Metabolic Conversions by Lactic Acid Bacteria during Plant Protein Fermentations.

To secure a sustainable food supply for the rapidly growing global population, great efforts towards a plant-based diet are underway. However, the use of plant proteins comes with several challenges, such as improvement or removal of undesired flavours, and generation of desired texture properties. Fermentation holds large potential to alter these properties, but compared to dairy fermentations, our knowledge on strain properties in different plant-based substrates is still limited. Here, we explored different lactic acid bacteria for their ability to grow, produce flavour compounds, or remove off-flavour compounds from different plant proteins. For this, 151 LAB strains from dairy and non-dairy origins were cultured in plant protein plus coconut oil emulsions supplemented with glucose. Pea, chickpea, mung, fava, and soybean proteins were used in the study and bacterial strains for screening included the genera Streptococcus, Lactococcus, Lactobacillus, and Leuconostoc. Efficient, high throughput, screening on plant proteins was developed and strains were assessed for their ability to (i) acidify and decrease the pH; (ii) express key enzymes involved in the formation of amino acid derived flavours, which included PepN (aminopeptidase N), PepXP (X-prolyl dipeptidyl peptidase), EstA (esterase), BcAT (branched chain aminotransferase), CBL (cystathione beta lyase), and ArAT (aromatic aminotransferase); and (iii) improve the overall aroma profile by generating dairy/cheesy notes and decreasing off flavours. Suitable screening conditions were determined, and highlighted the importance that a sufficient heat treatment must be applied to samples containing plant proteins, prior to fermentation, as an outgrowth of spore forming Bacillus cereus was observed if the material was only pasteurised. Enzyme activities for strains measured in rich broth vs. a buffered protein solution showed little-to-no correlation, which illustrated the importance of screening conditions to obtain predictive enzyme measurements. Aroma formation analysis allowed to identify strains that were able to increase key aromas such as diacetyl, acetoin, 2- and 3-methyl butanol, and 2,3-pentanedione, as well as decrease the off-flavours hexanal, pentanal, and nonanal. Our findings illustrate the importance of strain specific differences in the assessed functionalities and how a methodical approach to screening LAB can be applied to select suitable microorganisms that show promise in fermentation of plant proteins when applied in non-dairy cheese applications.

A generic workflow for Single Locus Sequence Typing (SLST) design and subspecies characterization of microbiota.

We present TaxPhlAn, a new method and bioinformatics pipeline for design and analysis of single-locus sequence typing (SLST) markers to type and profile bacteria beyond the species-level in a complex microbial community background. TaxPhlAn can be applied to any group of phylogenetically-related bacteria, provided reference genomes are available. As TaxPhlAn requires the SLST targets identified to fit the phylogenetic pattern as determined through comprehensive evolutionary reconstruction of input genomes, TaxPhlAn allows for the identification and phylogenetic inference of new biodiversity. Here, we present a clinically relevant case study of high-resolution Staphylococcus profiling on skin of atopic dermatitis (AD) patients. We demonstrate that SLST enables profiling of cutaneous Staphylococcus members at (sub)species level and provides higher resolution than current 16S-based techniques. With the higher discriminative ability provided by our approach, we further show that the presence of Staphylococcus capitis on the skin together with Staphylococcus aureus associates with AD disease.

The bacterial and fungal microbiome of the skin of healthy dogs and dogs with atopic dermatitis and the impact of topical antimicrobial therapy, an exploratory study.

Canine atopic dermatitis is a genetically predisposed inflammatory and pruritic allergic skin disease that is often complicated by (secondary) bacterial and fungal (yeast) infections. High-throughput DNA sequencing was used to characterize the composition of the microbiome (bacteria and fungi) inhabiting specific sites of skin in healthy dogs and dogs with atopic dermatitis (AD) before and after topical antimicrobial treatment. Skin microbiome samples were collected from six healthy control dogs and three dogs spontaneously affected by AD by swabbing at (non-) predilection sites before, during and after treatment. Bacteria and fungi were profiled by Illumina sequencing of the 16S ribosomal RNA gene of bacteria (16S) and the internally transcribed spacer of the ribosomal gene cassette in fungi (ITS). The total cohort of dogs showed a high diversity of microbes on skin with a strong individual variability of both 16S and ITS profiles. The genera of Staphylococcus and Porphyromonas were dominantly present both on atopic and healthy skin and across all skin sites studied. In addition, bacterial and fungal alpha diversity were similar at the different skin sites. The topical antimicrobial treatment increased the diversity of bacterial and fungal compositions in course of time on both AD and healthy skin.

Cell Surface Properties of Lactococcus lactis Reveal Milk Protein Binding Specifically Evolved in Dairy Isolates.

Surface properties of bacteria are determined by the molecular composition of the cell wall and they are important for interactions of cells with their environment. Well-known examples of bacterial interactions with surfaces are biofilm formation and the fermentation of solid materials like food and feed. Lactococcus lactis is broadly used for the fermentation of cheese and buttermilk and it is primarily isolated from either plant material or the dairy environment. In this study, we characterized surface hydrophobicity, charge, emulsification properties, and the attachment to milk proteins of 55 L. lactis strains in stationary and exponential growth phases. The attachment to milk protein was assessed through a newly developed flow cytometry-based protocol. Besides finding a high degree of biodiversity, phenotype-genotype matching allowed the identification of candidate genes involved in the modification of the cell surface. Overexpression and gene deletion analysis allowed to verify the predictions for three identified proteins that altered surface hydrophobicity and attachment of milk proteins. The data also showed that lactococci isolated from a dairy environment bind higher amounts of milk proteins when compared to plant isolates. It remains to be determined whether the alteration of surface properties also has potential to alter starter culture functionalities.

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis.

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DeltarecA mutant strain after exposure to the DNA-damaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DeltarecA cultures showed considerably lower rifampicin- and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA- and yneA-promoter reporter studies. Stress-survival studies showed DeltarecA mutant cells to be less resistant to heat, H(2)O(2) and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.