A chromosome-scale genome assembly of the nipa palm hispid beetle Octodonta nipae.

Nipa palm hispid beetle (Octodonta nipae) is an insect species that is native to Malaysia but has spread to southern China and beyond, seriously threatening palm production. A lack of high-quality genome resources has hindered understanding of the insect's invasive characteristics and ecological adaptations. Here, we combined Illumina short read, PacBio long-read, and high-throughput chromosome conformation capture (Hi-C) sequencing technologies to generate a high-quality, chromosome-scale genome assembly of nipa palm hispid beetle. The genome assembly was 1.31 Gb in size, consisting of nine chromosomes. The contig and scaffold N50 values were 1.022 Mb and 148.6 Mb, respectively. The genome assembly completeness was estimated at 99.1%. Annotation revealed 16,305 protein-coding genes and 62.16% repeat sequences. This high-quality genome assembly is a valuable resource that will contribute to understanding of the genetic factors underlying the invasive characteristics of nipa palm hispid beetle, ultimately promoting development of efficient control policies.

Cry9A and Vip3A protein-induced transcriptional changes correspond to their synergistic damage to the midgut of Chilo suppressalis.

Cry and Vip3 proteins are both pore-forming toxins produced by Bacillus thuringiensis that show synergistic insecticidal activity against different insect pests. However, the synergistic effect of Cry and Vip3 proteins on the midgut in target insects is still unclear. In this study, faster and more serious damage was observed after treatment with both Cry9A and Vip3A proteins in the Chilo suppressalis midgut compared to single-protein treatment. Through RNA sequencing, midgut transcriptomic comparison was performed between dual- and single-protein treatments according to midgut injury. After 6 h, 609 differentially expressed genes were found with the combined Cry9A and Vip3A treatments, which was much more than that in the single treatment, corresponding to faster and more serious damage. These genes were mainly enriched in similar pathways, such as lipid metabolic, oxidation-reduction and carbohydrate metabolic process, peptide secretion and cell-cell adhesion; however, the number and expression level of differentially expressed genes are increased. For specific genes significantly regulated by induction of Cry9A and Vip3A, lipases, phospholipid scramblase, probable tape measure protein and arylsulfatase J were significantly downregulated after 6 h treatment. In addition, regular genes related to the activation and receptor binding of B. thuringiensis toxins were differentially regulated, such as ATP-binding cassette subfamily G member 1 and serine protease. Validation with RT-qPCR showed agreement with the sequencing results. Overall, our results support that stronger and faster midgut responses at the cellular and transcriptional levels are induced by the synergistic toxicity of Cry9A and Vip3A in C. suppressalis.

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

Occurrence of Tomato leaf curl New Delhi virus in tomato (Lycopersicon esculentum) in China.

Tomato leaf curl New Delhi virus (ToLCNDV), a member of the genus Begomovirus in the family Geminiviridae is naturally transmitted by the whitefly Bemisia tabaci (order Hemiptera, family Aleyrodidae) in a circulative and persistent manner (Moriones et al. 2017). ToLCNDV has occurred in Bangladesh, India, Indonesia, Iran, Italy, Malaysia, Pakistan, Sri Lanka, Spain, Thailand and Tunisia (Moriones et al. 2017). To date, The primary cultivated host of ToLCNDV has been identified as tomato (Lycopersicon esculentum), but the virus is also known to infect 43 other plant species from a range of families including Cucurbitaceae, Euphorbiaceae, Solanaceae, Malvaceae and Fabaceae (Zaidi et al. 2017). In August 2021, virus-like symptoms including leaf deformation and curing were observed on tomato (Lycopersicon esculentum) in a greenhouse of about 0.5 hectares in Zhejiang Province, China. To identify viral agents potentially associated with this disease, an Oxford Nanopore cDNA library from a symptomatic sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan). Libraries were constructed using Oxford Nanopore PCR-cDNA Sequencing Kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK), as recommended. Approximately 8.7 million reads were obtained from the Oxford MinION platform. After removing the adapters and low-quality reads, the clean reads were subjected to BLASTn analysis against the nt database. Approximately 797 and 168 reads produced high nt identities to the genome of ToLCNDV DNA-A (GeneBank Accession No. U15015.2) and ToLCNDV DNA-B (GeneBank Accession No. U15017.2) respectively. We designed 6 primer pairs (Table S1) to obtain the sequence of ToLCNDV Zhejiang (ToLCNDV-ZJ) isolate DNA-A and DNA-B. Briefly, total DNA from ToLCNDV-infected tomato was extracted using standard cetyl trimethylammonium bromide method. Segments of ToLCNDV DNA-A and DNA-B were amplified using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced. The obtained sequences were assembled into complete sequences of ToLCNDV-ZJ DNA-A (2,739 nt, GeneBank Accession No. OP356207) and DNA-B (2,693 nt, GeneBank Accession No. OP356208). Pairwise sequence comparison revealed that the ToLCNDV -ZJ shared the highest nt sequence identities of 98.7% and 98.4% with the genome segments of New Delhi isolate (genome A: HM159454) and India:Delhi:Cucumis:2012 isolate (genome B: KC545813) respectively. Furthermore, we performed PCR detection on 10 collected samples using the primer pair P1F and P1R. All eight symptomatic plants showing upward leaf curling and leaf distortion tested positive for ToLCNDV infection, whereas two asymptomatic plants were ToLCNDV free. To our knowledge, this is the first report of ToLCNDV infecting tomato in China, and with the widespread presence of B. tabaci in green houses, ToLCNDV may be a potential threat to the cultivation of tomato in China. In addition, ToLCNDV is an exceptional Old World bipartite begomovirus. In China, monopartite DNA satellite-associated begomoviruses with mostly narrow geographical ranges predominate, and are widespread (Li et al., 2022). The occurrence of ToLCNDV in China, which indicates that the success of this virus would become an emerging threat to vegetable and fiber crops.

Nanopore sequencing technology and its application in plant virus diagnostics.

Plant viruses threaten crop yield and quality; thus, efficient and accurate pathogen diagnostics are critical for crop disease management and control. Recent advances in sequencing technology have revolutionized plant virus research. Metagenomics sequencing technology, represented by next-generation sequencing (NGS), has greatly enhanced the development of virus diagnostics research because of its high sensitivity, high throughput and non-sequence dependence. However, NGS-based virus identification protocols are limited by their high cost, labor intensiveness, and bulky equipment. In recent years, Oxford Nanopore Technologies and advances in third-generation sequencing technology have enabled direct, real-time sequencing of long DNA or RNA reads. Oxford Nanopore Technologies exhibit versatility in plant virus detection through their portable sequencers and flexible data analyses, thus are wildly used in plant virus surveillance, identification of new viruses, viral genome assembly, and evolution research. In this review, we discuss the applications of nanopore sequencing in plant virus diagnostics, as well as their limitations.

Venom resistance mechanisms in centipede show tissue specificity.

Venomous animals utilize venom glands to secrete and store powerful toxins for intraspecific and/or interspecific antagonistic interactions, implying that tissue-specific resistance is essential for venom glands to anatomically separate toxins from other tissues. Here, we show the mechanism of tissue-specific resistance in centipedes (Scolopendra subspinipes mutilans), where the splice variant of the receptor repels its own toxin. Unlike the well-known resistance mechanism by mutation in a given exon, we found that the KCNQ1 channel is highly expressed in the venom gland as a unique splice variant in which the pore domain and transmembrane domain six, partially encoded by exon 6 (rather than 7 as found in other tissues), contain eleven mutated residues. Such a splice variant is sufficient to gain resistance to SsTx (a lethal toxin for giant prey capture) in the venom gland due to a partially buried binding site. Therefore, the tissue-specific KCNQ1 modification confers resistance to the toxins, establishing a safe zone in the venom-storing/secreting environment.

Genome of the parasitoid wasp Cotesia chilonis sheds light on amino acid resource exploitation.

BACKGROUND: A fundamental feature of parasitism is the nutritional exploitation of host organisms by their parasites. Parasitoid wasps lay eggs on arthropod hosts, exploiting them for nutrition to support larval development by using diverse effectors aimed at regulating host metabolism. However, the genetic components and molecular mechanisms at the basis of such exploitation, especially the utilization of host amino acid resources, remain largely unknown. To address this question, here, we present a chromosome-level genome assembly of the parasitoid wasp Cotesia chilonis and reconstruct its amino acid biosynthetic pathway. RESULTS: Analyses of the amino acid synthetic pathway indicate that C. chilonis lost the ability to synthesize ten amino acids, which was confirmed by feeding experiments with amino acid-depleted media. Of the ten pathways, nine are known to have been lost in the common ancestor of animals. We find that the ability to synthesize arginine was also lost in C. chilonis because of the absence of two key genes in the arginine synthesis pathway. Further analyses of the genomes of 72 arthropods species show that the loss of arginine synthesis is common in arthropods. Metabolomic analyses by UPLC-MS/MS reveal that the temporal concentrations of arginine, serine, tyrosine, and alanine are significantly higher in host (Chilo suppressalis) hemolymph at 3 days after parasitism, whereas the temporal levels of 5-hydroxylysine, glutamic acid, methionine, and lysine are significantly lower. We sequence the transcriptomes of a parasitized host and non-parasitized control. Differential gene expression analyses using these transcriptomes indicate that parasitoid wasps inhibit amino acid utilization and activate protein degradation in the host, likely resulting in the increase of amino acid content in host hemolymph. CONCLUSIONS: We sequenced the genome of a parasitoid wasp, C. chilonis, and revealed the features of trait loss in amino acid biosynthesis. Our work provides new insights into amino acid exploitation by parasitoid wasps, and this knowledge can specifically be used to design parasitoid artificial diets that potentially benefit mass rearing of parasitoids for pest control.

The acquisition of cold sensitivity during TRPM8 ion channel evolution.

To cope with temperature fluctuations, molecular thermosensors in animals play a pivotal role in accurately sensing ambient temperature. Transient receptor potential melastatin 8 (TRPM8) is the most established cold sensor. In order to understand how the evolutionary forces bestowed TRPM8 with cold sensitivity, insights into both emergence of cold sensing during evolution and the thermodynamic basis of cold activation are needed. Here, we show that the trpm8 gene evolved by forming and regulating two domains (MHR1-3 and pore domains), thus determining distinct cold-sensitive properties among vertebrate TRPM8 orthologs. The young trpm8 gene without function can be observed in the closest living relatives of tetrapods (lobe-finned fishes), while the mature MHR1-3 domain with independent cold sensitivity has formed in TRPM8s of amphibians and reptiles to enable channel activation by cold. Furthermore, positive selection in the TRPM8 pore domain that tuned the efficacy of cold activation appeared late among more advanced terrestrial tetrapods. Interestingly, the mature MHR1-3 domain is necessary for the regulatory mechanism of the pore domain in TRPM8 cold activation. Our results reveal the domain-based evolution for TRPM8 functions and suggest that the acquisition of cold sensitivity in TRPM8 facilitated terrestrial adaptation during the water-to-land transition.

Nanopore sequencing approach for variation detection of a live attenuated Newcastle disease virus vaccine.

Live attenuated Newcastle disease virus (NDV) vaccines have been used widely to protect chickens against Newcastle disease. However, the vaccine issues caused by genome mutations can seriously affect poultry health. In this study, the authors demonstrate the use of nanopore sequencing technology for rapid genome determination and variation analysis from a live attenuated NDV vaccine. NDV-specific reads were detected immediately after sequencing, and 24× genome coverage was obtained within 10 min. Variation analysis revealed 19 variant sites across the vaccine genome compared to the NDV clone 30 reference sequence . The sequencing and data analysis workflow employed enables all basic molecular biology laboratories to perform detailed genome sequencing in live attenuated vaccine, providing an effective means of quality control for vaccine production.

Toward an understanding of tree frog (Hyla japonica) for predator deterrence.

Gene-encoded peptides with distinct potent bioactivities enable several animals to take advantage of fierce interspecific interaction, as seen in the skin secretion of amphibians. Unlike, most amphibian species that frequently switches terrestrial-aquatic habitats and hides easily from terrestrial predators, tree frogs of small body size are considered as the vulnerable prey in the arboreal habitat. Here, we show the structural and functional diversity of peptide families based on the skin transcriptome of Hyla japonica, which has evolved to be wrapped as an efficient chemical toolkit for defensive use in arboreal habitat. Generally, the presence of antimicrobial peptide and proteinase inhibitor families reveals the functional consistency of Hyla japonica skin compared to other amphibian species. Furthermore, we found that Anntoxin-like neurotoxins with high expression levels are species-specific in tree frogs. Interestingly, derivatives in the Anntoxin-like family exhibit multiple evolutionary traits in modifying the copy number, folding type, and three-dimensional architecture, which are considered essential for targeting the ion channels of terrestrial predators. Together, our study not only reveals the peptide diversity in the skin secretion of H. japonica, but also draws insights into the predator-deterring strategy for coping with arboreal habitat.

Amino acid synthesis loss in parasitoid wasps and other hymenopterans.

Insects utilize diverse food resources which can affect the evolution of their genomic repertoire, including leading to gene losses in different nutrient pathways. Here, we investigate gene loss in amino acid synthesis pathways, with special attention to hymenopterans and parasitoid wasps. Using comparative genomics, we find that synthesis capability for tryptophan, phenylalanine, tyrosine, and histidine was lost in holometabolous insects prior to hymenopteran divergence, while valine, leucine, and isoleucine were lost in the common ancestor of Hymenoptera. Subsequently, multiple loss events of lysine synthesis occurred independently in the Parasitoida and Aculeata. Experiments in the parasitoid Cotesia chilonis confirm that it has lost the ability to synthesize eight amino acids. Our findings provide insights into amino acid synthesis evolution, and specifically can be used to inform the design of parasitoid artificial diets for pest control.

Introgressive hybridization between two non-native apple snails in China: widespread hybridization and homogenization in egg morphology.

BACKGROUND: Apple snails from the genus Pomacea have spread widely in paddy fields and other wetlands of southern China since their introduction in the 1980s. Pomacea spp. are commonly identified using mitochondrial COI sequences. However, sequencing the nuclear elongation factor 1-alpha (EF1α) gene revealed genetic introgression between field populations of P. canaliculata and P. maculata, which produce surviving hybrids in laboratory crossbreeding experiments. RESULTS: In this study, we sequenced 1054 EF1α clones to design specific primers and established a fast and accurate multiplex polymerase chain reaction (PCR) method for genotyping EF1α. Combined with genotyping P. canaliculata and P. maculata based on mitochondrial COI and nuclear EF1α, we revealed the genetic introgression patterns of 30 apple snail populations in China. Purebred and hybrid individuals of P. canaliculata were widely distributed, while pure maculata-EF1α type was detected only in a few individuals identified as P. canaliculata based on COI sequences. Each egg clutch had one to three genetic patterns, indicating multiple paternity or segregation in the progeny of hybrids. The higher percentages of hybrids in both wild populations and progeny than the homozygotes indicated a potential heterosis in the apple snail populations. Additionally, egg size and clutch size of the apple snails became homogeneous among the non-native populations exhibiting introgression hybridization. CONCLUSION: Our findings emphasize the value of apple snails as a model to study the mechanisms and impacts of introgressive hybridization on fitness traits. © 2020 Society of Chemical Industry.

A chromosome-level genome assembly provides new insights into paternal genome elimination in the cotton mealybug Phenacoccus solenopsis.

Mealybugs (Hemiptera: Pseudococcidae) are economically important agricultural pests with several compelling biological phenomena including paternal genome elimination (PGE). However, limited high-quality genome assemblies of mealybugs hinder a full understanding of this striking and unusual biological phenomenon. Here, we generated a chromosome-level genome assembly of cotton mealybug, Phenacoccus solenopsis, by combining Illumina short reads, PacBio long reads and Hi-C scaffolding. The assembled genome was 292.54 Mb with a contig N50 of 489.8 kb and a scaffold N50 of 49.0 Mb. Hi-C scaffolding assigned 84.42% of the bases to five chromosomes. A total of 110.75 Mb (37.9%) repeat sequences and 11,880 protein-coding genes were predicted. The completeness of the genome assembly was estimated to be 95.5% based on BUSCO genes. In addition, 27,086 (95.3%) full-length PacBio transcripts were uniquely mapped to the assembled scaffolds, suggesting the high quality of the genome assembly. We showed that cotton mealybugs lack differentiated sex chromosomes by analysing genome resequencing data of males and females. DAPI staining confirmed that one chromosome set in males becomes heterochromatin at an early embryo stage. Chromatin immunoprecipitation assays with sequencing analysis demonstrated that the epigenetic modifications H3K9me3 and H3K27me3 are distributed across the whole genome in males, suggesting that these two modifications might be involved in maintaining heterochromatin status. Both markers were more likely to be distributed in repeat regions, while H3K27me3 had higher overall enrichment. Our results provide a valuable genomic resource and shed new light on the genomic and epigenetic basis of PGE in cotton mealybugs.

A chromosome-level genome assembly reveals the genetic basis of cold tolerance in a notorious rice insect pest, Chilo suppressalis.

The rice stem borer, Chilo suppressalis, is one of the most damaging insect pests to rice production worldwide. Although C. suppressalis has been the focus of numerous studies examining cold tolerance and diapause, plant-insect interactions, pesticide targets and resistance, and the development of RNAi-mediated pest management, the absence of a high-quality genome has limited deeper insights. To address this limitation, we generated a draft C. suppressalis genome constructed from both Illumina and PacBio sequences. The assembled genome size was 824.35 Mb with a contig N50 of 307 kb and a scaffold N50 of 1.75 Mb. Hi-C scaffolding assigned 99.2% of the bases to one of 29 chromosomes. Based on universal single-copy orthologues (BUSCO), the draft genome assembly was estimated to be 97% complete and is predicted to encompass 15,653 protein-coding genes. Cold tolerance is an extreme survival strategy found in animals. However, little is known regarding the genetic basis of the winter ecology of C. suppressalis. Here, we focused our orthologous analysis on those gene families associated with animal cold tolerance. Our finding provided the first genomic evidence revealing specific cold-tolerant strategies in C. suppressalis, including those involved in glucose-originated glycerol biosynthesis, triacylglycerol-originated glycerol biosynthesis, fatty acid synthesis and trehalose transport-intermediate cold tolerance. The high-quality C. suppressalis genome provides a valuable resource for research into a broad range of areas in molecular ecology, and subsequently benefits developing modern pest control strategies.

The genomes of two parasitic wasps that parasitize the diamondback moth.

BACKGROUND: Parasitic insects are well-known biological control agents for arthropod pests worldwide. They are capable of regulating their host's physiology, development and behaviour. However, many of the molecular mechanisms involved in host-parasitoid interaction remain unknown. RESULTS: We sequenced the genomes of two parasitic wasps (Cotesia vestalis, and Diadromus collaris) that parasitize the diamondback moth Plutella xylostella using Illumina and Pacbio sequencing platforms. Genome assembly using SOAPdenovo produced a 178 Mb draft genome for C. vestalis and a 399 Mb draft genome for D. collaris. A total set that contained 11,278 and 15,328 protein-coding genes for C. vestalis and D. collaris, respectively, were predicted using evidence (homology-based and transcriptome-based) and de novo prediction methodology. Phylogenetic analysis showed that the braconid C. vestalis and the ichneumonid D. collaris diverged approximately 124 million years ago. These two wasps exhibit gene gains and losses that in some cases reflect their shared life history as parasitic wasps and in other cases are unique to particular species. Gene families with functions in development, nutrient acquisition from hosts, and metabolism have expanded in each wasp species, while genes required for biosynthesis of some amino acids and steroids have been lost, since these nutrients can be directly obtained from the host. Both wasp species encode a relative higher number of neprilysins (NEPs) thus far reported in arthropod genomes while several genes encoding immune-related proteins and detoxification enzymes were lost in both wasp genomes. CONCLUSIONS: We present the annotated genome sequence of two parasitic wasps C. vestalis and D. collaris, which parasitize a common host, the diamondback moth, P. xylostella. These data will provide a fundamental source for studying the mechanism of host control and will be used in parasitoid comparative genomics to study the origin and diversification of the parasitic lifestyle.

A chromosome-level genome assembly of Cydia pomonella provides insights into chemical ecology and insecticide resistance.

The codling moth Cydia pomonella, a major invasive pest of pome fruit, has spread around the globe in the last half century. We generated a chromosome-level scaffold assembly including the Z chromosome and a portion of the W chromosome. This assembly reveals the duplication of an olfactory receptor gene (OR3), which we demonstrate enhances the ability of C. pomonella to exploit kairomones and pheromones in locating both host plants and mates. Genome-wide association studies contrasting insecticide-resistant and susceptible strains identify hundreds of single nucleotide polymorphisms (SNPs) potentially associated with insecticide resistance, including three SNPs found in the promoter of CYP6B2. RNAi knockdown of CYP6B2 increases C. pomonella sensitivity to two insecticides, deltamethrin and azinphos methyl. The high-quality genome assembly of C. pomonella informs the genetic basis of its invasiveness, suggesting the codling moth has distinctive capabilities and adaptive potential that may explain its worldwide expansion.

Parasitic insect-derived miRNAs modulate host development.

Parasitic wasps produce several factors including venom, polydnaviruses (PDVs) and specialized wasp cells named teratocytes that benefit the survival of offspring by altering the physiology of hosts. However, the underlying molecular mechanisms for the alterations remain unclear. Here we find that the teratocytes of Cotesia vestalis, an endoparasitoid of the diamondback moth Plutella xylostella, and its associated bracovirus (CvBV) can produce miRNAs and deliver the products into the host via different ways. Certain miRNAs in the parasitized host are mainly produced by teratocytes, while the expression level of miRNAs encoded by CvBV can be 100-fold greater in parasitized hosts than non-parasitized ones. We further show that one teratocyte-produced miRNA (Cve-miR-281-3p) and one CvBV-produced miRNA (Cve-miR-novel22-5p-1) arrest host growth by modulating expression of the host ecdysone receptor (EcR). Altogether, our results show the first evidence of cross-species regulation by miRNAs in animal parasitism and their possible function in the alteration of host physiology during parasitism.

The genomic features of parasitism, Polyembryony and immune evasion in the endoparasitic wasp Macrocentrus cingulum.

BACKGROUND: Parasitoid wasps are well-known natural enemies of major agricultural pests and arthropod borne diseases. The parasitoid wasp Macrocentrus cingulum (Hymenoptera: Braconidae) has been widely used to control the notorious insect pests Ostrinia furnacalis (Asian Corn Borer) and O. nubilalis (European corn borer). One striking phenomenon exhibited by M. cingulum is polyembryony, the formation of multiple genetically identical offspring from a single zygote. Moreover, M. cingulum employs a passive parasitic strategy by preventing the host's immune system from recognizing the embryo as a foreign body. Thus, the embryos evade the host's immune system and are not encapsulated by host hemocytes. Unfortunately, the mechanism of both polyembryony and immune evasion remains largely unknown. RESULTS: We report the genome of the parasitoid wasp M. cingulum. Comparative genomics analysis of M. cingulum and other 11 insects were conducted, finding some gene families with apparent expansion or contraction which might be linked to the parasitic behaviors or polyembryony of M. cingulum. Moreover, we present the evidence that the microRNA miR-14b regulates the polyembryonic development of M. cingulum by targeting the c-Myc Promoter-binding Protein 1 (MBP-1), histone-lysine N-methyltransferase 2E (KMT2E) and segmentation protein Runt. In addition, Hemomucin, an O-glycosylated transmembrane protein, protects the endoparasitoid wasp larvae from being encapsulated by host hemocytes. Motif and domain analysis showed that only the hemomucin in two endoparasitoids, M. cingulum and Venturia canescens, possessing the ability of passive immune evasion has intact mucin domain and similar O-glycosylation patterns, indicating that the hemomucin is a key factor modulating the immune evasion. CONCLUSIONS: The microRNA miR-14b participates in the regulation of polyembryonic development, and the O-glycosylation of the mucin domain in the hemomucin confers the passive immune evasion in this wasp. These key findings provide new insights into the polyembryony and immune evasion.

ACE: an efficient and sensitive tool to detect insecticide resistance-associated mutations in insect acetylcholinesterase from RNA-Seq data.

BACKGROUND: Insecticide resistance is a substantial problem in controlling agricultural and medical pests. Detecting target site mutations is crucial to manage insecticide resistance. Though PCR-based methods have been widely used in this field, they are time-consuming and inefficient, and typically have a high false positive rate. Acetylcholinesterases (Ace) is the neural target of the widely used organophosphate (OP) and carbamate insecticides. However, there is not any software available to detect insecticide resistance associated mutations in RNA-Seq data at present. RESULTS: A computational pipeline ACE was developed to detect resistance mutations of ace in insect RNA-Seq data. Known ace resistance mutations were collected and used as a reference. We constructed a Web server for ACE, and the standalone software in both Linux and Windows versions is available for download. ACE was used to analyse 971 RNA-Seq data from 136 studies in 7 insect pests. The mutation frequency of each RNA-Seq dataset was calculated. The results indicated that the resistance frequency was 30%-44% in an eastern Ugandan Anopheles population, thus suggesting this resistance-conferring mutation has reached high frequency in these mosquitoes in Uganda. Analyses of RNA-Seq data from the diamondback moth Plutella xylostella indicated that the G227A mutation was positively related with resistance levels to organophosphate or carbamate insecticides. The wasp Nasonia vitripennis had a low frequency of resistant reads (<5%), but the agricultural pests Chilo suppressalis and Bemisia tabaci had a high resistance frequency. All ace reads in the 30 B. tabaci RNA-Seq data were resistant reads, suggesting that insecticide resistance has spread to very high frequency in B. tabaci. CONCLUSIONS: To the best of our knowledge, the ACE pipeline is the first tool to detect resistance mutations from RNA-Seq data, and it facilitates the full utilization of large-scale genetic data obtained by using next-generation sequencing.