Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 1.550
Filtrar
1.
J Colloid Interface Sci ; 629(Pt A): 864-872, 2023 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-36152616

RESUMO

HYPOTHESIS: The dynamic behaviors of colloidal particles have already been considered as one of the key issues in their practical application, such as aggregation and dispersion. However, it is still remained significant challenge in developing the real time techniques to capture their dynamic tracks. The nano/subnanometer scale gap generated during the colloidal collisions served as the critical location for amplifying the Raman signal, so called as gap ("hot spots") based surface enhanced Raman spectroscopy (SERS). The alternating reversible "spike" of SERS intensity and irreversible step in baseline intensity are contributed to the preferred stability and the aggregation of colloid respectively. EXPERIMENTS: A facile approach is developed to track colloidal stability in real-time based on collisions and SERS. The effects of particle concentration, the dispersion medium, and solution pH on colloidal stability are systematically investigated, and the SERS intensity of a simulated single-like "hot spot" was calculated by combining a SEM position with SERS mapping technology to estimate the intensity of single-particle collision. FINDINGS: The colloidal particles exhibited higher stability in the solution with lower particle concentration, higher viscosity and neutral medium. The SERS intensity of single-particle collision was estimated to be about 2.06 × 10-7 counts, and the average number of collisions for the 0.13 mmol/dm3 SiO2@Ag solution was about 1.11 × 108 times/spike in the "spikes" with SERS intensity of 23.0 cps. It is believed that the SERS based strategy would be developed as a promising tool for obtaining the deeper insight into the nature of collisions in the colloidal science.


Assuntos
Prata , Análise Espectral Raman , Análise Espectral Raman/métodos , Prata/química , Dióxido de Silício , Propriedades de Superfície , Coloides/química
2.
J Neurosci Res ; 101(1): 34-47, 2023 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-36134557

RESUMO

Besides the well-documented ophthalmic manifestations, thyroid-associated ophthalmopathy (TAO) is believed to be related to emotional and psychological abnormalities. Given the previous neuroimaging evidence, we hypothesized that TAO patients would have altered neurovascular coupling associated with clinical-psychiatric disturbances. This study was to investigate neurovascular coupling changes in TAO by combining resting-state functional magnetic resonance imaging (rs-fMRI) and arterial spin labeling (ASL) techniques. Amplitude of low-frequency fluctuation (ALFF) was calculated from rs-fMRI, and cerebral blood flow (CBF) was computed from ASL in 37 TAO patients and 21 healthy controls (HCs). Global neurovascular coupling was assessed by across-voxel CBF-ALFF correlation, and regional neurovascular coupling was evaluated by CBF/ALFF ratio. Auxiliary analyses were performed using fractional ALFF (fALFF) and regional homogeneity (ReHo) as rs-fMRI measures. Compared with HCs, TAO patients showed significantly reduced global CBF-ALFF coupling. Moreover, TAO patients exhibited decreased CBF/ALFF ratio in the left lingual gyrus (LG)/fusiform gyrus (FFG), and increased CBF/ALFF ratio in the bilateral precuneus (PCu). In TAOs, CBF/ALFF ratio in the left LG/FFG was positively correlated with visual acuity, while CBF/ALFF ratio in the bilateral PCu was negatively correlated with Montreal Cognitive Assessment score. The auxiliary analyses showed trends of reduced global neurovascular coupling (i.e., CBF-fALFF correlation and CBF-ReHo correlation), as well as significant altered regional neurovascular coupling (i.e., CBF/fALFF ratio and CBF/ReHo ratio) in several brain regions. These findings indicated that TAO patients had altered neurovascular coupling in the visual and higher-order cognitive cortices. The neurovascular decoupling might be a possible neuropathological mechanism of TAO.


Assuntos
Oftalmopatia de Graves , Acoplamento Neurovascular , Humanos , Acoplamento Neurovascular/fisiologia , Imageamento por Ressonância Magnética/métodos , Marcadores de Spin , Descanso
3.
Curr Microbiol ; 79(12): 391, 2022 Nov 03.
Artigo em Inglês | MEDLINE | ID: mdl-36329291

RESUMO

Klebsiella pneumoniae is an important bacterium and responsible for both infections acquired in hospital and community because of its multidrug resistance and the virulence. The aim of this research was to investigate clonal lineages, antibiotic resistance profiles, and virulence factors of the hospital isolated carbapenem-resistant strains. Fifty carbapenem-resistant isolates were phenotypically confirmed extended-spectrum beta-lactamases ESBLs producers. MLST analysis revealed 94% sequence type 11. These isolates mainly belonged to three clones according to the PFGE DNA patterns. PFGE patterns have good discrimination than ST profiles. One isolate, K. pneumoniae KPX, undergoing whole-genome sequencing comprised one circular chromosome and four circular plasmids. This isolate harbored a variety of antimicrobial resistance and virulence determinants. The closest relative of K. pneumoniae KPX was another ST11 clinical isolate recovered Sichuan. In addition, KPC-2 (98.0%), SHV-11 (98.0%), TEM-1 (76.0%), CTX-M (76.0%), oqxB1(66%), qnrS (70%), Int1 (42.0%), sul1 (82.0%), sul2 (96.0%), iutA (88%), iucC(10%), and rmpA2 (100%) genes were presented in multiple drug-resistant isolates. The dataset presented in this study provided the genomic and epidemiological analysis of carbapenem-resistant K. pneumoniae in hospital settings. Antimicrobial-resistant profiles suggested the presence of significant selective antibiotic pressure. Appropriate surveillance is essential to the development of effective control strategies in the prevention of nosocomial infection.


Assuntos
Enterobacteriáceas Resistentes a Carbapenêmicos , Infecções por Klebsiella , Humanos , Klebsiella pneumoniae , Infecções por Klebsiella/microbiologia , Tipagem de Sequências Multilocus , beta-Lactamases/genética , Farmacorresistência Bacteriana Múltipla/genética , Enterobacteriáceas Resistentes a Carbapenêmicos/genética , Carbapenêmicos/farmacologia , Plasmídeos/genética , Antibacterianos/farmacologia , Genômica , Testes de Sensibilidade Microbiana
4.
Head Neck ; 2022 Nov 22.
Artigo em Inglês | MEDLINE | ID: mdl-36412064

RESUMO

BACKGROUND: Associations between peripheral blood biomarkers and oncologic outcomes were explored in recurrent/metastatic (R/M) head and neck squamous cell carcinoma (HN) and salivary gland cancer (SGC) treated with pembrolizumab and vorinostat on a phase II trial (NCT02538510). EXPERIMENTAL DESIGN: Twenty-five HN and 25 SGCs were treated with pembrolizumab and vorinostat. Baseline peripheral blood was available in 21 HN and 20 SGCs and evaluated for associations with grade ≥3 adverse events (G ≥ 3AE) by CTCAEv4, objective response rate (ORR), overall survival (OS), and progression-free survival (PFS). RESULTS: Higher pretreatment neutrophil-to-lymphocyte ratio (NLR) and neutrophils, as well as lower pretreatment lymphocytes and T helper cells correlated with worse OS and PFS. Higher NLR further predicted increased rates of G ≥ 3AEs. No correlations with ORR were observed. CONCLUSIONS: In a prospectively evaluated cohort of HN and SGCs treated with pembrolizumab and vorinostat, we observed novel associations between peripheral blood biomarkers and oncologic outcomes and toxicities.

5.
Front Oncol ; 12: 1026278, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36387165

RESUMO

Solid tumors can be divided into benign solid tumors and solid malignant tumors in the academic community, among which malignant solid tumors are called cancers. Cancer is the second leading cause of death in the world, and the global incidence of cancer is increasing yearly New cancer patients in China are always the first. After the concept of stem cells was introduced in the tumor community, the CSC markers represented by ALDH1 have been widely studied due to their strong CSC cell characteristics and potential to be the driving force of tumor metastasis. In the research results in the past five years, it has been found that ALDH1 is highly expressed in various solid cancers such as breast cancer, lung cancer, colorectal cancer, liver cancer, gastric cancer, cervical cancer, esophageal cancer, ovarian cancer, head,and neck cancer. ALDH1 can activate and transform various pathways (such as the USP28/MYC signaling pathway, ALDH1A1/HIF-1α/VEGF axis, wnt/ß-catenin signaling pathway), as well as change the intracellular pH value to promote formation and maintenance, resulting in drug resistance in tumors. By targeting and inhibiting ALDH1 in tumor stem cells, it can enhance the sensitivity of drugs and inhibit the proliferation, differentiation, and metastasis of solid tumor stem cells to some extent. This review discusses the relationship and pathway of ALDH1 with various solid tumors. It proposes that ALDH1 may serve as a diagnosis and therapeutic target for CSC, providing new insights and new strategies for reliable tumor treatment.

7.
Mol Vis ; 28: 352-358, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36338666

RESUMO

Purpose: To investigate the molecular pathogenesis of a large group of Han Chinese patients with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES), and to evaluate the correlation between the phenotype and genotype for these patients. Methods: Seventy-six affected individuals, including 45 patients from 17 pedigrees and 31 sporadic patients, were recruited with their family members. All participants underwent complete clinical examinations and were classified as having type I or II based on whether they had premature ovarian failure. The patients' genomic DNA was extracted. A genetic test was performed with direct sequencing of the coding regions of the forkhead transcriptional factor 2 (FOXL2) gene. Variations were analyzed using online databases and programs. Genotype-phenotype correction was investigated. Results: Seventy-six affected and 75 unaffected individuals underwent clinical evaluations and genetic testing. Only one family was diagnosed with type I; the others could not be classified because of a lack of female patients or a definite history of premature ovarian failure. Twenty-seven variations were identified, including 12 novel and 15 previously reported variations. Six variations were detected repeatedly in different nonconsanguineous pedigrees. Four indel variations, located in the alanine/proline-rich region of the FOXL2 gene, presented with a relatively higher frequency. Two rare double variations were detected in two sporadic patients. FOXL2 gene variations were not detected in five sporadic patients. The phenotype varied among different families and patients, although they carried the same variations. Conclusions: We identified 12 novel variations in the FOXL2 gene that would expand the spectrum of the FOXL2 variation database. In addition, we found that the alanine/proline-rich region is a variation hotspot in the FOXL2 gene. The genotype-phenotype correlation is not easy to establish due to clinical and genetic heterogeneity.


Assuntos
Blefarofimose , Insuficiência Ovariana Primária , Humanos , Feminino , Blefarofimose/genética , Blefarofimose/diagnóstico , Linhagem , Insuficiência Ovariana Primária/genética , Mutação/genética , Proteína Forkhead Box L2/genética , Fatores de Transcrição Forkhead/genética , Alanina/genética , China , Prolina/genética
8.
BMC Endocr Disord ; 22(1): 286, 2022 Nov 18.
Artigo em Inglês | MEDLINE | ID: mdl-36401201

RESUMO

BACKGROUND: This study aims to explore the association between dietary acid load and hyperuricemia in Chinese adults. METHODS: A case-control study was conducted. Adult participants with hyperuricemia were recruited as the cases and those without hyperuricemia were as the controls. Food consumption was evaluated by food frequency questionnaire (FFQ). Dietary acid load was assessed by potential renal acid load (PRAL) and net endogenous acid production (NEAP). Dietary acid load was divided into four levels: the first quartile (Q1), the second quartile (Q2), the third quartile (Q3) and the fourth quartile (Q4). Logistic regression model was applied for exploring the association between dietary acid load (PRAL and NEAP) and hyperuricemia. Odds ratio (OR) and its correspondence confidence interval (CI) were computed. RESULTS: A total of 290 participants were eligible in this study, in which there were 143 individuals in case group and 147 in control group. A higher level of PRAL was found to be associated with odds of hyperuricemia. ORs of hyperuricemia for Q2, Q3 and Q4 of PRAL were 2.74 (95%CI: 1.94 ~ 3.88, p-value: 0.004), 2.90 (95%CI: 2.05 ~ 4.10, p-value: 0.002) and 3.14 (95%CI: 2.22 ~ 4.45, p-value: 0.001), respectively. There was a positive association between elevated NEAP and hyperuricemia. OR of hyperuricemia for Q2 was not material significance (OR:1.54, 95%CI: 0.93 ~ 2.53, p-value: 0.210), however, ORs of hyperuricemia for Q3 (OR: 2.40, 95%CI: 1.70 ~ 3.38, p-value: 0.011) and Q4 (OR: 3.27, 95%CI: 2.31 ~ 4.62, p-value: 0.001) were statistically significant. CONCLUSION: Higher level of dietary acid load was found to be associated with hyperuricemia in Chinese adults, indicative of advocation of a well-balanced diet in this population.


Assuntos
Hiperuricemia , Humanos , Adulto , Hiperuricemia/epidemiologia , Hiperuricemia/etiologia , Estudos de Casos e Controles , Dieta/efeitos adversos , Ácidos , China/epidemiologia
9.
Zool Res ; 43(6): 1041-1062, 2022 Nov 18.
Artigo em Inglês | MEDLINE | ID: mdl-36349357

RESUMO

Infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) causes diverse clinical manifestations and tissue injuries in multiple organs. However, cellular and molecular understanding of SARS-CoV-2 infection-associated pathology and immune defense features in different organs remains incomplete. Here, we profiled approximately 77 000 single-nucleus transcriptomes of the lung, liver, kidney, and cerebral cortex in rhesus macaques ( Macaca mulatta) infected with SARS-CoV-2 and healthy controls. Integrated analysis of the multi-organ dataset suggested that the liver harbored the strongest global transcriptional alterations. We observed prominent impairment in lung epithelial cells, especially in AT2 and ciliated cells, and evident signs of fibrosis in fibroblasts. These lung injury characteristics are similar to those reported in patients with coronavirus disease 2019 (COVID-19). Furthermore, we found suppressed MHC class I/II molecular activity in the lung, inflammatory response in the liver, and activation of the kynurenine pathway, which induced the development of an immunosuppressive microenvironment. Analysis of the kidney dataset highlighted tropism of tubule cells to SARS-CoV-2, and we found membranous nephropathy (an autoimmune disease) caused by podocyte dysregulation. In addition, we identified the pathological states of astrocytes and oligodendrocytes in the cerebral cortex, providing molecular insights into COVID-19-related neurological implications. Overall, our multi-organ single-nucleus transcriptomic survey of SARS-CoV-2-infected rhesus macaques broadens our understanding of disease features and antiviral immune defects caused by SARS-CoV-2 infection, which may facilitate the development of therapeutic interventions for COVID-19.


Assuntos
COVID-19 , Animais , COVID-19/genética , COVID-19/veterinária , Macaca mulatta , SARS-CoV-2 , Transcriptoma , Carga Viral/veterinária
10.
Bosn J Basic Med Sci ; 2022 Nov 10.
Artigo em Inglês | MEDLINE | ID: mdl-36373623

RESUMO

A nomogram was constructed to predict the survival of patients with colorectal mucinous adenocarcinoma based on data extracted from the Surveillance, Epidemiology and End Result (SEER) database. Data collected between 2010 and 2018 were obtained from the SEER database. The log-rank test and multivariate Cox regression were performed to identify the independent prognostic factors for overall survival, which were further used to construct a nomogram model to predict 1-, 3-, and 5-year overall survival. In total, 10846 patients diagnosed with colorectal mucinous adenocarcinoma were enrolled in the study. The following 11 variables were associated with survival and were further incorporated into the nomogram: age at diagnosis, primary site, grade, tumour size, lymph node dissection, T stage, N stage, M stage, surgery for primary site, chemotherapy, and household income. The concordance index (C-index) value was 0.725 (95% confidence interval 0.716-0.734), and the receiver operating characteristic curves and calibration curves showed satisfactory predictive accuracy. Both the C-index and time-independent area under the curve values were greater than those of the American Joint Committee on Cancer 7th TNM classification system (both P < 0.001). In the validation group, the results were consistent with those of the training group, with a C-index value of 0.726 (95% confidence interval, 0.713-0.739). This study constructed a practical nomogram to predict 1-, 3-, and 5-year OS for patients with colorectal colorectal mucinous adenocarcinoma based on SEER data.

11.
Adv Sci (Weinh) ; : e2204814, 2022 Nov 14.
Artigo em Inglês | MEDLINE | ID: mdl-36373730

RESUMO

Extracellular vesicles (EVs) have increasingly been recognized as important cell surrogates influencing many pathophysiological processes, including cellular homeostasis, cancer progression, neurologic disease, and infectious disease. These behaviors enable EVs broad application prospects for clinical application in disease diagnosis and treatment. Many studies suggest that EVs are superior to conventional synthetic carriers in terms of drug delivery and circulating biomarkers for early disease diagnosis, opening up new frontiers for modern theranostics. Despite these clinical potential, EVs containing diverse cellular components, such as nucleic acids, proteins, and metabolites are highly heterogeneous and small size. The limitation of preparatory, engineering and analytical technologies for EVs poses technical barriers to clinical translation. This article aims at present a critical overview of emerging technologies in EVs field for biomedical applications and challenges involved in their clinic translations. The current methods for isolation and identification of EVs are discussed. Additionally, engineering strategies developed to enhance scalable production and improved cargo loading as well as tumor targeting are presented. The superior clinical potential of EVs, particularly in terms of different cell origins and their application in the next generation of diagnostic and treatment platforms, are clarified.

12.
J Neurooncol ; 2022 Nov 03.
Artigo em Inglês | MEDLINE | ID: mdl-36329368

RESUMO

PURPOSE: To determine if loss of H3K27me3 could predict higher risk of re-recurrence in recurrent meningiomas. METHODS: A retrospective, single-center cohort study was performed for patients who underwent resection of recurrent grade 1 (N = 132) &2 (N = 32) meningiomas from 2009 to 2013. Association of H3K27me3 staining and clinical parameters was analyzed. Additionally, H3K27me3 staining was performed from 45 patients whose tumors recurred and were resected during the follow-up, to evaluate H3K27me3 change during tumor progression. Survival analysis was performed as well. RESULTS: Loss of H3K27me3 expression was observed in 83 patients, comprising 63 grade 1 (47.7%) and 20 grade 2 patients (62.5%). Both grade 1 (p < 0.001) and grade 2 recurrent meningiomas (p < 0.001) had a higher frequency of H3K27me3 loss, compared to de novo meningiomas. 8 of 27 tumors with retained H3K27me3 lost H3K27me3 during re-recurrence (29.6%), while no gain of H3K27me3 was observed in progressive disease from 18 tumors with H3K27me3 loss. Loss of H3K27me3 expression was associated with an earlier re-recurrence in recurrent meningiomas grade 1 and 2 (p < 0.001), and was an independent prognostic factor for PFS in recurrent grade 1 meningiomas (p = 0.005). CONCLUSION: Compared to primary meningiomas, recurrent meningiomas more predominantly had loss of H3K27me3 expression, and further loss can occur during the progression of recurrent tumors. Our results further demonstrated that loss of H3K27me3 predicted shorter PFS in recurrent grade 1 and grade 2 meningiomas. Our work thus supports clinical testing of H3K27me3 in recurrent meningiomas WHO grade 1 and 2.

13.
Medicine (Baltimore) ; 101(44): e31240, 2022 Nov 04.
Artigo em Inglês | MEDLINE | ID: mdl-36343066

RESUMO

RATIONALE: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. PATIENT CONCERNS: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. DIAGNOSES: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). INTERVENTIONS: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. OUTCOMES: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. LESSONS: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.


Assuntos
Deficiência de Antitrombina III , Trombofilia , Trombose , Masculino , Humanos , Adolescente , Varfarina/uso terapêutico , Deficiência de Antitrombina III/complicações , Deficiência de Antitrombina III/genética , Deficiência de Antitrombina III/tratamento farmacológico , Trombofilia/tratamento farmacológico , Veia Cava Inferior , Anticoagulantes , Heparina , Mutação , Trombose/tratamento farmacológico , Antitrombinas , Antitrombina III/genética
14.
ACS Sens ; 2022 Nov 16.
Artigo em Inglês | MEDLINE | ID: mdl-36383027

RESUMO

Early diagnosis and therapy are clinically crucial in decreasing mortality from breast carcinoma. However, the existing probes have difficulty in accurately identifying the margins and contours of breast carcinoma due to poor sensitivity and specificity. There is an urgent need to develop high-sensitive fluorescent probes for the diagnosis of breast carcinoma and for differentiating tumors from normal tissues during surgery. ß-Galactosidase is a significant biomarker, whose overexpression is closely associated with the progression of breast tumors. Herein, we have constructed a ß-galactosidase-activated fluorescent probe NIR-ßgal-2 through rational design and molecular docking engineering simulations. The probe displayed superior sensitivity (detection limit = 2.0 × 10-3 U/mL), great affinity (Km = 1.84 µM), and catalytic efficiency (kcat/Km = 0.24 µM-1 s-1) for ß-galactosidase. Leveraging this probe, we demonstrated the differentiation of cancer cells overexpressing ß-galactosidase from normal cells and then applied the probe for intraoperative guided excision of breast tumors. Moreover, we exhibited the application of NIR-ßgal-2 for the successful resection of orthotopic breast tumors by "in situ spraying" and monitored a good prognostic recovery. This work may promote the application of enzyme-activated near-infrared fluorescent probes for the development of carcinoma diagnosis and image-guided surgery.

15.
Am J Trop Med Hyg ; 2022 Nov 14.
Artigo em Inglês | MEDLINE | ID: mdl-36375456

RESUMO

Hemophagocytic lymphohistiocytosis (HLH) is a rare and fatal complication of visceral leishmaniasis (VL). To provide a basis for early and correct diagnosis and to improve prognosis in the future, we describe a case series of VL-associated HLH in adults in our center in the past decade after review of all reported cases of adult VL-associated HLH in English through May 2022. In our case series, a total of 111 patients were diagnosed with VL. Among these patients, only six cases were diagnosed with VL-associated HLH. All patients tested positive for serology. Leishmania was detected for the first time by bone marrow aspiration (BMA) in three of the six patients and in the other three patients after three or four BMAs. It took more than 1 month from onset to diagnosis of VL for all the six cases, and the longest time was 6 months. Five of the six patients recovered after receiving sodium stibogluconate. VL-associated HLH is rare but potentially life-threatening in adults and predisposes to early delays in diagnosis. However, diagnostic techniques are not complicated or difficult, so it is more important to consider that it is not recognized by physicians. Although guidelines recommend liposomal amphotericin B as the most effective therapy, our experience suggests that sodium stibogluconate can be an alternative option when liposomal amphotericin B is unavailable or unaffordable.

16.
Sci Rep ; 12(1): 19687, 2022 Nov 16.
Artigo em Inglês | MEDLINE | ID: mdl-36385115

RESUMO

During the spring thawing, the decrease of soil-ice interface strength by temperature may lead to slope instability. For this reason, some researchers have explored the relationship between temperature and soil-ice interface strength. However, previous studies have not systematically explored the change law of strength at the soil-ice interface from negative temperature to 0 °C. Therefore, direct shear tests were conducted at different shear temperatures and different moisture contents. The effects of temperature and moisture content on strength, cohesion, and internal friction angle are analyzed, while the shear failure mechanism of specimens at different temperatures is discussed according to the location of the shear failure surface. The results show that: Shear properties of soil ice specimens are related to the unfrozen moisture content. The strength of the sample decreases with increasing temperature, and the change in strength is most significant from - 2 to - 0 °C. The strength reduction in this range is from 21.8 to 74.8%, and the higher the moisture content the more obvious this phenomenon is. The shear index tends to decrease with the increase of unfrozen water content, and the greater the increase of unfrozen water, the faster the decrease of both, especially in stage 2. When the temperature is higher than - 5℃, the failure surface is located above the soil-ice interface, and the strength of the specimen is similar to that of the frozen soil. When the temperature is - 10℃, the shear damage surface appears at the soil-ice interface, and the strength of the specimen is determined by the strength of the soil-ice interface.

17.
Front Cell Infect Microbiol ; 12: 990197, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36389154

RESUMO

Diagnosis and treatment of latent tuberculosis infection (LTBI) is critical to tuberculosis (TB) control. Identifying the risk factors associated with LTBI can contribute to developing an optimized strategy for LTBI management. We conducted a survey of adults aged 65 years and older living in rural areas in Zhejiang Province during July 2021, followed by a one-year follow-up period to determine TB incidence. Participants underwent a physical examination and 5-6 mL of blood was drawn to test for Mycobacterium tuberculosis infection A total of 1856 individuals participated in the study, of whom 50.5% were men and 80.1% were married. Most participants (96.8%) often opened windows for ventilation at home. One-third (33.4%) of participants had abnormal chest radiographs and 34.9% had LTBI. Nine participants (0.5%) developed active TB patients during the one-year follow-up period. People who frequented closed entertainment places such as chess and card rooms had a relatively high percentage of LTBI (39.5%). Factors associated with a higher risk of LTBI in multivariable logistic regression analysis included being male (odds ratio [OR]:1.32; 95% confidence interval [CI] =:1.01-1.72), smoking (OR: 1.43; 95% CI:1.04-1.97), not opening windows for ventilation at home frequently (OR: 1.88; 95% CI: 1.10-3.22), and abnormal chest radiographs (OR; 1.48; 95% CI; 1.20-1.81). LTBI was prevalent among the elder adults living in high-epidemic rural areas of TB in Zhejiang province. Men, people who smoke, and people without the habit of ventilating at home should be targeted for LTBI screening to accelerate the decline of the TB epidemic in Zhejiang Province.


Assuntos
Tuberculose Latente , Tuberculose , Adulto , Humanos , Masculino , Idoso , Feminino , Tuberculose Latente/diagnóstico , Tuberculose Latente/epidemiologia , Tuberculose/diagnóstico , Tuberculose/epidemiologia , China/epidemiologia , Incidência , Fatores de Risco
18.
Biosensors (Basel) ; 12(11)2022 Nov 04.
Artigo em Inglês | MEDLINE | ID: mdl-36354480

RESUMO

Honey is a natural product and is heavily consumed for its well-known nutritional functions. Honeys with different floral origins possess distinctive flavors, tastes, functions and economic values. It is vital to establish an effective strategy for identifying the authenticity of honey. The intrinsic genetic materials of pollen were adopted as target analytes for the effective identification of honey with floral origins. With an optimized protocol for the rapid gene extraction from honey, target genetic templates were amplified on-site with a portable device. Conveniently, all on-site amplified functional products were easily judged by the designed lateral flow strip (LFS), which was defined as the molecular LFS in this research. Additionally, the entire on-site genetic authentication of honey was completed in less than 2 h by visual observation. Commercial honey products have been successfully identified with excellent accuracy. This low-cost, high-efficiency and easy-operational strategy will greatly benefit the quality guarantee of foods with specific functions and geographical markers.


Assuntos
Análise de Alimentos , Mel
19.
Polymers (Basel) ; 14(22)2022 Nov 21.
Artigo em Inglês | MEDLINE | ID: mdl-36433165

RESUMO

Natural fibers and their composites have attracted much attention due to the growing energy crisis and environmental awareness. In this work, a natural lignocellulosic fiber was extracted from cow dung waste and its potential use as reinforcing material in resin-based polymer composites was evaluated. For this purpose, cow dung fiber-reinforced composites (CDFC) were fabricated, and their mechanical and morphological properties were systematically investigated and compared with corn stalk fiber composites (CSFC) and sisal fiber composites (SFC). The results showed that the addition of cow dung fibers reduced the density of the polymer composites, increased the water absorption, and enhanced the impact strength and shear strength. The highest impact and shear strengths were obtained at 6 wt.% and 9 wt.% of fiber loading, respectively, which increased by 23.8% and 34.6% compared to the composite without the fibers. Further comparisons revealed that at the same fiber addition level, the CDFC exhibited better mechanical properties than the CSFC; notably, the CDFC-3 (adding 3 wt.% of fiber loading) had an impact strength closer to the SFC-3. Furthermore, an SEM analysis suggested that the cow dung fibers exhibited a rough and crinkly surface with more node structures, and presented good interfacial bonding with the composite matrix. This work revealed that cow dung fibers are a promising candidate as reinforcement for resin-based polymer composites, which promotes an alternative application for cow dung waste resources in the automotive components field.

20.
Asian J Neurosurg ; 17(3): 521-526, 2022 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-36398175

RESUMO

Low-grade, sporadic, pilocytic astrocytomas (PAs) are rare spinal cord tumors diagnosed in adult patients. Their localization to the conus medullaris is exceedingly rare, having only been described in a limited number of case reports. Here, we describe a case of a 22-year-old female presenting with back pain, lower extremity weakness, hypoesthesia, and urinary incontinence. Imaging studies demonstrated a cystic lesion of the conus medullaris that was treated with subtotal resection and cyst-subarachnoid shunt placement. Final pathology report confirmed PA from the histology of surgical specimens. We discuss the current literature of conus medullaris lesions and their differential diagnosis.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...