Mechanism of Plasmon-Induced Catalysis of Thiolates and the Impact of Reaction Conditions.

The conversion of the thiols 4-aminothiophenol (ATP) and 4-nitrothiophenol (NTP) can be considered as one of the standard reactions of plasmon-induced catalysis and thus has already been the subject of numerous studies. Currently, two reaction pathways are discussed: one describes a dimerization of the starting material yielding 4,4'-dimercaptoazobenzene (DMAB), while in the second pathway, it is proposed that NTP is reduced to ATP in HCl solution. In this combined experimental and theoretical study, we disentangled the involved plasmon-mediated reaction mechanisms by carefully controlling the reaction conditions in acidic solutions and vapor. Motivated by the different surface-enhanced Raman scattering (SERS) spectra of NTP/ATP samples and band shifts in acidic solution, which are generally attributed to water, additional experiments under pure gaseous conditions were performed. Under such acidic vapor conditions, the Raman data strongly suggest the formation of a hitherto not experimentally identified stable compound. Computational modeling of the plasmonic hybrid systems, i.e., regarding the wavelength-dependent character of the involved electronic transitions of the detected key intermediates in both reaction pathways, confirmed the experimental finding of the new compound, namely, 4-nitrosothiophenol (TP*). Tracking the reaction dynamics via time-dependent SERS measurements allowed us to establish the link between the dimer- and monomer-based pathways and to suggest possible reaction routes under different environmental conditions. Thereby, insight at the molecular level was provided with respect to the thermodynamics of the underlying reaction mechanism, complementing the spectroscopic results.

Circ_UBAP2 exacerbates proliferation and metastasis of OS via targeting miR-665/miR-370-3p/HMGA1 axis.

Circ_UBAP2 is extensively engaged in regulating the development of various malignancies, containing osteosarcoma (OS). However, its biological significance and function are not fully understood. In this study, we found that circ_UBAP2 and HMGA1 levels were up-regulated, and miR-370-3p and miR-665 expressions were decreased in osteosarcoma tissues. Inhibition of circ_UBAP2 or HMGA1 expression in OS cells, cell viability, invasion and migration abilitities were notably hindered, and cell apoptosis abilities were increased. Bioinformatics analysis predicted that miR-665 and miR-370-3p were the downstream targets of circ_UBAP2, and the dual luciferase experiment demonstrated the correlation between them. In addition, inhibition of miR-665 and miR-370-3p expression could significantly reverse the impact of knocking down circ_UBAP2 on OS cells. HMGA1 was discovered to become the downstream target of both miR-665 and miR-370-3p. It was shown that over-expression of miR-665 or miR-370-3p notably stimulated the cell growth, invasion, and migration of osteosarcoma cells, while hindered cell apoptosis. Nevertheless, this effect could be reversed by concurrent over-expression of HMGA1. Our data strongly prove that circ_UBAP2 makes a vital impact on promoting the proliferation, invasion as well as migration of osteosarcoma cells via down-regulating the level of miR-665 and miR-370-3p, and later up-regulating the level of HMGA1. In conclusion, circ_UBAP2 is upregulated in osteosarcoma, and it competitively adsorbs miR-370-3p and miR-665, resulting in up-regulation of HMGA1, thus promoting OS development.

LncRNA CECR7 boosts hepatocellular carcinoma progression by recruiting RNA binding protein U2AF2 to enhance the stability of EXO1 mRNA.

Objective: As an important factor tumor regulator，long non-coding RNAs (lncRNAs) have aroused extensive attention via the diverse functional mechanisms that were associated with the pathological and physiological processes of HCC. Here, the main purpose of this study was to provide a clear understanding about the expression, functions and potential mechanism of lncRNA CECR7 (Cat Eye Syndrome Chromosome Region, Candidate 7) in HCC. Methods: RT-qPCR analysis and TCGA database analysis were applied to investigate the expression of CECR7 in HCC cell lines and tissues. Chi-squared Test was employed to explore the correlation between CECR7 expression and HCC clinicopathological features. Besides, Kaplan-Meier curves were constructed to test the effects of CECR7 expression on the prognosis of HCC patients. Transwell assays, MTT assay EdU assay and animal experiments were applied to explore the effects of CECR7 expression on HCC cells migration, invasion, and growth. Furthermore, RNA-seq analysis, luciferase reporter assay and mRNA decay rates assessment were utilized to investigate the mechanism whereby CECR7 regulated EXO1 mRNA. And, rescue experiments were used to determine whether EXO1 was an essential mediator for CECR7 to accelerate HCC cells migration, invasion, and growth. Results: CECR7 was determined to be significantly overexpressed in HCC cell lines and tissues. CECR7 expression was closely correlated with the tumor size, venous infiltration, TNM stage, 5-year overall survival and disease-free survival of HCC. And, CECR7 played a catalytic role in HCC cells migration, invasion, and growth. Furthermore, CECR7 enhanced the stability of EXO1 mRNA by recruiting RNA binding protein U2AF2. And, EXO1 was determined to be an essential mediator for CECR7 to accelerate HCC cells migration, invasion, and growth. Conclusion: In a word, our findings demonstrates that the cancer-promoting gene lncRNA CECR7 motivates HCC metastasis and growth through enhanced mRNA stability of EXO1 mediated by U2AF2, proposing a new insight for targeted therapy of HCC.

Targeted Suppression of Peptide Degradation in Ag-Based Surface-Enhanced Raman Spectra by Depletion of Hot Carriers.

Sample degradation, in particular of biomolecules, frequently occurs in surface-enhanced Raman spectroscopy (SERS) utilizing supported silver SERS substrates. Currently, thermal and/or photocatalytic effects are considered to cause sample degradation. This paper establishes the efficient inhibition of sample degradation using iodide which is demonstrated by a systematic SERS study of a small peptide in aqueous solution. Remarkably, a distinct charge separation-induced surface potential difference is observed for SERS substrates under laser irradiation using Kelvin probe force microscopy. This directly unveils the photocatalytic effect of Ag-SERS substrates. Based on the presented results, it is proposed that plasmonic photocatalysis dominates sample degradation in SERS experiments and the suppression of typical SERS sample degradation by iodide is discussed by means of the energy levels of the substrate under mild irradiation conditions. This approach paves the way toward more reliable and reproducible SERS studies of biomolecules under physiological conditions.

Circular RNA circ_UBAP2 facilitates the progression of osteosarcoma by regulating microRNA miR-637/high-mobility group box (HMGB) 2 axis.

Circular RNA circ_UBAP2 has been reported to be closely associated with various tumors. The present work focused on exploring the roles of circ_UBAP2 and its molecular mechanism in osteosarcoma (OS). Circ_UBAP2, miR-637, and high-mobility group box (HMGB) 2 levels in OS cells and tissues were detected by quantitative real-time polymerase chain reaction. The relationship between miR-637 and circ_UBAP2, as well as between miR-637 and HMGB2, was predicted and examined through bioinformatics analysis and luciferase reporter gene experiments. Moreover, OS cell growth, invasion, migration, and apoptosis were detected using the cell counting kit-8 (CCK-8), Transwell and flow cytometry assays, respectively. HMGB2 protein levels were measured using Western blotting. Xenograft tumor formation assay was also performed. Circ_UBAP2 showed high expression levels in OS tissues and cells, which was directly proportional to metastasis and clinical stage of OS. The overexpression of circ_UBAP2 enhanced the growth, invasion, and migration of OS cells, but suppressed their apoptosis. In contrast, circ_UBAP2 silencing had opposite effects. Furthermore, miR-637 served as a downstream target of circ_UBAP2, which played opposite roles to circ_UBAP2 in OS. More importantly, HMGB2 served as miR-637's downstream target. The xenograft experiments in nude mice also proved that knockdown of circ_UBAP2 could increase miR-637 expression, but decrease HMGB2 expression, thus alleviating OS progression. Mechanistically, circ_UBAP2 exerts a cancer-promoting effect on OS by downregulating miR-637 and upregulating the expression of HMGB2. Circ_UBAP2 plays a promoting role in OS, and the circ_UBAP2/miR-637/HMGB2 axis is involved in OS progression.

Long noncoding RNA LINC01410 promotes tumorigenesis of osteosarcoma cells via miR-497-5p/HMGA2 axis.

LINC01410 is a tumor promoter that is upregulated in some cancer types, such as osteosarcoma (OS). Nonetheless, its role in OS and the underlying molecular mechanism have not been fully understood. Hence, we sought to elucidate it. We performed reverse-transcription quantitative polymerase chain reaction for examining LINC01410, miR-497-5p and HMGA2 levels. Additionally, we carried out the cell counting kit-8 and Transwell assays for detecting cell proliferation and invasion/migration. Bioinformatics predicted that there was a miR-497-5p binding site in LINC01410 or HMGA2; meanwhile, miR-497-5p was found to interact with HMGA2 and LINC01410 through dual-luciferase reporter assay. LINC01410 and HMGA2 were high, and miR-497-5p showed low expression in OS tissues and cells. Cell function assay demonstrated that LINC01410 or HMGA2 knockdown or miR-497-5p overexpression obviously restrained OS proliferation, invasion, and migration. Oppositely, inhibiting miR-497-5p had the opposite effects. Functionally, miR-497-5p bound with LINC01410 3'-untranslated region and HMGA2 was found to be the miR-497-5p target gene. Lastly, LINC01410 enhanced OS cell growth, invasion, and migration via decreasing miR-497-5p expression, whereas increasing that of HMGA2. We have demonstrated that LINC01410 promoted OS development partly by miR-497-5p/HMGA2 signal transduction pathway and this provides a reference for studying the mechanism of LINC01410 in OS.

Tubular cell-derived exosomal miR-150-5p contributes to renal fibrosis following unilateral ischemia-reperfusion injury by activating fibroblast in vitro and in vivo.

Unilateral ischemia reperfusion injury (UIRI) with longer ischemia time is associated with an increased risk of acute renal injury and chronic kidney disease. Exosomes can transport lipid, protein, mRNA, and miRNA to corresponding target cells and mediate intercellular information exchange. In this study, we aimed to investigate whether exosome-derived miRNA mediates epithelial-mesenchymal cell communication relevant to renal fibrosis after UIRI. The secretion of exosomes increased remarkably in the kidney after UIRI and in rat renal tubular epithelium cells (NRK-52E) after hypoxia treatment. The inhibition of exosome secretion by Rab27a knockout or GW4869 treatment ameliorates renal fibrosis following UIRI in vivo. Purified exosomes from NRK-52E cells after hypoxia treatment could activate rat kidney fibroblasts (NRK-49F). The inhibition of exosome secretion in hypoxic NRK-52E cells through Rab27a knockdown or GW4869 treatment abolished NRK-49F cell activation. Interestingly, exosomal miRNA array analysis revealed that miR-150-5p expression was increased after hypoxia compared with the control group. The inhibition of exosomal miR-150-5p abolished the ability of hypoxic NRK-52E cells to promote NRK-49F cell activation in vitro, injections of miR-150-5p enriched exosomes from hypoxic NRK-52E cells aggravated renal fibrosis following UIRI, and renal fibrosis after UIRI was alleviated by miR-150-5p-deficient exosome in vivo. Furthermore, tubular cell-derived exosomal miR-150-5p could negatively regulate the expression of suppressor of cytokine signaling 1 to activate fibroblast. Thus, our results suggest that the blockade of exosomal miR-150-5p mediated tubular epithelial cell-fibroblast communication may provide a novel therapeutic target to prevents UIRI progression to renal fibrosis.

circUBAP2 regulates osteosarcoma progression via the miR­204­3p/HMGA2 axis.

Circular RNA (circRNA/circ)­ubiquitin associated protein 2 (UBAP2), a newly recognized circRNA, serves a functional role in several types of tumor, including ovarian cancer, colorectal cancer and osteosarcoma. However, the precise roles and molecular mechanism underlying circUBAP2 in osteosarcoma (OS) are not completely understood. In the present study, the expression levels of circUBAP2, microRNA (miR)­204­3p and (HMGA2) were evaluated via reverse transcription­quantitative PCR in OS tissues and cells. OS cell proliferation, migration, invasion and apoptosis were assessed by performing Cell Counting Kit­8, Transwell and flow cytometry assays, respectively. HMGA2 protein expression levels were determined via western blotting. Dual­luciferase reporter assays were performed to verify the interaction between circUBAP2 and miR­204­3p, and between miR­204­3p and HMGA2. An RNA immunoprecipitation (RIP) assay was conducted to confirm the interaction between circUBAP2 and miR­204­3p. The results demonstrated that circUBAP2 expression was significantly upregulated in OS tissues and cell lines compared with paracancerous tissues and hFOB1.19 cells, respectively. In addition, high circUBAP2 expression levels in patients with OS were associated with a lower survival rate compared with lower expression levels in patients with OS. The functional assays revealed that circUBAP2 knockdown significantly inhibited OS cell proliferation, migration and invasion, but increased OS cell apoptosis compared with the small interfering RNA­negative control (si­NC) group. The dual­luciferase reporter and RIP assay results confirmed that circUBAP2 bound to miR­204­3p. Moreover, miR­204­3p expression was significantly downregulated in OS tissues compared with paracancerous tissues, and miR­204­3p expression was negatively correlated with circUBAP2 expression in OS tissues. Collectively, the results demonstrated that miR­204­3p was associated with circUBAP2 knockdown­mediated inhibition of OS cell malignant behavior. Moreover, miR­204­3p was also identified as one of the direct targets of HMGA2. Collectively, the results indicated that compared with the si­NC group, circUBAP2 knockdown significantly inhibited OS cell malignant behavior by binding to miR­204­3p, which subsequently regulated HMGA2 expression. Therefore, the present study demonstrated that circUBAP2 expression was upregulated in OS, and circUBAP2 regulated OS cell malignant behavior via the miR­204­3p/HMGA2 axis.

miR-99b-3p promotes hepatocellular carcinoma metastasis and proliferation by targeting protocadherin 19.

Hepatocellular carcinoma (HCC) is one of the most common cancers in the world, with characteristics of high morbidity and mortality. Identifying clinically practical targets and uncovering the potential mechanism for HCC were urgent for us. Though aberrantly expressed miR-99b-3p has been reported in several cancers, the expression and roles of miR-99b-3p in HCC remain uncovered. In the present study, we demonstrated for the first time that miR-99b-3p was overexpressed in HCC by our findings and data from GEO datasets. Statistical analysis revealed that highly expressed miR-99b-3p was closely related to malignant clinicopathological characteristics and poorer prognosis of HCC patients. Furthermore, results from Wound healing assay, Transwell assays, 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)assay and 5-ethynyl-2'-deoxyuridine (EdU) assay revealed that miR-99b-3p played a promoting role in migration, invasion and proliferation of HCC cells. Then, by bioinformatics tools, luciferase reporter gene assay, integrative database analysis, and Pearson correlation analysis and so on, protocadherin 19 (PCDH19) was identified as the target of miR-99b-3p in HCC cells. Furthermore, rescue experiments were conducted to confirm the mediator role of PCDH19 for miR-99b-3p. Collectively, we demonstrate that miR-99b-3p promotes HCC metastasis and proliferation by directly targeting PCDH19. MiR-99b-3p may become a potential therapy target for HCC.

Acupuncture for hyperlipidemia: Protocol for a systematic review and meta-analysis.

BACKGROUND: Hyperlipidemia is a major risk factor for cardiovascular and cerebrovascular diseases. Acupuncture has been widely applied in the treatment of hyperlipidemia. But its efficacy has not been evaluated scientifically and systematically. Therefore, we provide a protocol of systematic evaluation to assess the effectiveness and safety of acupuncture treatment on patient with hyperlipidemia. METHODS: We will search the following databases electronically, including 3 English literature databases (i.e., PubMed, Embase, and Cochrane Library) and 4 Chinese literature databases (i.e., Chinese Biological and Medical database, China National Knowledge Infrastructure, VIP, and Wanfang Database). We will also search randomized-controlled trials about acupuncture treatment for hyperlipidemia and the search time limit is from its establishment to October 2018. The primary outcome is lipid-lowering efficacy. Secondary outcomes are total cholesterol, low-density lipoprotein cholesterol, triglyceride, and high-density lipoprotein cholesterol levels. We will use RevMan V.5.3 software as well to compute the data synthesis carefully when a meta-analysis is allowed. RESULTS: This study will provide a high-quality synthesis to assess the effectiveness and safety of acupuncture treatment on patient with hyperlipidemia. CONCLUSION: The conclusion of our systematic review will provide evidence to judge whether acupuncture is an effective intervention for patient with hyperlipidemia.

Enantioseparation of single layer native cyclodextrin chiral stationary phases: Effect of cyclodextrin orientation and a modeling study.

A novel native cyclodextrin (CD) chiral stationary phase (CSP) with single triazole-bridge at CD C2 position (CSP1) was prepared by anchoring mono(2A-azido-2A-deoxy)-ß-CD onto alkynyl silica via click chemistry. The effect of CD orientation on single layer CD-CSP's enantioseparation was comprehensively investigated using CSP1 (reversed orientation) and our previously reported CSP2 (C6 single triazole-bridge, normal orientation) as well as a commercial CD-CSP (Cyclobond I 2000, hybrid orientation) by separating several groups of analytes in chiral high performance liquid chromatography. It is found that the CD orientation on silica surface plays an important role in separating different racemates. CSP2 with normal CD orientation affords best separation for isoxazolines while CSP1 with reversed CD orientation better separates naringenin, hesperetin and Tröger's base. CSP2 and Cyclobond I 2000 show comparable separation ability for dansyl amino acids while poor separation was found on CSP1. Besides, molecular dynamics simulation was performed under "real" separation conditions using flavanone as model analyte to reveal the essential factors for CD's chiral discrimination behaviors.

Inhibition of mitochondrial translation effectively sensitizes renal cell carcinoma to chemotherapy.

The functional importance of mitochondrial protein translation has been recently documented in the context of various cancers but not renal cell carcinoma (RCC). In lines with these efforts, our work demonstrates that mitochondrial translation inhibition by tigecycline or depletion of EF-Tu mitochondrial translation factor effectively targets RCC and significantly sensitizes RCC response to chemotherapy. We show that antibiotic tigecycline inhibits multiple biological functions of RCC, including growth, colony formation and survival. It also significantly enhances in vitro and in vivo efficacy of paclitaxel in RCC. Tigecycline preferentially inhibits translation of mitochondrial DNA-encoded proteins, activities of mitochondrial respiratory complexes that contain mitochondrially encoded subunits. As a consequence of mitochondrial respiratory chain inhibition, decreased mitochondrial respiration is observed in RCC cells exposed to tigecycline. In contrast, tigecycline is ineffective in RCC ρ0 cells that lack mitochondrial DNA and subsequent mitochondrial respiration, further confirm mitochondrial translation inhibition as the mechanism of tigecycline's action in RCC. Importantly, genetic inhibition of mitochondrial translation by EF-Tu knockdown reproduced the inhibitory effects of tigecycline. Finally, we show the association between mitochondrial translation inhibition and suppression of PI3K/Akt/mTOR signaling pathway. Our work used pharmacological and genetic strategies to demonstrate the important roles of mitochondrial translation in RCC and emphasize the therapeutic value of sensitizing RCC to chemotherapy.

Thioether bridged cationic cyclodextrin stationary phases: Effect of spacer length, selector concentration and rim functionalities on the enantioseparation.

The preparation and evaluation of four single thioether bridged cationic cyclodextrin (CD) chiral stationary phases (CSPs) with different spacer length, selector concentration and rim functionalities are reported. Mono-6-(1-vinyl/allyl/butenylimidazolium)-ß-CDs chloride were synthesized and clicked onto thiol silica to form three novel cationic native-CD-CSPs (CSP1, CSP2 and CSP3) and a post-synthetic phenylcarbamoylation of CSP2 was performed affording CSP4. The enantioseparation ability of the as-prepared CSPs were evaluated in high performance liquid chromatography (HPLC) by separating over forty enantiomers including isoxazolines, dansyl amino acids, flavonoids, tröger's base, 4-chromanol, bendroflumethiazide and styrene oxide. Most of the enantiomers were well resolved with the resolution (Rs) of 4NPh-OPr reaching 12.68. The effects of spacer length, selector concentration and rim functionalities on the enantioseparation were investigated. A comparison of the current CSP with a commercial column (Cyclobond I 2000) was also conducted to reveal the superiors enantioselectivity of the as-prepared CSPs.

Engineering Thiol-Ene Click Chemistry for the Fabrication of Novel Structurally Well-Defined Multifunctional Cyclodextrin Separation Materials for Enhanced Enantioseparation.

The preparation of two novel multifunctional cyclodextrin (CD) separation materials and their ultimate enantioseparation performances in high performance liquid chromatography are reported. A mild thiol-ene click reaction was used to anchor 1-allylimidazolium-per(p-methyl)phenylcarbamoylated-ß-CD and 1-allylimidazolium-per(p-chloride)phenylcarbamoylated-ß-CD onto thiol-modified porous silica giving structurally well-defined stable cationic multifunctional CD chiral stationary phases (CSP1 and CSP2 respectively). These covalently bonded CD phases have typical interaction modes such as H-bonding, π-π effect, electrostatic and dipole-dipole interactions as well as steric effects which result in superior chiral resolution for a variety of chiral compounds in different separation modes. In a reverse-phase mode, both CSPs exhibited excellent separation abilities for isoxazolines, flavonoids, ß-blockers, and some other neutral and basic racemates. In a polar-organic mode, isoxazolines and flavonoids were well resolved. CSP1 with an electron-rich phenyl substitution on the CD rims gave a better resolution for isoxazolines whereas CSP2 with an electron-deficient phenyl substitution on the CD rims gave better resolution for flavonoids. Among isoxazolines, 4ClPh-OPr gained a high selectivity and resolution up to 18.6 and 38.7, respectively, which is an amazing result for CD enantioseparation materials.

A visualized probe method for localization of surface oxygen vacancy on TiO2: Au in situ reduction.

Surface oxygen vacancy has been investigated extensively due to its great influence on photocatalysis in recent years. Among these investigations, the location of surface defects is found to be a key factor during the photocatalytic procedure. Especially when a crystal facet is involved, the synergistic action between these two factors may greatly increase the photocatalytic efficiency. Location of defects would greatly help in understanding the mechanism of this coupling action. Without an available technique, however, it is very difficult to gain the position information directly. In this paper, we provide a low-cost and visualized method to solve this problem via in situ reduction of Au. TiO2 with surface oxygen vacancy on a specific area is synthesized via a photochemical reaction. Then the Au ion was reduced at the place where oxygen vacancy exists on the TiO2 surface. Hence, the localization of surface vacancy will be determined by examining the location of Au particles. Moreover, application of this method can be extended to other surface defects such as oxygen vacancy on oxide semiconductors, Ti(3+) in TiO2, Zn vacancy on ZnO, etc. This technique is helpful for understanding how surface defects affect the properties of semiconductors.

Chemical Radiosensitivity of DNA Induced by Gold Nanoparticles.

Gold nanoparticles (GNPs) sensitize biomolecules to radiation in two ways: by locally increasing the radiation energy absorbed and by modifying the sensitivity of the target biomolecules to radiation. Taking DNA as the biological target, we present the first investigation of the latter chemical mechanism of radiosensitization by irradiating thin films made of GNP-DNA complexes with 10 eV electrons. Naked GNPs of 5 and 15 nm diameters were synthesized and electrostatically bound to DNA. Damage to the GNP-DNA complexes were analyzed, as a function of electron fluence, by electrophoresis. In identical 5-monolayer films, the yield of DNA damage, as well as the enhancement factor due to the presence of 5 nm positively-charged nanoparticles, increased with rising ratio of GNPs to DNA up to 1:1. In comparison, increasing the ratio of negatively-charged 15 nm GNPs to DNA did not increase damage. As verified by XPS and zeta potential measurements, the binding of plasmid DNA to the surface of the two sizes of GNPs varies owing to the characteristics of the GNP surface and electrostatic interaction. The results indicate that strong binding of GNPs to DNA could significantly influence the efficiency of the chemical radiosensitization mechanism. This mechanism appears to be an important component of the overall process of GNP radiosensitization and should be considered when modeling this phenomenon. Our results suggest that small size GNPs (diam. ≤ 5 nm) are more efficient radiosensitizers compared to larger GNPs when delivered into cancerous cells, where their action should be cell-cycle dependent.

Thiol-ene click chemistry derived cationic cyclodextrin chiral stationary phase and its enhanced separation performance in liquid chromatography.

This work is the first demonstration of a simple thiol-ene click chemistry to anchor vinyl imidazolium ß-CD onto thiol silica to form a novel cationic native cyclodextrin (CD) chiral stationary phase (CSP). The CSP afforded high enantioseparation ability towards dansyl (Dns) amino acids, carboxylic aryl compounds and flavonoids in chiral HPLC. The current CSP demonstrates the highest resolving ability (selectivity >1.1, resolution >1.5) towards Dns amino acids in a mobile phase buffered at pH=6.5, with the resolution of Dns-dl-leucine as high as 6.97. 2,4-dichloride propionic acid (2,4-ClPOPA) was well resolved with the selectivity and resolution of 1.37 and 4.88, respectively. Compared to a previously reported native CD-CSP based on a triazole linkage, the current cationic CD-CSP shows a stronger retention and higher resolution towards acidic chiral compounds, ascribed to the propitious strong electrostatic attraction. Stability evaluation results indicated that thiol-ene reaction can provide a facile and robust approach for the preparation of positively charged CD CSPs.

Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL.

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.