Changes in the expression of cyclin dependent kinase inhibitors during differentiation of immortalized fibroblasts into adipocytes.

The mechanisms implicated in the differentiation of fibroblastic precursors into adipocytes can be analyzed in vitro using cell models, such as the 3T3-L1 cell line. Since cell differentiation involves an exit from the cell cycle, it is likely that molecules that inhibit proliferation participate in the control of adipogenesis. This study was aimed at determining the role, if any, of several cyclin-dependent kinase (CDK)-inhibitors and the transcription factor C/EBPα in the process of adipocyte differentitation. We analyzed by Western blot the expression of distinct cyclin-dependent kinase (CDK)-inhibitors and C/EBPα during various stages of differentiation of 3T3-L1 cells to adipocytes. We observed specific changes in the expression of CDK inhibitors and C/EBPα, during the various phases of adipogenesis. Levels of p15INK4B were maximal in confluent cells prior to the induction of differentiation and minimal in differentiated cells. Maximal levels of p16INK4A were detected following 48 h of differentiation treatment. Highest levels of p18INK4C were measured during the phase of cell confluence prior to treatment and in differentiated cells. p21CIP1 was expressed during the exponential growth phase, during exit from clonal expansion, and in differentiated cells, while p27KIP1 was found above all in confluent and differentiated cells. The present results support the participation of CDK-inhibitors in the process of in vitro adipogenesis. Specifically, the proteins p18INK4C, p21CIP1 and p27KIP1 seem to play an outstanding role in the maintenance of the differentiated state of adipocytes. Understanding the molecular mechanisms involved in adipocyte differentiation will presumably facilitate the design of new drugs aimed at novel therapeutic targets.

Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine neoplasia type 1 syndrome in Spain.

CONTEXT: Multiple endocrine neoplasia type 1 (MEN1) is a rare autosomal dominant disorder mostly owing to a genetic defect in MEN1 gene. Not all patients with MEN1 phenotype present a defect in this gene. Thus, other genes like CDKN and AIP have been showed to be involved in MEN1-like patients. OBJECTIVE: The aim of this study was to perform a genetic screening in our cohort or patients with suspected MEN1 syndrome by direct sequencing analysis of MEN1, CDKN1B and AIP, and dosage analysis of MEN1 and AIP. RESULTS: A total of 79 different sporadic and familial cases with the MEN1 phenotype have been studied, in which 34 of them (48%) present a mutation in MEN1 gene. In two patients without a detectable mutation in MEN1 gene, we have identified a novel missense mutation (c.163G>A/p.Ala55Thr) in CDKN1B gene and a novel frameshift mutation (c.825_845delCGCGGCCGTGTGGAATGCCCA/p. His275GlnfsX49) in AIP gene, respectively. CONCLUSIONS: Our data support that MEN1 gene is the main target for genetic analysis in clinical MEN1 syndrome. We confirm that in those patients without MEN1 gene mutation, other genes such as CDKN1B/p27Kip, or AIP in those including pituitary tumours should also be tested.

Cooperation between p27 and p107 during endochondral ossification suggests a genetic pathway controlled by p27 and p130.

Pocket proteins and cyclin-dependent kinase (CDK) inhibitors negatively regulate cell proliferation and can promote differentiation. However, which members of these gene families, which cell type they interact in, and what they do to promote differentiation in that cell type during mouse development are largely unknown. To identify the cell types in which p107 and p27 interact, we generated compound mutant mice. These mice were null for p107 and had a deletion in p27 that prevented its binding to cyclin-CDK complexes. Although a fraction of these animals survived into adulthood and looked similar to single p27 mutant mice, a larger number of animals died at birth or within a few weeks thereafter. These animals displayed defects in chondrocyte maturation and endochondral bone formation. Proliferation of chondrocytes was increased, and ectopic ossification was observed. Uncommitted mouse embryo fibroblasts could be induced into the chondrocytic lineage ex vivo, but these cells failed to mature normally. These results demonstrate that p27 carries out overlapping functions with p107 in controlling cell cycle exit during chondrocyte maturation. The phenotypic similarities between p107(-/-) p27(D51/D51) and p107(-/-) p130(-/-) mice and the cells derived from them suggest that p27 and p130 act in an analogous pathway during chondrocyte maturation.

p130Rb2 and p27kip1 cooperate to control mobilization of angiogenic progenitors from the bone marrow.

Neoangiogenesis involves both bone marrow-derived myelomonocytic and endothelial progenitor cells as well as endothelial cells coopted from surrounding vessels. Cytokines induce these cells to proliferate, migrate, and exit the cell cycle to establish the vasculature; however, which cell cycle regulators play a role in these processes is largely unknown. Here, we report that mice lacking the cell cycle inhibitors p130 and p27 show defects in tumor neoangiogenesis, both in xenografts and spontaneously arising tumors. This defect is associated with impaired mobilization of endothelial and myelomonocytic angiogenic progenitors from the bone marrow. This article documents the role of these molecules in angiogenesis and further suggests that cell expansion and mobilization from the bone marrow of angiogenic precursors are separable events.

p53 and cyclin D1 as prognostic factors in squamous cell carcinoma of the larynx.

OBJECTIVES/HYPOTHESIS: Proteins p53 and cyclin D1 play a crucial role in cell cycle control. Protein p53 mutations are one of the most common genetic alterations in human cancer, and cyclin D1 gene amplification has been found to be associated with poor prognosis in different types of tumors. Functional alterations of these proteins may play an important role both in the carcinogenesis of squamous carcinomas of the head and neck and in the clinical evolution of these tumors. The objective of the present study was to evaluate whether the presence of p53 and/or cyclin D1 proteins (detected by immunohistochemical analysis) could serve as relevant variables for the assessment of the prognosis of laryngeal squamous cell carcinoma. STUDY DESIGN: Retrospective multicentric study. METHODS: Paraffin-embedded biopsy specimens from 62 human epidermoid laryngeal carcinomas were randomly selected. The expression of p53 and cyclin D1 was examined by means of immunohistochemical analysis with a view to evaluating whether there is a correlation between the aberrant expression of these proteins and disease prognosis. RESULTS: In the sample, the presence of immunohistochemically detectable p53 is associated with shorter survival and disease-free intervals, as shown in Kaplan-Meier survival curve analysis. Indeed, multivariate statistical analysis revealed that the accumulation of p53 is an independent prognostic factor, which is associated with shorter survival. This association was not evident in the case of cyclin D1. CONCLUSION: A more precise prognosis of patients with laryngeal epidermoid carcinomas could be achieved by taking into account the presence of p53 (as assayed by immunohistochemical analysis) in biopsy tissue