RESUMO
Trillions of intestinal bacteria in the human body undergo dynamic transformations in response to physiological and pathological changes. Alterations in their composition and metabolites collectively contribute to the progression of Alzheimer's disease. The role of gut microbiota in Alzheimer's disease is diverse and complex, evidence suggests lipid metabolism may be one of the potential pathways. However, the mechanisms that gut microbiota mediate lipid metabolism in Alzheimer's disease pathology remain unclear, necessitating further investigation for clarification. This review highlights the current understanding of how gut microbiota disrupts lipid metabolism and discusses the implications of these discoveries in guiding strategies for the prevention or treatment of Alzheimer's disease based on existing data.
Assuntos
Doença de Alzheimer , Microbioma Gastrointestinal , Humanos , Doença de Alzheimer/metabolismo , Microbioma Gastrointestinal/fisiologia , Metabolismo dos Lipídeos , Progressão da Doença , LipídeosRESUMO
Metallo-ß-lactamases (MBLs) are zinc-dependent enzymes capable of hydrolyzing all bicyclic ß-lactam antibiotics, posing a great threat to public health. However, there are currently no clinically approved MBL inhibitors. Despite variations in their active sites, MBLs share a common catalytic mechanism with carbapenems, forming similar reaction species and hydrolysates. We here report the development of 2-aminothiazole-4-carboxylic acids (AtCs) as broad-spectrum MBL inhibitors by mimicking the anchor pharmacophore features of carbapenem hydrolysate binding. Several AtCs manifested potent activity against B1, B2, and B3 MBLs. Crystallographic analyses revealed a common binding mode of AtCs with B1, B2, and B3 MBLs, resembling binding observed in the MBL-carbapenem product complexes. AtCs restored Meropenem activity against MBL-producing isolates. In the murine sepsis model, AtCs exhibited favorable synergistic efficacy with Meropenem, along with acceptable pharmacokinetics and safety profiles. This work offers promising lead compounds and a structural basis for the development of potential drug candidates to combat MBL-mediated antimicrobial resistance.
Assuntos
Carbapenêmicos , Inibidores de beta-Lactamases , Animais , Camundongos , Inibidores de beta-Lactamases/farmacologia , Inibidores de beta-Lactamases/química , Carbapenêmicos/farmacologia , Meropeném/farmacologia , Ácidos Carboxílicos , beta-Lactamases/metabolismo , Antibacterianos/farmacologia , Antibacterianos/químicaRESUMO
With the development of near-infrared II (NIR-II) fluorescence imaging, Ag2Se quantum dots (QDs) have become promising label candidates due to their negligible toxicity and narrow band gap. Despite their potential for gastrointestinal (GI) imaging, the application of Ag2Se QDs still presents significant challenges due to issues such as fluorescence extinction or poor stability in the complex digestive microenvironment. Herein, we have proposed a novel approach to the continuous production of Se precursors using glutathione (GSH) as the reductant under acidic conditions, realizing the continuous growth of water-dispersible Ag2Se QDs. The Ag2Se QDs emitting at 600-1100 nm have been successfully synthesized. Meanwhile, the silver-rich surface of the synthesized NIR-II Ag2Se QDs has been passivated well with the dense GSH, resulting in exceptional colloidal stability and photostability and endowing them with acid resistance. As a result, the obtained NIR-II Ag2Se QDs have exhibited remarkable stability in gastric acid, thus enabling their utilization for long-term real-time monitoring of GI peristalsis via NIR-II fluorescence imaging. Moreover, in contrast to conventional barium meal-based X-ray imaging, NIR-II fluorescence imaging with as-prepared NIR-II Ag2Se QDs can offer clearer visualization of fine intestinal structures, with a width as small as 1.07 mm. The developed strategy has offered a new opportunity for the synthesis of acid-resistant nanocrystals, and the acid-resistant, low-toxicity, and biocompatible NIR-II Ag2Se QDs synthesized in this work show a great promise for GI imaging and diagnosis of GI diseases in vivo.
Assuntos
Nanopartículas , Pontos Quânticos , Pontos Quânticos/toxicidade , Pontos Quânticos/química , Nanopartículas/química , Fluorescência , Prata/químicaRESUMO
As the canonical model organism to dissect bacterial morphological development, Streptomyces species has attracted much attention from the microbiological society. However, the evolution of development-related genes in Streptomyces remains elusive. Here, we evaluated the distribution of development-related genes, thus indicating that the majority of these genes were ubiquitous in Streptomyces genomes. Furthermore, the phylogenetic topologies of related strict orthologous genes were compared to the species tree of Streptomyces from both concatenation and single-gene tree analyses. Meanwhile, the reconciled gene tree and normalization based on the number of parsimony-informative sites were also employed to reduce the impact of phylogenetic conflicts, which was induced by uncertainty in single-gene tree inference based merely on the sequence and the bias in the amount of phylogenetic information caused by variable numbers of parsimony-informative sites. We found that the development-related genes had higher congruence to the species tree than other strict orthologous genes. Considering that the development-related genes could also be tracked back to the common ancestor of Streptomyces, these results suggest that morphological development follows the same pattern as species divergence.
RESUMO
Several groups of bacteria have complex life cycles involving cellular differentiation and multicellular structures. For example, actinobacteria of the genus Streptomyces form multicellular vegetative hyphae, aerial hyphae, and spores. However, similar life cycles have not yet been described for archaea. Here, we show that several haloarchaea of the family Halobacteriaceae display a life cycle resembling that of Streptomyces bacteria. Strain YIM 93972 (isolated from a salt marsh) undergoes cellular differentiation into mycelia and spores. Other closely related strains are also able to form mycelia, and comparative genomic analyses point to gene signatures (apparent gain or loss of certain genes) that are shared by members of this clade within the Halobacteriaceae. Genomic, transcriptomic and proteomic analyses of non-differentiating mutants suggest that a Cdc48-family ATPase might be involved in cellular differentiation in strain YIM 93972. Additionally, a gene encoding a putative oligopeptide transporter from YIM 93972 can restore the ability to form hyphae in a Streptomyces coelicolor mutant that carries a deletion in a homologous gene cluster (bldKA-bldKE), suggesting functional equivalence. We propose strain YIM 93972 as representative of a new species in a new genus within the family Halobacteriaceae, for which the name Actinoarchaeum halophilum gen. nov., sp. nov. is herewith proposed. Our demonstration of a complex life cycle in a group of haloarchaea adds a new dimension to our understanding of the biological diversity and environmental adaptation of archaea.
Assuntos
Halobacteriaceae , Streptomyces , Hifas/genética , Proteômica , Filogenia , RNA Ribossômico 16S/genética , Streptomyces/genética , Halobacteriaceae/genética , Esporos , Diferenciação Celular , Análise de Sequência de DNA , ChinaRESUMO
Mutations in epidermal growth factor receptor and anaplastic lymphoma kinase are common driver events in non-small cell lung cancer (NSCLC), which are associated with a high frequency of bone metastases (BMs). While the bone marrow represents a specialized immune microenvironment, the immune repertoire of BMs remains unknown. Considering the higher incidence of BMs in driver gene-positive NSCLCs, and the unique biology of the bone, herein, we assessed the infiltrating immune cells and T cell receptor (TCR) profile of BMs in driver-positive NSCLCs. Immune profile of BMs in driver gene-positive NSCLC were assessed in 10 patients, where 6 had driver gene-positive mutation. TCR and bulk RNA sequencing were performed on malignant bone samples. The diversity and clonality of the TCR repertoire were analyzed. The cellular components were inferred from bulk gene expression profiles computationally by CIBERSORT. Although BMs were generally regarded as immune-cold tumors, immune cell composition analyses showed co-existence of cytotoxic and suppressor immune cells in driver-positive BM samples, as compared to primary lung. Analysis of the TCR repertoire indicated a trend of higher diversity and similar clonality in the driver-positive compared with the driver-negative subsets. In addition, we identified two cases that showed the opposite response to immune checkpoint blockade. A comparison of these two patients' BM samples showed more highly amplified clones, fewer M2 macrophages and more activated natural killer cells in the responder. In summary, BMs in NSCLC are heterogeneous in their immune microenvironment, which might be related to differential clinical outcomes to immune checkpoint blockade.
Assuntos
Neoplasias Ósseas , Carcinoma Pulmonar de Células não Pequenas , Neoplasias Pulmonares , Humanos , Carcinoma Pulmonar de Células não Pequenas/patologia , Neoplasias Pulmonares/patologia , Inibidores de Checkpoint Imunológico/uso terapêutico , Pulmão/patologia , Neoplasias Ósseas/genética , Receptores de Antígenos de Linfócitos T/genética , Microambiente Tumoral/genéticaRESUMO
BACKGROUND: Melatonin is considered to be a polyfunctional master regulator in animals and higher plants. Exogenous melatonin inhibits plant infection by multiple diseases; however, the role of melatonin in Cucumber green mottle mosaic virus (CGMMV) infection remains unknown. RESULTS: In this study, we demonstrated that exogenous melatonin treatment can effectively control CGMMV infection. The greatest control effect was achieved by 3 days of root irrigation at a melatonin concentration of 50 µM. Exogenous melatonin showed preventive and therapeutic effects against CGMMV infection at early stage in tobacco and cucumber. We utilized RNA sequencing technology to compare the expression profiles of mock-inoculated, CGMMV-infected, and melatonin+CGMMV-infected tobacco leaves. Defense-related gene CRISP1 was specifically upregulated in response to melatonin, but not to salicylic acid (SA). Silencing CRISP1 enhanced the preventive effects of melatonin on CGMMV infection, but had no effect on CGMMV infection. We also found exogenous melatonin has preventive effects against another Tobamovirus, Pepper mild mottle virus (PMMoV) infection. CONCLUSIONS: Together, these results indicate that exogenous melatonin controls two Tobamovirus infections and inhibition of CRISP1 enhanced melatonin control effects against CGMMV infection, which may lead to the development of a novel melatonin treatment for Tobamovirus control.
Assuntos
Melatonina , Tobamovirus , Reguladores de Crescimento de Plantas , Cisteína , Melatonina/farmacologia , Tobamovirus/genética , Nicotiana/genética , Doenças das Plantas/genéticaRESUMO
OBJECTIVES: Genus Clostridium sensu stricto is generally regarded as the true Clostridium genus, which includes important human and animal pathogens and industrially relevant microorganisms. Besides, it is also a prominent member of plant-associated endophytes. However, our knowledge of endophytic Clostridium is limited. METHODS: In this study, the endophytes were isolated under anaerobic condition from the roots of Paris polyphylla Smith var. yunnanensis. Subsequently, a polyphasic taxonomic approach was used to clarify their taxonomic positions. The fermentation products were measured in the isolates with HPLC analysis. Comparative genomics was performed on these new strains and other relatives. RESULTS: In total, nine endophytic strains belonging to the genus Clostridium sensu stricto were isolated, and three of them were identified as new species. Seven of nine strains could produce acetate, propionate, and butyrate. Only two strains could produce ethanol, although genomics analysis suggested that only two of them were without genes for solventogenesis. Different from the endophytic strains, the phylogenetically closely related non-endophytic strains showed significant enrichment effects on some metabolic pathways involving environmental information processing, carbohydrate, and amino acid metabolisms, etc. It suggests that the genomes of these endophytic strains had undergone subtle changes associated with environmental adaptations. CONCLUSION: Consequently, strains YIM B02505T, YIM B02515T, and YIM B02565T are proposed to represent a new species of the genus Clostridium sensu stricto, for which the names Clostridium yunnanense sp. nov., Clostridium rhizosphaerae sp. nov., and Clostridium paridis sp. nov. are suggested.
Assuntos
Endófitos , Ácidos Graxos , Humanos , Endófitos/genética , Ácido Acético , Etanol , Análise de Sequência de DNA , Composição de Bases , Clostridium/genética , RNA Ribossômico 16S/genética , Genômica , Filogenia , DNA Bacteriano/genética , Técnicas de Tipagem BacterianaRESUMO
The movement protein (MP) and coat protein (CP) of tobamoviruses play critical roles in viral cell-to-cell and long-distance movement, respectively. Cucumber green mottle mosaic virus (CGMMV) is a member of the genus Tobamovirus. The functions of CGMMV MP and CP during viral infection remain largely unclear. Here, we show that CGMMV MP can interact with CP in vivo, and the amino acids at positions 79-128 in MP are vital for the MP-CP interaction. To confirm this finding, we mutated five conserved residues within the residue 79-128 region and six other conserved residues flanking this region, followed by in vivo interaction assays. The results showed that the conserved threonine residue at the position 107 in MP (MPT107 ) is important for the MP-CP interaction. Substitution of T107 with alanine (MPT107A ) delayed CGMMV systemic infection in Nicotiana benthamiana plants, but increased CGMMV local accumulation. Substitutions of another 10 conserved residues, not responsible for the MP-CP interaction, with alanine inhibited or abolished CGMMV systemic infection, suggesting that these 10 conserved residues are possibly required for the MP movement function through a CP-independent manner. Moreover, two movement function-associated point mutants (MPF17A and MPD97A ) failed to cause systemic infection in plants without impacting on the MP-CP interaction. Furthermore, we have found that co-expression of CGMMV MP and CP increased CP accumulation independent of the interaction. MP and CP interaction inhibits the salicylic acid-associated defence response at an early infection stage. Taken together, we propose that the suppression of host antiviral defence through the MP-CP interaction facilitates virus systemic infection.
Assuntos
Tobamovirus , Proteínas do Capsídeo/genética , Nicotiana , Doenças das PlantasRESUMO
The surface of nanocrystals plays a dominant role in many of their physical and chemical properties. However, controllability and tunability of nanocrystal surfaces remain unsolved. Herein, we report that the surface chemistry of nanocrystals, such as near-infrared Ag2Se quantum dots (QDs), is size-dependent and composition-tunable. The Ag2Se QDs tend to form a stable metal complex on the surface to minimize the surface energy, and therefore the surface chemistry can be varied with particle size. Meanwhile, changes in surface inorganic composition lead to reorganization of the surface ligands, and the surface chemistry also varies with composition. Therefore, the surface chemistry of Ag2Se QDs, responsible for the photoluminescence (PL) quantum yield and photostability, can be tuned by changing their size or composition. Accordingly, we demonstrate that the PL intensity of the Ag2Se QDs can be tuned reversely by adjusting the degree of surface Ag+ enrichment via light irradiation or the addition of AgNO3. This work provides insight into the control of QD surface for desired PL properties.
Assuntos
Nanopartículas , Pontos Quânticos , Pontos Quânticos/química , Nanopartículas/química , Semicondutores , Tamanho da PartículaRESUMO
A Gram-negative, facultative anaerobic bacterial strain, designated YIM B02556T, was isolated from the root of Paris polyphylla Smith var. yunnanensis collected from Yunnan Province, southwest China. By using a polyphasic approach, its taxonomic position was investigated. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain YIM B02556T belonged to the genus Azospirillum and the 16S rRNA gene sequence similarity values of strain YIM B02556T to the type strains of members of this genus ranged from 94.9 to 98.3%. Overall genome relatedness index (OGRI) analysis estimated based on average nucleotide identity (ANI) and digital DNA-DNA hybridization (dDDH) between YIM B02556T and other Azospirillum species type strains were <90.8% and <37.8%, lower than the limit of species circumscription. Cells of the strain were characterized as oxidase- and catalase-positive, with motility provided by flagella. The growth conditions of the strain were found to occur at 20-40 °C (optimum, 35 °C), and pH 6.0-9.5 (optimum, pH 7.5). Strain YIM B02556T can tolerate 2% NaCl concentration. Strain YIM B02556T contained Q-10 as the major ubiquinone. The major fatty acids were C18:1 ω7c and summed feature three (C16:1 ω7c and/or C16:1 ω6c). The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol, and phosphatidylethanolamine. Based on polyphasic analysis, strain YIM B02556T could be differentiated genotypically and phenotypically from recognized species of the genus Azospirillum. Therefore, the isolate represents a novel species, for which the name Azospirillum endophyticum is proposed. The type strain is YIM B02556T (=JCM 34631T=CGMCC 1.18654T).
Assuntos
Azospirillum , RNA Ribossômico 16S/genética , Azospirillum/genética , Filogenia , Endófitos/genética , Composição de Bases , DNA Bacteriano/genética , Técnicas de Tipagem Bacteriana , Análise de Sequência de DNA , Fosfolipídeos/análise , China , Ácidos Graxos/análiseRESUMO
Perfluoroalkyl acids (PFAAs) are emerging ionic organic pollutants worldwide. Great amounts of extracellular DNA (â¼mg/kg) coexist with PFAAs in the environment. However, PFAA-DNA interactions and effects of such interactions have not been well studied. Herein, we used isothermal titration calorimetry (ITC), spectroscopy, and computational simulations to investigate the PFAA-DNA interactions. ITC assays showed that specific binding affinities of PFHxA-DNA, PFOA-DNA, PFNA-DNA, and PFOS-DNA were 5.14 × 105, 3.29 × 105, 1.99 × 105, and 2.18 × 104 L/mol, respectively, which were about 1-2 orders of magnitude stronger than those of PFAAs with human serum albumin. Spectral analysis suggested interactions of PFAAs with adenine (A), cytosine (C), guanine (G), and thymine (T), among which grooves associated with thymine were the major binding sites. Molecular dynamics simulations and quantum chemical calculations suggested that hydrogen bonds and van der Waals forces were the main interaction forces. Such a PFAA-DNA binding decreased the bioavailability of PFAAs in plant seedlings. The findings will help to improve the current understanding of the interaction between PFAAs and biomacromolecules, as well as how such interactions affect the bioavailability of PFAAs.
Assuntos
Brassica , Fluorocarbonos , Humanos , Fluorocarbonos/análise , Disponibilidade Biológica , Brassica/genética , Brassica/metabolismo , Timina , DNA/metabolismoRESUMO
Despite limited efficacy of immunotherapy for advanced non-small-cell lung cancer (NSCLC) with driver mutations, whether neoadjuvant immunotherapy could be clinically valuable in those patients warrants further investigation. We utilized 40 oncogene-mutant NSCLC treated with induction immunotherapy from a large consecutive multicenter cohort. Overall response rate was 62.5% while 2 patients had disease progression. Of 39 patients that received surgery, R0 resection rate was 97.4%. The major pathological response (MPR) rate was 37.5% and the pathological complete response (pCR) rate was 12.5%. Pre-treatment PD-L1 expression was not a predictive biomarker in these patients. Median disease-free survival for all oncogenic mutation and EGFR mutation was 28.5 months. Indirect comparison through integrating CTONG1103 cohort showed neoadjuvant immunotherapy plus chemotherapy yielded the most superior efficacy among erlotinib and chemotherapy for resectable EGFR-mutant NSCLC. No MPR patients were identified with neoadjuvant immunotherapy plus chemotherapy for uncommon EGFR insertion or point mutations. Our results indicated the potential clinical feasibility of neoadjuvant immunotherapy for resectable localized oncogene-mutant NSCLC especially for EGFR-mutant NSCLC.
RESUMO
In the genus Streptomyces, several validly described species have been reduced to synonyms of earlier described species though additional synonyms remain to be detected given the previous dependence on traditional phenotypic methods. In this study, genome-based procedures, including DNA-DNA hybridization analyses, overall genome-related indices, such as ANI, dDDH and AAI, revealed that certain strains recorded genomic indices above the threshold values used to define species boundaries. The results of phylogenetic and phylogenomic trees based on concatenated and phylogenomic analyses showed that 33 out of 364 tested species could be assigned to 15 species groups and that 18 Streptomyces species names be reclassified as later heterotypic synonyms of earlier validly published species. Consequently, it is proposed that S. albaduncus is a later heterotypic synonym of S. griseoloalbus; S. bellus is a synonym of S. coeruleorubidus; S. gancidicus and S. rubiginosus are synonyms of S. pseudogriseolus; S. niveoruber is a synonym of S. griseoviridis; S. griseomycini is a synonym of S. griseostramineus; S. jietaisiensis is a synonym of S. griseoaurantiacus; S. pluricolorescens is a synonym of S. rubiginosohelvolus; S. nashvillensis is a synonym of S. tanashiensis; S. yerevanensis is a synonym of S. flaveus; S. durhamensis is a synonym of S. filipinensis; S. recifensis is a synonym of S. griseoluteus; S. canaries and S. olivaceoviridis are synonyms of S. corchorusii; S. melanosporofaciens is a synonym of S. antimycoticus; S. albulus is a synonym of S. noursei; and S. janthinus and S. violarus are synonyms of S. violaceus. Additionally, seven of these 18 Streptomyces species have been designated subspecies.
Assuntos
Streptomyces , Técnicas de Tipagem Bacteriana , DNA Bacteriano/genética , Hibridização de Ácido Nucleico , Filogenia , Análise de Sequência de DNA , Streptomyces/genéticaRESUMO
A novel moderately halophilic, Gram-stain-negative, catalase- and oxidase-positive, strictly aerobic, non-sporulating, non-motile rod, designated strain JSM 104105 T, was isolated from human faeces. Strain JSM 104105 T was able to grow with 0.5-18% (w/v) NaCl (optimum 4-9%), at pH 6-10.5 (optimum pH 7-8) and at 10-40 °C (optimum 30 °C) in complex media. The major cellular fatty acids were C18:1ω7c, C16:0, C16:1ω7c and/or C16:1ω6c, C19:0 cyclo ω8c and C12:0 3-OH. The polar lipids consisted of diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, an unidentified aminophospholipid, an unidentified glycolipid and three unidentified phospholipids. The predominant respiratory quinone was Q-9 and the genomic DNA G + C content was 64.5 mol%. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain JSM 104105 T should be assigned to the genus Halomonas, and was most closely related to Halomonas gudaonensis SL014B-69 T (99.0% sequence similarity), followed by Halomonas azerbaijanica TBZ202T (98.6%) and Halomonas lysinitropha 3(2)T (97.3%). The whole genomic analysis showed that strain JSM 104105 T constituted a different taxon separated from the recognized Halomonas species. Combined data from phenotypic and genotypic studies demonstrated that strain JSM 104105 T represents a new species of the genus Halomonas, for which the name Halomonas faecis sp. nov. is proposed. The type strain is JSM 104105 T (= CCTCC AB 2014160 T = CGMCC 1.12945 T = KCTC 42146 T).
Assuntos
Halomonas , Técnicas de Tipagem Bacteriana , DNA Bacteriano/genética , Ácidos Graxos/química , Fezes , Humanos , Hibridização de Ácido Nucleico , Filogenia , RNA Ribossômico 16S/genética , Análise de Sequência de DNARESUMO
The electrochemical oxidation method is a promising technology for the degradation of perfluorooctane sulfonate (PFOS). However, the elimination processes of PFOS are still unknown, including the electron transfer pathway, key reactive sites, and degradation mechanism. Here, we fabricated diatomite and cerium (Ce) co-modified Sb2O3 (D-Ce/Sb2O3) anode to realize efficient degradation of PFOS via peroxymonosulfate (PMS) activation. The transferred electron and the generated hydroxyl radical (â¢OH) can high-effectively decompose PFOS. The electron can be rapidly transferred from the highest occupied molecular orbital of the PFOS to the lowest unoccupied molecular orbital of the PMS via the D-Ce/Sb2O3 driven by a potential energy difference under electrochemical process. The active site of Ce-O in the D-Ce/Sb2O3 can greatly reduce the migration distance of the electron and the â¢OH, and thus improving the catalytic activity for degrading various organic micropollutants with high stability. In addition, the electrochemical process shows strong resistance and tolerance to the changing pH, inorganic ions, and organic matter. This study offers insights into the electron transfer pathway and PMS activation mechanism in PFOS removal via electrochemical oxidation, paving the way for its potential application in water purification.
Assuntos
Ácidos Alcanossulfônicos , Poluentes Químicos da Água , Domínio Catalítico , Fluorocarbonos , Peróxidos/química , Água , Poluentes Químicos da Água/químicaRESUMO
A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.
RESUMO
A novel endophytic strain, designated YIM B02564T, was isolated from the root of Paris polyphylla Smith var. yunnanensis obtained from Yunnan Province, southwest China. By using a polyphasic approach, cells of the strain were characterized as facultative anaerobic, Gram-positive and rod-shaped. The growth conditions of the strain were found to occur at 20-55 °C (optimum, 30 °C), pH 6.0-9.0 (optimum, pH 7.0). Strain YIM B02564T can tolerate 2% NaCl concentration. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain YIM B02564T belonged to the genus Neobacillus and the 16S rRNA gene sequence similarity values of strain YIM B02564T to the type strains of members of this genus ranged from 95.6 to 97.8%. The DNA G+C content of strain YIM B02564T calculated from the whole genome sequence was 41.6 mol%. Values of the ANI and the dDDH between strain YIM B02564T and its closely related Neobacillus species were below 77.9% and 21.5%. Strain YIM B02564T contained MK-7 as the major menaquinone, iso-C15:0 and anteiso-C15:0 as the major fatty acids. The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, an unidentified aminophospholipid and four unidentified lipids. It contained meso-diaminopimelic acid in the cell-wall peptidoglycan. On the basis of polyphasic analysis, strain YIM B02564T could be differentiated genotypically and phenotypically from recognized species of the genus Neobacillus. The isolate therefore represents a novel species, for which the name Neobacillus paridis is proposed. The type strain is YIM B02564T (= JCM 34668T = CGMCC 1.18655T).
Assuntos
Endófitos , Liliaceae , Técnicas de Tipagem Bacteriana , China , DNA Bacteriano/genética , Endófitos/genética , Ácidos Graxos/análise , Hibridização de Ácido Nucleico , Fosfolipídeos , Filogenia , RNA Ribossômico 16S/genética , Análise de Sequência de DNARESUMO
A novel endophytic actinobacterium, designated as strain YIM B02568T, was isolated from the root of Paris polyphylla Smith var. Yunnanensis obtained from Yunnan Province, southwest China. Strain YIM B02568T was characterized using a polyphasic approach. Phylogenetic analysis indicated that this isolate belonged to the genus Janibacter. The 16S rRNA gene sequence similarity values of strain YIM B02568T to the type strains of members of this genus ranged from 95.8 to 98.6%. However, overall genome relatedness indices were significantly lower than the widely accepted species-defined threshold. The cell wall of strain YIM B02568T contained meso-diaminopimelic acid. The major menaquinone was MK-8(H4). The main polar lipids were phosphatidylglycerol, diphosphatidylglycerol, and phosphatidylinositol. The major cellular fatty acids were comprised of iso-C16:0 and C18:1 ω9c. The DNA G + C content was 71.6 mol%. Based on the data from the polyphasic studies, we propose that strain YIM B02568T represents a novel species within the genus Janibacter, Janibacter endophyticus sp. nov. The type strain is YIM B02568T (= JCM 34639T = CGMCC 1.18658T).