucleosome binding domain 1 (HMGN1) was screened out based on our biotin-avidin enrichment system. First, chromatin immunoprecipitation and fluorescent in situ hybridization assays confirmed the binding of HMGN1 with cccDNA in the nucleus. Second, functional experiments in HBV-infected cells showed that the promoting effect of HMGN1 on HBV transcription and replication depended on the functional region of the nucleosomal binding domain, while transfection of the HMGN1 mutant showed no influence on HBV compared with the vector. Third, further mechanistic exploration revealed that the silencing of HMGN1 increased the level of phosphorylase CLK2 and promoted H3 phosphorylation causing the reduced accessibility of cccDNA. Moreover, silenced HMGN1 was mimicked in HBV (r) cccDNA mouse model of HBV infection in vivo. The results showed that silencing HMGN1 inhibited HBV replication in vivo. CONCLUSIONS: In summary, our study identified that a host protein can bind to cccDNA and promote its transcription, providing a candidate strategy for anti-HBV targeting to interfere with the transcriptional activity of cccDNA microchromosomes.

The strategy and prospect of gene therapy in neurogenetic diseases / 中华神经科杂志

Most of the neurogenetic disorders could not be cured until now. With the development of molecular biological techniques, gene therapies show brilliant application prospects in neurogenetic disorders, which contain gene supplementation, exon skipping, splicing enhancement, dynamic mutation correction and toxic expression product elimination, and so on.

Rapid diagnosis of hereditary neuropathy with liability to pressure palsies by multiplex ligation-dependent probe amplification / 中华神经科杂志

Objective To introduce the application of multiplex ligation-dependent probe amplification (MLPA) assays in the diagnosis of patients with hereditary neuropathy with liability to pressure palsies (HNPP).Methods Copy numbers of the exons in peripheral myelin prolein 22 (PMP22) gene,tektin 3 (TEKT3) gene and cytochrome c oxidase assembly protein 10 (COX10) gene were analyzed by MLPA in 8 patients diagnosed with HNPP clinically and 5 normal controls.Results Among the 8 patients,7 patients were identified to have deletion mutations according to their reduced peak area of PMP22 gene,TEKT3 gene and COX10 gene compared with that of normal controls.One patient with normal peak area of PMP22 gene,TEKT3 gene and COX10 gene showed no deletion of these genes.Conclusions MLPA assays can detect the copy numbers of genes in HNPP region through semi-quantitative analysis in a rapid,accurate way,which may be utilized widely in the genetic diagnosis among HNPP patients.

[The construction of urine-derived cell lines from patients with spinal muscular atrophy].

Spinal muscular atrophy (SMA) is a common neurodegenerative disease in childhood and infancy, clinically characterized by progressive and symmetric muscular weakness and atrophy. Few effective therapies are available now, and SMA is one of the most common genetic causes of infantile mortality. SMA patient-derived cells are beneficial in basic research on this disease, but the most common model cell, fibroblasts can only be obtained through invasive procedures such as muscle or skin biopsy, which are unwelcome to patients and their families. In this study, fresh urine from SMA patients and healthy controls was collected and centrifuged, and the urine sediment was cultured in vitro. The growth characteristics of urine-derived cells were observed, and the survival of motor neuron (SMN) gene, and the amount and localization of SMN protein in different urine cell lines were investigated. In total, 25 urine cell lines from 11 SMA patients and 14 healthy controls were established. These urine-derived cells expand robustly in vitro with stable cell morphological characteristics. The urine cell lines derived from patients carry the SMN1 gene defect and express a low level of SMN protein, while the intracellular localization of SMN protein is normal. Urine-derived cell culture technology is simple, non-invasive and highly reproducible, a way of obtaining and storing rare cell samples from SMA patients with which to study the pathogenesis of SMA.

Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative / 中华神经科杂志

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Investigation of survival motor neuron gene deletion in Chinese patients with sporadic amyotrophic lateral sclerosis / 中华神经科杂志

Objective To investigate the correlation between survival motor neuron (SMN) gene deletion and Chinese patients with sporadic amyotrophic lateral sclerosis (SALS).Methods A total of 141SALS patients and 134 unrelated controls were recruited from the Chinese population.Polymerase chain reaction (PCR) and restriction fragment length polymorphisro (RFLP) analysis were performed to screen SMN gene deletion.Frequencies of deletion were coropared by Chi-square test.Results Four patients and 3 controls were detected to have horoozygous SMN2 deletion.The frequencies of SMN2 deletion were 2.84%(4/141) and 2.24% (3/134), respectively, which was not significantly different (χ2= 0.0001, P =1.000).No subjects were found to have homozygous SMN1 deletion.Condusion There is no correlation between SMN gene deletion and Chinese patients with SALS.